Peanut gene editing method based on CRISPR / Cas9 and carrier thereof

Abstract

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR / Cas9)-based peanut gene editing method, which comprises the following steps: knocking out a peanut AhMULE gene by using a CRISPR / Cas9 gene editing technology, and cultivating transgenic peanuts by using a pollen tube channel conversion method so as to obtain an AhMULE-knocked-out peanut plant. Experimental research shows that the peanut AhMULE gene has the function of regulating and controlling peanut growth, so that a peanut gene editing material which grows ahead of time can be obtained by applying the method, valuable gene resources and germplasm resources are provided for peanut breeding, a solid foundation is laid for peanut variety breeding work, and the method has a wide application prospect. Meanwhile, the development of peanut gene engineering is promoted, and the method has important significance on further developing peanut breeding work of high-quality genes.

Description

Technical Field

[0001] The present invention belongs to the technical field of peanut breeding, and in particular relates to a peanut gene editing method based on CRISPR / Cas9 and a vector thereof. Background Art

[0002] Peanut is an oilseed and cash crop widely grown worldwide, rich in oil and protein. At present, the selection and breeding of peanut varieties is mainly carried out through conventional breeding methods, but the genetic basis of varieties bred by traditional methods is narrow, and the excellent traits of wild peanut resources are difficult to utilize due to factors such as hybrid incompatibility. Modern genetic engineering technology can introduce exogenous genes into plants, artificially select target trait genes, and achieve rapid variety improvement. CRISPR / Cas9, as the latest gene editing technology, is an RNA-guided Cas9 protein nuclease that cuts and modifies the targeted genome at specific sites, thereby achieving gene knockout, insertion, replacement and chromosome recombination. As an important tool for studying gene function in reverse genetics, it has the characteristics of simple vector construction and high targeting specificity. In addition, mutants created by CRISPR / Cas9 gene editing technology can remove the vector through self-fertilization, and such mutants with removed vectors are expected to be used in molecular breeding.

[0003] Agrobacterium transformation is the most commonly used method in plant genetic engineering research, with advantages such as low cost and low number of introduced gene copies. Peanut is a dicotyledonous plant, one of the natural hosts of Agrobacterium, and is self-pollinating. Although peanut genetic transformation has made some progress in recent years, the currently constructed peanut genetic transformation system has problems such as long transformation cycle and low transformation efficiency. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a peanut gene editing method based on CRISPR / Cas9 and its vector, which will promote the development of peanut genetic engineering and is of great significance for further carrying out peanut breeding work with high-quality genes.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] The peanut gene editing method based on CRISPR / Cas9 uses CRISPR / Cas9 gene editing technology to knock out the peanut AhMULE gene, and then the pollen tube channel transformation method is used to cultivate transgenic peanuts, thereby obtaining AhMULE knockout peanut plants.

[0007] The above peanut gene editing method comprises the following steps:

[0008] <1> Construction of CRISPR / Cas9 expression vector of peanut AhMULE gene;

[0009] <2> Obtaining peanut mutants by CRISPR / Cas9 gene editing of peanut AhMULE gene.

[0010] Step 1: Follow the steps below:

[0011] Amplify the gRNA target sequence,

[0012] Golden Gate clone,

[0013] Transformed into E. coli DH5α competent cells,

[0014] Sequencing bacterial detection and sequencing,

[0015] The plasmid was transformed into Agrobacterium GV3101 competent cell.

[0016] In amplifying the gRNA target sequence, the target sequence is the base sequence of SEQ.ID.NO.2 in the sequence list, and the primer sequences used for amplification are the base sequences of SEQ.ID.NO.3 and 4 in the sequence list.

[0017] Step <2> is performed as follows: the infection solution is prepared by using the positive clone solution obtained by screening the competent Agrobacterium GV3101 in step <1>, and genetic transformation is performed using the Agrobacterium-mediated pollen tube pathway method to obtain peanut mutants.

[0018] The above-mentioned CRISPR / Cas9-based peanut gene editing method and the application of the obtained peanut plants in peanut breeding.

[0019] The peanut AhMULE gene has the base sequence of SEQ.ID.NO.1 in the sequence listing.

[0020] Application of peanut AhMULE gene in regulating peanut growth.

[0021] In view of the problems existing in traditional peanut breeding, the inventors have established a peanut gene editing method based on CRISPR / Cas9, using CRISPR / Cas9 gene editing technology to knock out the peanut AhMULE gene, and then using the pollen tube channel transformation method to cultivate transgenic peanuts, thereby obtaining peanut plants with AhMULE knockout. Experimental studies have shown that the peanut AhMULE gene has the function of regulating the growth of peanuts. Therefore, the application of the present invention can obtain peanut gene editing materials with early growth, providing valuable gene resources and germplasm resources for peanut breeding, laying a solid foundation for the breeding of peanut varieties, and promoting the development of peanut genetic engineering, which is of great significance for the further development of peanut breeding with high-quality genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1This is a schematic diagram of the target site and vector construction of the AhMULE gene induced by CRISPR / Cas9, in which: a: schematic diagram of the target site; b: schematic diagram of the vector construction.

[0023] Figure 2 This is a photo of Agrobacterium-mediated pollen tube transformation of peanut by injecting bacterial solution through puncturing the keel petal. In the photo: a: the flower to be injected; b: the injected keel petal.

[0024] Figure 3 This is a diagram of the AhMULE gene sequence inspection results in cloned gene-edited mutant plants. In the figure: M: 2000bp Marker; 1 and 2: CRISPR / Cas9-AhMULE mutant peanut plants.

[0025] Figure 4 This is the sequencing result of the target site area of ​​CRISPR / Cas9 editing AhMULE copy mutant.

[0026] Figure 5 This is a graph showing the growth phenotype results of CRISPR / Cas9 gene editing mutants, including: WT wild plants, Cas9-AhMULE-2, -3 mutant peanut plants of different strains. DETAILED DESCRIPTION

[0027] In order to illustrate how to implement the present invention, the following examples are provided.

[0028] 1. Construction of CRISPR / Cas9 expression vector for peanut AhMULE gene

[0029] 1. Selection of sg RNA target sites

[0030] Use the online tool CRISPR RGEN Tools (http: / / www.rgenome.net / cas-database / ) to predict the specificity of the target site, such as Figure 1 As shown, the sg RNA sequence of AhMULE is located at 306-328 bp in the full length of the sequence.

[0031] sg RNA upstream and downstream primer design:

[0032] Targeting peanut gene AhMULE: GTTCAGGAAGGGGTATCTCACGG

[0033] Primers were designed based on TGG (PAM sequence) as an example. The primer sequences are as follows:

[0034] F:cagtGGTCTCatgca GTTCAGGAAGGGGTATCTCA

[0035] R:cagtGGTCTCaaaacTGAGATACCCCTTCCTGAAC

[0036] 2. Construction of CRISPR / Cas9 expression vector and Agrobacterium transformation

[0037] ① Amplify gRNA target sequence

[0038] Target amplification system (20μL)

[0039] 2×BioRun Pfu PCR Mix (10μM)

[0040] F(10μM)1μL

[0041] R(10μM)1μL

[0042] ddH2O 8μL

[0043] PCR conditions:

[0044]

[0045] ②Golden Gate clone

[0046]

[0047]

[0048] After the above system is evenly mixed, centrifuge briefly, and immediately incubate at 37°C for 30-60 min, heat at 65°C for 20 min to terminate the reaction, and transfer to ice for later use.

[0049] ③Transform into E. coli DH5α competent cells

[0050] Thaw the competent cells (DH5α) on ice, take 5-10 μL of the enzyme-cut ligation product, add it to 100 μL of competent cells, flick the tube wall several times to mix, and place it on ice for 30 minutes. Heat shock at 42℃ for 60 seconds, and ice bath for 3 minutes. Add about 500 μL of antibiotic-free LB medium, shake and culture at 37℃, 200rpm for 60 minutes. Take an appropriate volume of bacterial liquid and evenly spread it on a plate with kanamycin antibiotics, and place the plate upside down at 37℃ incubator for overnight culture.

[0051] ④ Sequencing bacterial detection and sequencing

[0052] Pick 3-5 single clones and perform colony PCR verification using 2×BioRun Pfu PCR Mix. Amplification primers: TNOS-7265+: CGTTATTTATGAGATGGGTTTT; Pbw2-: gcgattaagttgggtaacgccaggg; select the target band of 1064bp, and sequence the positive clones with the correct size and brightness to confirm.

[0053] Sequencing primer U6cef: TACAGCTAGAGTCGAAGTAG.

[0054] ⑤Extract plasmid and transform it into Agrobacterium GV3101 competent cell

[0055] Place 100 μL of Agrobacterium competent medium on ice for 30 min, add 2-5 μL of plasmid, mix well, and place on ice for 5 min, quick freeze in liquid nitrogen for 5 min, incubate in a 37°C water bath for 5 min, add 500 μL of LB antibiotic-free medium, and culture at 28°C, 220 rpm, with shaking for 3 h.

[0056] Results: The positive bacterial solution containing the target gene was successfully obtained.

[0057] 2. Acquisition and identification of peanut AhMULE gene CRISPR / Cas9 gene-edited peanut mutants

[0058] 1. Obtaining peanut mutants through Agrobacterium-mediated pollen tube pathway genetic transformation

[0059] ①Peanut variety used: Zhonghua No. 2.

[0060] ② Take large and plump medium-flowered No. 2 peanuts and culture them in a sand box in the dark for 3 days, then peel off the seed coat, use Hoagland's culture solution to hydroponically culture them in an incubator at a constant temperature of 26°C for about two weeks, with 16 hours of light and 8 hours of darkness, then transplant them into sterilized substrate soil until they bloom.

[0061] ③The primers used in each step are shown in Table 1.

[0062] Table 1 Primer list

[0063]

[0064]

[0065] ④Injection

[0066] At the beginning of flowering, remove the flowers that have opened that day every morning to prevent the peanuts from setting fruit. The number of flowers that bloom after setting fruit is reduced. Remove the flowers in the morning for 10 consecutive days, and judge the peak flowering period of peanuts according to the weather. The peak flowering period of peanuts will be delayed in bad weather, and injection will begin at the peak flowering period. Take out the prepared bacterial solution the night before the injection, take about 200 μL of the bacterial solution and culture it in 10 mL of YEP liquid culture medium containing 50 mg / L kanamycin (Kan), 50 mg / L rifampicin (Rif) and 50 mg / L streptomycin (Str), and shake the bacteria at 28°C and 250 rpm for about 10 hours. Take out the bacterial solution the next morning, and use a spectrophotometer to measure the OD of the bacterial solution 600 , so that it reaches 0.8, 4000rpm, 28℃ centrifuge the bacterial solution, discard the supernatant, use the infection solution to resuspend the bacteria, and the infection solution should be prepared and used immediately.

[0067] Inject before 8 am, shake the bacterial solution before injection, inject the flowers that are in full bloom on the day, hold the flower in one hand, gently open the wing petals with the thumb and index finger, and the keel petals are wrapped in the wing petals; puncture the keel petals with a 1mL syringe in one hand and inject the bacterial solution into the keel petals, and continue the injection for 10-15 days ( Figure 2 ). After the injection is completed, continue to pick the flowers that have opened on the day every morning until the injected flowers are needled and fruited, and mark the needled fruit.

[0068] 2. Identification of peanut mutants using CRISPR / Cas9 gene editing of the peanut AhMULE gene

[0069] After harvesting T0 generation seeds, they were cultured in a sand box in the dark for 3 days, then the seed coat was peeled off and the seeds were cultured in a 26°C incubator with Hoagland medium until the third and fourth true leaves grew. Leaves at the same position were selected to extract DNA for PCR verification. The amplification primers were: AhMULE-F: ATGACTAATCAAGATTTGATACTTGGTCA; AhMULE-R: GATGGGAGCTGCACATGTGG ( Figure 3 ), sent for testing, and found that the mutation was at the target site, such as Figure 4 .

[0070] Results: Peanut varieties with cas9 gene editing were successfully screened.

[0071] 3. Verification of the effect of the peanut AhMULE gene on peanut growth

[0072] After 15 days of hydroponic culture, the differences in growth between the wild type peanut and the CRISPR / Cas9 gene-edited mutants (strains: cas9-AhMULE-2, -3) were observed. Figure 5 ), and found that Cas9-AhMULE delayed the growth of peanuts.

Claims

1. A peanut gene editing method based on CRISPR / Cas9, characterized in that The AhMULE gene of peanut was knocked out using CRISPR / Cas9 gene editing technology, and then the pollen tube transformation method was used to cultivate transgenic peanuts, thus obtaining AhMULE knocked-out peanut plants.

2. The peanut gene editing method according to claim 1, characterized in that The following steps are involved: <1> Construction of CRISPR / Cas9 expression vector of peanut AhMULE gene; <2> Obtaining peanut mutants by CRISPR / Cas9 gene editing of peanut AhMULE gene.

3. The peanut gene editing method according to claim 2, characterized in that Step 1: Follow the steps below: ① Amplify the gRNA target sequence, ②Golden Gate clone, ③Transform into competent E. coli DH5α, ④ Sequencing bacterial detection and sequencing, ⑤Transform the plasmid into competent Agrobacterium GV3101.

4. The peanut gene editing method according to claim 2, characterized in that: In the amplified gRNA target sequence, the target sequence is the base sequence of SEQ.ID.NO.2 in the sequence list, and the primer sequences used for amplification are the base sequences of SEQ.ID.NO.3 and 4 in the sequence list.

5. The peanut gene editing method according to claim 2, characterized in that Step <2> is performed as follows: the infection solution is prepared by using the positive clone solution obtained by screening the competent Agrobacterium GV3101 in step <1>, and genetic transformation is performed using the Agrobacterium-mediated pollen tube pathway method to obtain peanut mutants.

6. The peanut gene editing method based on CRISPR / Cas9 as described in claim 1 and the use of the obtained peanut plants in peanut breeding.

7. Peanut AhMULE gene, characterized by It has the base sequence of SEQ.ID.NO.1 in the sequence listing.

8. Use of the peanut AhMULE gene according to claim 7 in regulating peanut growth.

Images