Breeding method of mackerel mackerel

Abstract

The invention provides a mackerel mackerel breeding method, which comprises the following steps: analyzing microsatellite primer amplification products of a rapid growth group and a slow growth group of squalane squalane to screen molecular markers linked with growth traits, and screening parents for genetic breeding of squalane squalane by using the screened molecular markers. The microsatellite marker linked with the growth traits of the squalane squalane is obtained by analyzing amplification products of the squalane squalane varieties with different growth traits, and the microsatellite marker can be used for screening squalane squalane individuals with better growth potential, so that an effective molecular marker is provided for genetic breeding operation of the squalane squalane.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic breeding and seedling cultivation of aquatic species, and specifically relates to a breeding method for blue-spotted Spanish mackerel. Background Art

[0002] The blue-spotted Spanish mackerel (Scomberomorus niphonius) is a species of the genus Scomberomorus of the family Scomberidae. It is mainly distributed in the Bohai Sea, the Yellow Sea, and the East China Sea in China. It is also distributed in the waters south of Hokkaido, Japan, the waters of the Korean Peninsula, and the warm waters of the northwest Pacific Ocean. It mainly inhabits the middle and upper layers of the nearshore waters. The blue-spotted Spanish mackerel is an important economic fish species among the targets of China's marine fishing, and is a key fish species for research and management of fishery resources in southern China. The liver of the blue-spotted Spanish mackerel is the raw material for extracting cod liver oil. Its meat is firm, delicious, and nutritious, and it is often used as a table delicacy and is deeply loved by people.

[0003] Growth traits are important economic traits in fish genetic breeding. In recent years, molecular markers related to fish traits have been discovered and reported one after another. Zhang Yifeng et al. reported molecular markers related to carp weight, body length, and height; Xu Meijia et al. isolated molecular markers related to carp snout length, head length, tail length, and eye spacing; Zhang Libo et al. analyzed 10 markers related to feed conversion rate in Carp. However, there are few studies on molecular markers related to the growth shape of blue-spotted Spanish mackerel. Summary of the invention

[0004] The purpose of the present invention is to provide a breeding method for blue-spotted Spanish mackerel, that is, by analyzing the microsatellite primer amplification products of a fast-growing population and a slow-growing population of blue-spotted Spanish mackerel to screen molecular markers linked to growth traits, and using the screened molecular markers to screen parents for genetic breeding of blue-spotted Spanish mackerel.

[0005] The present invention first provides a molecular marker linked to the growth traits of Spanish mackerel, wherein the molecular marker is a microsatellite locus JS-3, and its nucleotide sequence is as follows:

[0006] AACTGTACACTAGAATGGAACATGCTAGCTATCCTGTTATACAG

[0007] TAGAATCTACGAGACCACAGAGTCAACTCCTTCTCACTTGTGAGAAT

[0008] CCAAACAATTCAAACAATT TATATATATATATATATATA TGACACTAACAT

[0009] GTTATTAGTAGTACCTGTACATCCAAAGGCCATACGTCACTAAGCCA

[0010] CCACGTTACTAGAGCAC(SEQ ID NO:1);

[0011] The microsatellite marker has a core repeat sequence (TA) n, where n is a natural number ranging from 7 to 10;

[0012] In another aspect, the present invention provides a use of the molecular marker in screening blue-spotted Spanish mackerel individuals with growth advantages;

[0013] The present invention also provides a method for screening blue-spotted Spanish mackerel parents, wherein the method is to detect the specific fragments of the above-mentioned molecular markers to screen the blue-spotted Spanish mackerel parents, wherein the length of the specific fragment of the microsatellite site JS-3 is 192 bp.

[0014] The method described herein is a PCR amplification method, wherein the primer pair for detecting JS-3 has the following sequence information:

[0015] Forward primer F: ACTGTACACTAGAATGGAACATGC (SEQ ID NO: 2), reverse primer R: CGTGGTGGCTTAGTGACGTA (SEQ ID NO: 3).

[0016] In yet another aspect, the present invention provides a method for cultivating blue-spotted Spanish mackerel fry with rapid growth potential, wherein the method comprises using the blue-spotted Spanish mackerel selected by the above method as a parent to cultivate fry.

[0017] The present invention obtains microsatellite markers linked to the growth traits of blue-spotted Spanish mackerel by analyzing amplification products of blue-spotted Spanish mackerel varieties with different growth traits. The microsatellite markers can be used to screen blue-spotted Spanish mackerel individuals with better growth potential, thereby providing effective molecular markers for the genetic breeding operation of blue-spotted Spanish mackerel. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :Data bar chart of growth traits of blue-spotted Spanish mackerel;

[0019] Figure 2 :Genomic DNA electrophoresis detection results;

[0020] Figure 3 : Fractal diagram of microsatellite locus JS-3 gene in the slow growth group (188 / 190);

[0021] Figure 4 : Fractal diagram of microsatellite locus JS-3 gene in the fast-growing group (192 / 192);

[0022] Figure 5:The data bar graph of growth traits of one-year-old blue-spotted Spanish mackerel in microsatellite marker group and other groups;

[0023] Figure 6 : Bar chart of growth data of one-year-old offspring bluespot mackerel. DETAILED DESCRIPTION

[0024] Microsatellite DNA is a simple repetitive sequence widely present in the genomes of eukaryotes and prokaryotes. The distribution of microsatellite markers in different regions of the genome varies greatly, and most of them are enriched in non-coding regions. Due to the advantages of microsatellite genetic markers such as high polymorphism, rich information content, and co-dominance, they are widely used in the location of QTLs for quantitative traits of biological species, the construction of genetic linkage maps, and DNA fingerprint analysis. Microsatellite markers have developed into one of the commonly used molecular markers in the field of aquatic animal breeding.

[0025] The present invention takes the blue-spotted Spanish mackerel as the research object, screens from microsatellite primers, obtains markers significantly correlated with the body length, body height and weight growth traits of the blue-spotted Spanish mackerel, and uses them to screen blue-spotted Spanish mackerel parent individuals with growth advantages.

[0026] The present invention is described in detail below in conjunction with embodiments and drawings.

[0027] Example 1: Establishing a fast-growing population of blue-spotted Spanish mackerel

[0028] The healthy and intact 4-5cm long blue-spotted Spanish mackerel fry cultivated by Ningbo Institute of Oceanography and Fishery are released into the breeding pond. The water temperature is maintained at 25-30 degrees Celsius, the salinity is maintained at 32-35‰, the pH value is between 6-8, the water quality is kept clear, and indicators such as ammonia nitrogen and nitrite are tested regularly to maintain stable water quality.

[0029] After 7 months of breeding, 300 healthy blue-spotted Spanish mackerels were randomly selected, and their body length and height were measured using a vernier caliper with an accuracy of ±0.02 mm. The surface moisture was wiped off and the body mass (Y, g) was weighed using a balance with an accuracy of ±0.01 g. Individuals with excellent body shape were selected as parents for offspring breeding. From the same batch of bred one-year-old blue-spotted Spanish mackerels, 50 individuals with larger body mass (faster growth group) and 50 individuals with smaller body mass (slow growth group) were selected to measure morphological traits. The measurement data are shown in Tables 1 and Figure 1 The results showed that there were significant differences in the growth traits of individuals in the faster growing group and the slower growing group.

[0030] Table 1: Average data of growth characteristics of blue-spotted Spanish mackerel

[0031]

[0032] Example 2: Screening of microsatellite markers associated with growth traits of Spanish mackerel

[0033] 1. Screening of microsatellite loci that can amplify products

[0034] By screening the microsatellite loci of blue-spotted Spanish mackerel from NCBI, a primer pair for amplifying the microsatellite loci was designed, and the designed primer pair was synthesized, and the 5′ end of the forward primer was labeled with fluorescein. The synthesized primer pair was used to perform preliminary amplification product screening using the genomic DNA of blue-spotted Spanish mackerel, and the sequence information of the microsatellite primer pair with amplified products is shown in Table 2.

[0035] Table 2: Blue-spotted Spanish mackerel microsatellite primer information

[0036]

[0037] 2. Polymorphism amplification in fast-growing and slow-growing Spanish mackerel

[0038] (1) Sample preparation: After rinsing the fins with ultrapure water, cut a small amount of fin tissue. The extraction amount should not exceed 20 mg.

[0039] (2) Sample pretreatment: Place the cut sample into a centrifuge tube containing a specific buffer solution, add an appropriate amount of proteinase K solution, vortex and oscillate for a period of time, and then treat in a 56°C water bath for a certain period of time.

[0040] (3) Sample lysis: Add appropriate amount of anhydrous ethanol, continue shaking, and then place in a 56°C water bath for a certain period of time.

[0041] (4) Protein removal: Add RNase A solution (as needed), shake again, and leave at room temperature for a few minutes.

[0042] (5) Proteinase K treatment: Add proteinase K solution, shake to mix, and then treat in a 56°C water bath for a certain period of time.

[0043] (6) Add isopropanol and chloroform: Transfer the supernatant to a new centrifuge tube, add appropriate amounts of isopropanol and chloroform, shake to mix, and then centrifuge at 12,000 rpm (about 13,400 g) for a few minutes.

[0044] (7) Further separation of DNA: The supernatant is transferred to an adsorption column, a specific buffer is added, and the mixture is centrifuged at 12,000 rpm for a few minutes. The contents of the adsorption column are then transferred to another collection tube.

[0045] (8) Rinsing and concentration: Add the substance in the adsorption column to a new adsorption column and add different buffers in sequence for rinsing until the desired DNA concentration is reached.

[0046] Mix 5 μL of DNA sample with 5× loading buffer (6× Loding buffer), mix well with a pipette, then load on a 1.5% agarose gel stained with nucleic acid dye, electrophoresed at 4 V / cm for 20 min, observe and photograph in a gel imaging system, and use the OD260 / OD280 ratio to determine the purity and quality of the DNA.

[0047] The extracted DNA samples were subjected to agarose gel electrophoresis and the DNA concentration was detected using an enzyme marker. The results showed that the bands were clear and the extraction quality was good. The 260 / 280 value was between 1.8 and 2.0, which met the requirements of subsequent experiments ( Figure 2 ).

[0048] 3. Microsatellite amplification of DNA templates from the fast-growing group and the slow-growing group

[0049] PCR amplification was performed using different primers and sample genomic DNA. The PCR reaction system was 25 μl: ddH2O 17.75 μl, 10× Buffer 2.5 μl, dNTP 2.0 μl, primers 0.5 μl each, DNA sample 1.5 μl, Taq 1.25 U. PCR reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 56°C renaturation for 30 s, 72°C extension for 1.5 min, 30 cycles in total; 72°C thorough extension for 10 min. The PCR product was stored at 4°C for later use, and detected and analyzed by polyacrylamide gel electrophoresis and silver staining.

[0050] Cervus3.0 software (Cervus) was used to count the number of alleles (k), expected heterozygosity (He), observed heterozygosity (Ho) and polymorphic information content (PIC) at different loci in the two populations. SPSS22.0 software was used for linear regression analysis of the association between different microsatellite loci and growth traits in the two silver carp populations. The loci with significant differences in growth traits were preliminarily determined. The general linear model (GLM) was then used to perform multiple comparisons of the observed means of the univariate variables of the preliminarily determined loci to determine whether there were significant differences between different genotypes at the same microsatellite locus. P < 0.05 was considered significant. In order to exclude contingency, each genotype was counted only when it had at least 3 observations when SPSS22.0 software was used for analysis.

[0051] The results are shown in Table 3. A total of 41 alleles were amplified from the 10 microsatellite loci in the templates of the fast-growing group, while a total of 27 alleles were detected in the templates of the slow-growing group.

[0052] Table 3: Information on SSR polymorphic loci related to growth traits of blue-spotted Spanish mackerel

[0053]

[0054] 4. Microsatellite locus markers related to growth

[0055] Three of the 10 microsatellite loci were significantly associated with growth traits (Table 4). A total of 15 genotypes were established using three microsatellite markers, including eight genotypes in the faster growth group and seven genotypes in the slower growth group. Multiple comparisons were made on different traits of different genotypes. At locus JS-3, the mean values ​​of each growth trait of individuals with the 192 / 192 genotype were higher than those of other genotypes, making it a dominant genotype related to the growth shape of blue-spotted Spanish mackerel.

[0056] Table 4: Comparison of growth-related traits among different genotypes of blue-spotted Spanish mackerel at three microsatellite loci

[0057]

[0058]

[0059] The microsatellite locus JS-3 was screened for dominant genes related to the growth traits of blue-spotted Spanish mackerel. The primer pair sequence used for the microsatellite locus is as follows:

[0060] Forward primer F: 5′-ACTGTACACTAGAATGGAACATGC-3′ (SEQ ID NO: 2)

[0061] Reverse primer R: 5′-CGTGGTGGCTTAGTGACGTA-3′ (SEQ ID NO: 3),

[0062] A special 192 bp band was amplified in the fast-growing group, and 188 / 190 genotypes and 190 / 190 genotypes ( Figure 3 ); while in the faster growing group, only the 192 / 192 genotype ( Figure 4 ).

[0063] The nucleotide sequence of the microsatellite locus JS-3 is as follows:

[0064] AACTGTACACTAGAATGGAACATGCTAGCTATCCTGTTATACAGT

[0065] AGAATCTACGAGACCACAGAGTCAACTCCTTCTCACTTGTGAGAATC

[0066] CAAACAATTCAAACAATT TATATATATATATATATATA TGACACTAACATG

[0067] TTATTAGTAGTACCTGTACATCCAAAGGCCATACGTCACTAAGCCAC

[0068] CACGTTACTAGAGCAC (SEQ ID NO: 1).

[0069] Its core repeating unit is (TA)n. Using the upstream and downstream primers of SEQ ID NO:2 and SEQ ID NO:3 for amplification, a fragment with 10 repeats can be amplified in the faster growing group, while a nucleic acid fragment with 8 repeats can be amplified in the slower growing group, and a nucleic acid fragment with 9 repeats can also be amplified.

[0070] Therefore, the primer pair with upstream and downstream sequences of SEQ ID NO: 2 and SEQ ID NO: 3 can be used to screen the fast-growing parent by checking whether the individual to be screened has a specific band; wherein the specific band, the microsatellite locus JS-3 is a 192 bp band.

[0071] Example 3: Application of microsatellite markers related to growth traits of Spanish mackerel

[0072] The offspring of 200 healthy blue-spotted Spanish mackerel fry were tested at an aquaculture company in Qingdao. The genomic DNA of each blue-spotted Spanish mackerel was obtained by non-destructive sampling. Microsatellite detection was performed using a primer pair with upstream and downstream sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and individuals with a 192 bp band were screened.

[0073] From 200 blue-spotted Spanish mackerel fry, 50 individuals with specific bands were selected and kept under the same conditions as other individuals: water temperature at 25-30 degrees Celsius, salinity maintained at 32-35‰, pH value between 6-8, water quality kept clear, ammonia nitrogen, nitrite and other indicators were tested regularly to keep the water quality stable. Growth traits were measured after one year of cultivation (Table 6 / Figure 5 ), and the results showed that individuals containing specific bands had significant growth effects.

[0074] Table 5 Growth trait data of one-year-old Spanish mackerel in microsatellite marker group and other groups

[0075]

[0076] The 50 individuals with genotype 192 / 192 obtained by screening were used as parents for seedling cultivation. When the offspring grew to one year old, 100 individuals with no obvious damage, good health and good vitality were randomly selected, and the growth traits of blue-spotted Spanish mackerel were measured using a vernier caliper and a balance (Table 6 / Figure 6 ).

[0077] Table 6 Data table of growth characteristics of offspring blue-spotted Spanish mackerel at one year old

[0078]

[0079] The results show that the individuals screened using the microsatellite sites provided by the present invention have a significant growth effect, and the offspring obtained by breeding with the screened individuals as parents also have growth advantages, indicating that the microsatellite markers provided by the present invention can be used to screen bluespotted Spanish mackerel parents with better growth traits.

Claims

1. A molecular marker linked to the growth traits of Spanish mackerel, characterized in that: The molecular marker is a microsatellite locus marker, and its nucleotide sequence is SEQ ID NO:

1.

2. The molecular marker according to claim 1, characterized in that The core repeat sequence of the microsatellite locus marker is (TA)n, wherein n is a natural number in the range of 7-10.

3. Application of the molecular marker described in claim 1 in screening blue-spotted Spanish mackerel individuals with growth advantages.

4. A method for screening blue-spotted Spanish mackerel parents, characterized in that: The method is to detect the specific fragments of the microsatellite locus marker described in claim 1 to screen the blue-spotted Spanish mackerel parents.

5. The method according to claim 4, characterized in that The specific fragment of the microsatellite locus marker of claim 1 is detected by using a primer pair whose upstream primer has a sequence of SEQ ID NO: 2 and whose downstream primer has a sequence of SEQ ID NO:

3.

6. The method according to claim 5, characterized in that The length of the specific fragment marked by the microsatellite locus is 192 bp.

7. A method for cultivating blue-spotted Spanish mackerel fry with rapid growth potential, characterized in that: The method is to use the blue-spotted Spanish mackerel selected by the method according to claim 4 as a parent for seed breeding.

Images