A primer pair, a kit for detecting erwinia amylovora and application thereof

Abstract

The application provides a primer pair, a kit and application thereof for detecting Erwinia amylovora, and belongs to the technical field of biological agricultural detection.The application provides a specific DNA fragment for detecting Erwinia amylovora, and the nucleotide sequence is shown as SEQ ID NO:1.The application also provides a primer pair for amplifying the specific DNA fragment, which comprises a forward primer with the nucleotide sequence shown as SEQ ID NO:2 and a reverse primer with the nucleotide sequence shown as SEQ ID NO:3.The primer pair can be used for routine PCR detection and / or real-time fluorescent quantitative PCR detection of Erwinia amylovora, has the characteristics of high specificity, and can realize specific detection without the combination of a fluorescent probe.

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural detection technology, specifically relating to a primer pair, reagent kit, and application for detecting pear blight pathogen. Background Technology

[0002] Pear fire blight is caused by the fungus *Erwinia amylovora*, which has a wide host range, infecting more than 140 species of plants in 32 genera of the Rosaceae family. It primarily infects pears, apples, hawthorns, crabapples, and quince, among other pome fruits in the Rosaceae family, causing particularly severe damage to pears and apples. In pear trees, newly infected shoots, flowers, and fruits initially show obvious water-soaked lesions. In humid climates, bacterial ooze may appear. As the disease progresses, the affected tissue turns black and withers, new shoots become twisted and spindly, and leaves, flowers, and diseased fruits become scorched but do not fall, resembling burnt fruit, ultimately leading to the death of the entire tree. Outbreaks of pear fire blight have caused irreparable losses in many countries. To prevent further spread of the disease, reliable detection methods are crucial for fungal infection detection and epidemic monitoring.

[0003] The most widely used detection methods in existing technologies are PCR-based molecular biology techniques, including conventional PCR and real-time quantitative PCR (qPCR). Conventional PCR amplifies large DNA fragments, making it unsuitable for qPCR. Existing qPCR primers, when used with dyes, exhibit low specificity in amplified DNA fragments, requiring the use of fluorescent probes for specific detection. Furthermore, the high cost of fluorescent probes in qPCR increases detection costs and limits the further widespread application of this technology. Summary of the Invention

[0004] In view of this, the present invention provides a specific DNA fragment for detecting pear fire blight pathogen, which is not only applicable to both conventional PCR detection and dye-based real-time quantitative PCR detection of pear fire blight pathogen, but also has the characteristic of high detection specificity.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The present invention provides a specific DNA fragment for detecting pear fire blight pathogen, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] This invention provides a primer pair for detecting pear fire blight pathogen, wherein the primer pair is a primer pair for amplifying the specific DNA fragment;

[0008] The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3.

[0009] This invention provides a detection kit for pear blight pathogens, including the primer pair.

[0010] Preferably, the detection kit further includes DNA polymerase, buffer solution, and the specific DNA fragment.

[0011] This invention provides the application of the specific DNA fragment, the primer pair, or the detection kit in the detection of fire blight in pear crops.

[0012] This invention provides a method for detecting the crop pathogen *Pyracantha fortuneana*, comprising the following steps:

[0013] 1) Using the genomic DNA of the sample to be tested as a template, real-time quantitative PCR and / or conventional PCR detection are performed using the primer pair described above;

[0014] 2) Determine whether the sample carries pear blight pathogen based on the test results;

[0015] The criteria for judging the results of real-time quantitative PCR are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is determined to carry pear fire blight pathogen; if the Ct value is >40, the sample is determined not to carry pear fire blight pathogen; if 35 < Ct value ≤40, retesting is required.

[0016] The criteria for judging the results of routine PCR testing are as follows: if a fragment of 136 bp is amplified, the sample is considered to carry pear fire blight pathogen; if no fragment of 136 bp is amplified, the sample is considered not to carry pear fire blight pathogen.

[0017] Preferably, the amplification system for the real-time quantitative PCR detection is: 10 μL of 2×Taq Pro Universal SYBRqPCR MasterMix, 0.5 μL each of 10 μM upstream and downstream primers, and 100-200 ng of genomic DNA template, with ddH2O added to make up to 20 μL;

[0018] The amplification program for the real-time quantitative PCR detection is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 40 cycles.

[0019] Preferably, the amplification system for the conventional PCR detection is: 10 μL of 2×TaqPCRMasterMix, 0.5 μL each of 10 μM upstream and downstream primers, and 100–200 ng of genomic DNA template, with ddH2O added to make up to 20 μL;

[0020] The amplification program for the conventional PCR detection is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0021] Preferably, the sample to be tested includes pome fruits of the Rosaceae family.

[0022] Preferably, the Rosaceae pome fruit plants include at least one of the following: pear, apple, hawthorn, crabapple, and quince.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] This invention provides a specific DNA fragment for detecting *Pyrus pyrifolia*, the nucleotide sequence of which is shown in SEQ ID NO:1. In this invention, the specific DNA fragment is only 136 bp in length. When using this specific DNA fragment as the target fragment to detect *Pyrus pyrifolia* and various crop pathogens, the amplified products exhibit clear electrophoretic bands and high specificity, accurately distinguishing *Pyrus pyrifolia* from various crop pathogens. Furthermore, when using this specific DNA fragment as a target to identify various host crops (pear, apple, hawthorn, crabapple, and quince), no non-specific bands are amplified. However, when using primers P1 and P3–P10 to amplify the corresponding targets, non-specific amplification occurs. In addition, testing of positive and negative samples from different regions shows that the detection results using this specific DNA fragment as the target are highly accurate, with both conventional PCR and dye-based real-time quantitative PCR achieving 100% accuracy. As can be seen, the specific DNA fragment described in this invention has the characteristics of short fragment length, high specificity and high accuracy, and is suitable for both routine PCR detection and dye-based real-time quantitative PCR detection of pear blight pathogen.

[0025] This invention provides a primer pair for detecting *Pycnopyrene pyrifolia*, a primer pair for amplifying the specific DNA fragment of *Pycnopyrene pyrifolia*. The primer pair includes a forward primer with the nucleotide sequence shown in SEQ ID NO:2 and a reverse primer with the nucleotide sequence shown in SEQ ID NO:3. This primer pair specifically amplifies *Pycnopyrene pyrifolia* and does not cross-react with other crop pathogens or host crops (pear, apple, hawthorn, crabapple, and quince). This primer pair can be used for conventional PCR and dye-based real-time quantitative PCR to detect *Pycnopyrene pyrifolia* in plant samples, and it achieves specific detection without the need for fluorescent probes, making it more cost-effective and easier to promote compared to probe-based methods. Furthermore, the primer pair of this invention has high detection accuracy; the results of conventional PCR and real-time quantitative PCR are consistent with those identified using standard primers. In addition, the primer pair of this invention has high sensitivity, with a detection sensitivity of 0.1 CFU / μL.

[0026] This invention provides a method for detecting the crop pathogen *Pyracantha fortuneana*, the causal agent of pear fire blight. Using the genomic DNA of the sample as a template, the method employs the primer pair for real-time quantitative PCR and / or conventional PCR detection. The detection results determine whether the sample carries *Pyracantha fortuneana*. This method can be used for conventional PCR and dye-based real-time quantitative PCR detection of *Pyracantha fortuneana* in plant samples, and it achieves specific detection without the need for fluorescent probes, making it more cost-effective than probe-based methods. Furthermore, it features high accuracy and high sensitivity. Attached Figure Description

[0027] Figure 1 The results of amplification of pear fire blight pathogen genomic DNA by primer pairs P1 to P8 are shown, where M represents DL2000 DNA marker, and lanes 1 to 8 represent the amplification products of primer pairs P1, P2, P3, P7, P4, P5, P6, and P8, respectively.

[0028] Figure 2 The results of primer pairs P1-P8 amplification of genomic DNA from healthy Venus Golden Apple plants are shown. M represents DL2000 DNA marker, and lanes 1-8 represent the amplification products of primer pairs P1, P2, P3, P7, P4, P5, P6, and P8, respectively.

[0029] Figure 3 The results of primer pairs P9 and P10 amplification of genomic DNA from healthy tissues of nine apple varieties are shown. M represents DL2000 DNA Marker, and lanes 1-10 are 1: Gan Hong, 2: Shandong Tiao Hong, 3: Wang Lin, 4: Miyazaki, 5: Huang Jin, 6: Lu Li, 7: Mi Cui, 8: Local Tiao Hong, 9: Yan Fu No. 8, and 10: Pear Fire Blight (positive control).

[0030] Figure 4 The results of primer pair P2 amplification of genomic DNA from healthy tissues of 9 apple varieties are shown. M represents DL2000 DNA Marker. Lanes 1-10 are 1: Gan Hong, 2: Shandong Tiao Hong, 3: Wang Lin, 4: Miyazaki, 5: Huang Jin, 6: Lu Li, 7: Mi Cui, 8: Local Tiao Hong, 9: Yan Fu No. 8, and 10: Pear Fire Blight (positive control). Detailed Implementation

[0031] The present invention provides a specific DNA fragment for detecting pear fire blight pathogen, the nucleotide sequence of which is shown in SEQ ID NO:1(CGTTCTGATTGAACACCAGTCGACGCCGGATAAACATATGGCCTTCCGG CTTATCCGCTACGCGGTGGCGGCGATGCAGCGCCATCTCGATGCCGGGCAT CAAAAGCTGCCGCTGGTTATCCCGGTGCTGTTCTAT).

[0032] In this invention, the specific DNA fragment is only 136 bp in length. When using this specific DNA fragment as a detection target to detect *Pyrus pyrifolia* and other crop pathogens, the amplified product exhibits clear electrophoretic bands and high specificity, accurately distinguishing *Pyrus pyrifolia* from various crop pathogens. Furthermore, when using this specific DNA fragment as the target fragment to identify various host crops (pear, apple, hawthorn, crabapple, and quince), no non-specific bands are amplified. In contrast, non-specific amplification occurred when other DNA fragments were used as target fragments in the embodiments of this invention. Moreover, the results of testing positive and negative samples from different regions demonstrate that the detection results using this specific DNA fragment are highly accurate, with both conventional PCR and dye-based real-time quantitative PCR showing 100% accuracy. Therefore, the specific DNA fragment of this invention is characterized by its short length, high specificity, and high accuracy, and is suitable for both conventional PCR detection and dye-based real-time quantitative PCR detection of *Pyrus pyrifolia*.

[0033] This invention provides a primer pair for detecting pear fire blight pathogen, which is a primer pair for amplifying the specific DNA fragment; the primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 (CGTTCTGATTGAACACCAGT) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3 (ATAGAACAGCACCGGGATAA).

[0034] This invention provides a detection kit for pear blight pathogens, including the primer pair.

[0035] In this invention, the detection kit preferably further includes DNA polymerase, buffer solution, and the specific DNA fragment.

[0036] This invention provides the application of the specific DNA fragment, the primer pair, or the detection kit in the detection of fire blight in pear crops.

[0037] This invention provides a method for detecting the crop pathogen *Pyracantha fortuneana*, comprising the following steps:

[0038] 1) Using the genomic DNA of the sample to be tested as a template, real-time quantitative PCR and / or conventional PCR detection are performed using the primer pair described above;

[0039] 2) Determine whether the sample carries pear blight pathogen based on the test results;

[0040] The criteria for judging the results of real-time quantitative PCR are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is determined to carry pear fire blight pathogen; if the Ct value is >40, the sample is determined not to carry pear fire blight pathogen; if 35 < Ct value ≤40, retesting is required.

[0041] The criteria for judging the results of routine PCR testing are as follows: if a fragment of 136 bp is amplified, the sample is considered to carry pear fire blight pathogen; if no fragment of 136 bp is amplified, the sample is considered not to carry pear fire blight pathogen.

[0042] In this invention, the test samples include pome fruits of the Rosaceae family. Preferably, the Rosaceae pome fruits include at least one of the following: pear, apple, hawthorn, crabapple, and quince. The test samples are preferably sourced from at least one of leaves, flowers, fruits, and branches; for diseased test samples, the diseased parts are preferably extracted. The genomic DNA extraction method for the test samples is preferably performed using the CTAB method or a plant genomic DNA extraction kit.

[0043] In this invention, the preferred amplification system for real-time quantitative PCR detection is: 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.5 μL each of 10 μM upstream and downstream primers, and 100–200 ng of genomic DNA template, with the volume made up to 20 μL using ddH2O. In this embodiment, the 2×TaqPro Universal SYBR qPCR Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. The amplification program for real-time quantitative PCR detection is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 40 cycles.

[0044] In this invention, the preferred amplification system for conventional PCR detection is: 10 μL of 2×TaqPCRMasterMix, 0.5 μL each of 10 μM upstream and downstream primers, and 100–200 ng of genomic DNA template, with the volume made up to 20 μL using ddH2O. In this embodiment, the 2×TaqPCRMasterMix was purchased from Nanjing Novizan Biotechnology Co., Ltd. The amplification program for conventional PCR detection is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0045] In one embodiment of the present invention, 10 primer pairs P1–P10 (primer pair P2 in this invention) were used to perform routine PCR detection on *Pyrus pyrifolia*. Electrophoresis results showed that P1–P10 amplified bands of the expected size using *Pyrus pyrifolia* genomic DNA as a template. Specifically, P1–P3, P5–P6, and P8–P10 amplified clear bands, while P4 and P7 amplified unclear bands. Furthermore, the present invention used P1–P10 to amplify the genomic DNA of 14 other pathogenic microorganisms, including *Escherichia coli*, *Pseudomonas fluorescens*, *Agrobacterium tumefaciens*, *Erwinia carotovora*, *Ralstonia solanacearum*, *Enterobacter ludwigii*, and *Bacillus subtilis*. Electrophoresis showed that none of the following fungi amplified the target bands: Aspergillus subtilis, Aspergillus flavus, Aspergillus niger, Aspergillus tubingensis, Fusarium solani, Penicillium glaucum, Valsa mali, and Valsa ambiens. This invention uses primers P1 through P10 to detect 20 host crops, including 9 apple varieties ('Venus Gold', 'Luli', 'Ganhong', 'Wanglin', 'Micrit', 'Miyazaki Short-branch Fuji', 'Yanfu No. 8', '2001 New Striped Fuji', and 'Golden Delicious'), 8 pear varieties ('Fragrant Pear', 'Duck Pear', 'Dangshan Pear', 'Snowflake Pear', 'Apple Pear', 'Red Fragrant Crisp', 'Jade Dew Fragrance', and 'Cuiguan'), and 1 variety each of hawthorn, crabapple, and quince. Electrophoresis results showed that only primer P2 did not amplify non-specific bands when detecting different host crops, indicating that primer pair P2 has good specificity when detecting different host crops and can be used for the detection of pear fire blight pathogen.

[0046] In one embodiment of the present invention, 20 samples of pear and apple trees were tested using the primer pairs described herein. The results of conventional PCR and real-time quantitative PCR were consistent with the results of standard primer identification, demonstrating the high accuracy of the primer pairs in detecting pear fire blight. Furthermore, the primer pairs of the present invention exhibit high sensitivity, with a detection limit of 0.1 CFU / μL.

[0047] To further illustrate the present invention, the primer pair, kit, and application for detecting pear blight pathogens provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] Primer design

[0050] Based on the genome of *Pyrus pyrifolia* (accession number: FN434113) and pEA29 plasmid (accession number: FN434114) published in GenBank, six primer pairs P1-P6 were designed using PremierPrimer 5. Simultaneously, publicly available primer pairs (P7-P10) for detecting *Pyrus pyrifolia* were screened. The specific nucleotide sequences of primers P1-P10 are shown in Table 1.

[0051] P7 References [1] Yuan Yingzhe, Han Jian, Wang Yan, et al. Establishment of rapid quantitative detection method for live bacteria of Pear fire blight [J]. Journal of Fruit Science, 2020, 37(09):1425-1433. DOI:10.13925 / j.cnki.gsxb.20200056.

[0052] P8 References [2] Qian Guoliang, Hu Baishi, Lu Ling, et al. Real-time fluorescence PCR detection of pear fire blight pathogen [J]. Acta Phytopathologica Sinica, 2006, (02): 123-128. DOI: 10.13926 / j.cnki.apps.2006.02.005.

[0053] P9 Reference [3] Gottsberger R A. Development and evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Letters in Applied Microbiology, 2010, 51 (3): 285-292.

[0054] P10 References [4] Lehman SM, KimW, Castle AJ, et al. Duplex real-timepolymerase chain reaction reveals competition between Erwinia amylovora and E.pyrifoliae onpearblossoms. Phytopathology, 2008, 98(6): 673-679.

[0055] Table 1 Primer Sequence Information

[0056]

[0057] Example 2

[0058] Primer specificity test

[0059] 1. Detection of different microorganisms using P1 to P10

[0060] Genomic DNA was extracted from 15 different pathogenic microorganisms, namely, *Erwinia pyrifoliae*, *Escherichia coli*, *Pseudomonas fluorescens*, *Agrobacterium tumefaciens*, *Erwinia carotovora*, *Ralstonia solanacearum*, *Enterobacter ludwigii*, *Bacillus subtilis*, *Aspergillus flavus*, *Aspergillus niger*, *Aspergillus tubingensis*, *Fusarium solani*, *Penicillium glaucum*, *Valsa mali*, and *Valsa ambiens*.

[0061] Using primers P1 to P10, conventional PCR was performed with genomic DNA from 15 different microorganisms as templates to obtain PCR products.

[0062] The standard PCR amplification system is as follows: 10 μL of 2×TaqPCR MasterMix, 0.5 μL each of 10 μM upstream and downstream primers, and 100 ng of genomic DNA template, with ddH2O added to make up to 20 μL;

[0063] The standard PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 54-60℃ annealing for 30 s (see Tables 1 and 2 for specific annealing temperatures of P1-P10), 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0064] PCR products were detected by 1.5% agarose gel electrophoresis.

[0065] Electrophoresis results showed that bands of the expected size were amplified at P1–P10 using *P. pear blight* genomic DNA as a template. The bands at P1–P3, P5–P6, and P8–P10 were clear, while the bands at P4 and P7 were unclear (see [link to P1–P8 amplification results]). Figure 1 When the genomic DNA of the remaining 14 microorganisms (excluding pear blight pathogen) was amplified using P1 to P10 as templates, no non-specific bands were amplified.

[0066] 2. P1~P10 detection of different host crops

[0067] Genomic DNA was extracted from 20 different host crops, including apples (9 varieties: 'Venus Gold', 'Luli', 'Ganhong', 'Wanglin', 'Micrit', 'Miyazaki Short-Branch Fuji', 'Yanfu No. 8', '2001 New Striped Fuji', and 'Golden Delicious'); pears (8 varieties: 'Fragrant Pear', 'Duck Pear', 'Dangshan Pear', 'Snowflake Pear', 'Apple Pear', 'Red Fragrant Crisp', 'Jade Dew Fragrance', and 'Emerald Crown'); and hawthorn, crabapple, and quince (one variety each).

[0068] The method for extracting host crop genomic DNA is as follows: Take an appropriate amount of plant tissue, grind it thoroughly with liquid nitrogen, and transfer about 0.1g to a sterile 2.0mL centrifuge tube. Add 800μL of [unclear text - possibly a specific type of liquid nitrogen]. CTAB extraction buffer was used, and the mixture was incubated at 65°C for 1 hour, inverting and mixing several times every 15 minutes. 800 μL of a phenol / chloroform / isopropanol mixture (phenol:chloroform:isopropanol volume ratio 25:24:1) was added, and the mixture was inverted and mixed. The mixture was centrifuged at 12000 rpm for 10 minutes. The supernatant was transferred to a new 2 mL centrifuge tube, and an equal volume of chloroform / isopropanol mixture (chloroform:isopropanol volume ratio 24:1) was added. The mixture was inverted and mixed, and the mixture was centrifuged at 12000 rpm for 10 minutes. The supernatant was transferred to a new 1.5 mL centrifuge tube, and 0.6 times the volume of isopropanol was added. The mixture was incubated at -20°C for at least 30 minutes, centrifuged at 12000 rpm for 10 minutes, and the supernatant was discarded. The mixture was washed twice with 75% ethanol, dried at room temperature for about 10 minutes, and the DNA was dissolved in water to obtain the host crop genomic DNA.

[0069] Using primers P1–P10, conventional PCR was performed with genomic DNA from 20 host crops of pear fire blight pathogens as templates to obtain PCR products.

[0070] The conventional PCR amplification system, procedure, and detection method for amplification products are the same as those for detecting different microorganisms using P1 to P10, and will not be repeated here.

[0071] Electrophoresis results showed that P1 and P3–P10 all amplified nonspecific bands when detecting apples, while only P2 did not amplify nonspecific bands when detecting 20 different host crops (partial results of P1–P10 for different host plants can be found in...). Figures 2-4 ).

[0072] In summary, the primer pair P2 designed in this invention has good specificity when detecting different host crops and can be used for the detection of pear fire blight pathogen.

[0073] Example 3

[0074] Sensitivity test of primer pair P2

[0075] Pear fire blight pathogen XJSZ0102 was prepared with sterile water to a concentration of 1×10⁻⁶. 8 The concentration of CFU / mL was serially diluted 10-fold, and after incubating in a 95℃ water bath for 5 minutes, 2 μL was taken as a template for real-time quantitative PCR detection.

[0076] The test results showed that a dilution of 1×10 5 It can still be detected after dilution of 1×10⁻⁶ times. 6 No detectable after doubling, therefore, the detection limit for primer pair P2 is 0.1 CFU / μL.

[0077] Example 4

[0078] Application of primer pair P2 in the detection of pear blight

[0079] Of the 20 samples from pear and apple trees from areas affected by pear fire blight in Xinjiang and Gansu, 13 were positive and 7 were negative, as determined by conventional PCR methods in the Agricultural Industry Standard of the People's Republic of China NY / T41802022.

[0080] Twenty samples were tested using primer pair P2. The results of conventional PCR and real-time quantitative PCR were consistent with those of the standard primer identification, indicating that P2 has high accuracy in detecting pear blight. Specific sample information and test results are shown in Table 2.

[0081] Table 2. Statistics of pear blight detection results

[0082]

[0083]

[0084] Note: + indicates a positive result for pear fire blight pathogen, and - indicates a negative result for pear fire blight pathogen.

[0085] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair for detecting pear fire blight pathogen, characterized in that, The primer pair is a primer pair for amplifying a specific DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1; The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

3.

2. A detection kit for pear blight pathogen, characterized in that, Includes the primer pair described in claim 1.

3. The detection kit according to claim 2, characterized in that, The detection kit also includes DNA polymerase, buffer, and the specific DNA fragment of claim 1.

4. The application of the primer pair of claim 1 or the detection kit of claim 2 or 3 in the detection of fire blight in pear crop.

5. A method for detecting the crop pathogen *Pyracantha fortuneana*, characterized in that, Includes the following steps: 1) Using the genomic DNA of the sample to be tested as a template, real-time quantitative PCR detection and / or conventional PCR detection are performed using the primer pair described in claim 1; 2) Determine whether the sample carries pear blight pathogen based on the test results; The criteria for judging the results of real-time quantitative PCR detection are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is determined to carry pear fire blight pathogen. If the Ct value is greater than 40, the sample is determined not to carry pear fire blight pathogen; If 35 < Ct value ≤ 40, a retest is required; The criteria for judging the results of routine PCR testing are as follows: if a fragment of 136 bp is amplified, the sample is considered to carry pear fire blight pathogen; if no fragment of 136 bp is amplified, the sample is considered not to carry pear fire blight pathogen.

6. The method according to claim 5, characterized in that, The amplification system for the real-time quantitative PCR detection is as follows: 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.5 μL each of 10 μM upstream and downstream primers, and 100~200 ng of genomic DNA template, with ddH2O added to make up to 20 μL; The amplification program for the real-time quantitative PCR detection is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 40 cycles.

7. The method according to claim 5, characterized in that, The amplification system for the conventional PCR detection is as follows: 10 μL of 2×Taq PCRMaster Mix, 0.5 μL each of 10 μM upstream and downstream primers, and 100-200 ng of genomic DNA template, with ddH2O added to make up to 20 μL; The amplification program for the conventional PCR detection is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

8. The method according to any one of claims 5 to 7, characterized in that, The samples to be tested include pome fruits of the Rosaceae family.

9. The method according to claim 8, characterized in that, The pome fruits of the Rosaceae family include at least one of the following: pear, apple, hawthorn, crabapple, and quince.

Images