Molecular marker of locus qFAC.C9-1 remarkably associated with fatty acid components of cabbage type rape seeds and application of molecular marker

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker of a locus qFAC.C9-1 remarkably associated with a fatty acid component of a cabbage type rape seed and application of the molecular marker. A locus qFAC.C9-1 remarkably associated with fatty acid components of rape seeds and a peak SNP (Single Nucleotide Polymorphism) marker Bn-scaff171901-p9206 of the locus qFAC.C9-1 are positioned at the 3rd, 592nd and 310th basic groups of a chromosome of a reference genome C09 of the rape DarmorV4.1, and 8.6% of phenotypic variance can be explained on average. When the PARMS marker designed by the SNP is used for detecting rape germplasm resources, the operation is simple and convenient, the typing is clear, the average content of arachidonic acid and erucic acid of AA genotype material seeds is lower than that of GG genotype material seeds, and the content of linoleic acid, oleic acid, palmitic acid and stearic acid is higher, so that the PARMS marker has a very good selection effect on the fatty acid components of the rape seeds.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker of a site qFAC.C9-1 significantly associated with a fatty acid component of Brassica napus seeds and an application thereof. Background Art

[0002] At present, the main goals of rapeseed breeding include resistance, yield and quality. These traits are complex quantitative traits, which are regulated by many genes and easily affected by environmental conditions. Traditional breeding methods and technical means are difficult to achieve precise improvement and breakthroughs in these traits. With the rapid advancement of molecular marker technology and the widespread use of emerging biotechnologies such as gene editing, molecular improvement of these traits has become possible.

[0003] Rapeseed quality traits mainly include rapeseed seed oil and protein content, the content of various fatty acid components in oil, the content of glucosinolates (sulfosinolates) and their components in rapeseed cake, cellulose and phytic acid content, etc. Rapeseed seed fatty acid components mainly include palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (20:1) and erucic acid (22:1). The fatty acid synthesis system first synthesizes saturated fatty acids with chain lengths of 18 and 16 carbons, and then the saturated fatty acids are converted into unsaturated fatty acids through the desaturation system, or under the regulation of the fatty acid elongase gene (FAE l), the very long chain fatty acid synthesis system synthesizes eicosenoic acid or erucic acid. Oleic acid, as a monounsaturated fatty acid, has a high value both for food and industrial use. As edible oil, increasing the oleic acid content in rapeseed oil can reduce the incidence of cardiovascular disease in obese people, reduce the low-density lipoprotein cholesterol content in the blood, and prevent arteriosclerosis; high oleic acid oil can prevent lipid oxidation, extend the shelf life of oil, and extend the shelf life; in addition, high oleic acid rapeseed oil can ensure less smoke when heated to a higher temperature, shorten cooking time, and reduce loss; high oleic acid rapeseed oil can ensure the thermal stability of rapeseed oil, and at the same time ensure that the food has a good aroma after being fried (Xiong Qiufang et al., 2014). In industry, due to the global energy crisis caused by the shortage of oil, people are looking for a biorenewable energy source that can replace oil, and high oleic acid rapeseed oil can be effectively methylated and is favored by people in the production of biodiesel (Guan Mei, 2004). Under the action of desaturase, oleic acid is converted into linoleic acid (ω-6 family), and linoleic acid is further converted into linolenic acid. As an essential fatty acid for the human body, linoleic acid can soften blood vessels, reduce cholesterol content, reduce the risk of arteriosclerosis, and is beneficial to human digestion and absorption (Wu Moucheng, 2004). Linoleic acid deficiency in the human body can cause cholesterol and certain saturated fatty acids to combine and deposit on the blood vessel wall, leading to arteriosclerosis and cardiovascular and cerebrovascular diseases (Zhou Yinzhu, 2011). There are two types of linolenic acid: α-linolenic acid and γ-linolenic acid. α-linolenic acid is the main form of linolenic acid in rapeseed. If the human body lacks α-linolenic acid, lipid metabolism will be disordered, leading to symptoms such as decreased immunity, fatigue, and atherosclerosis (Li Jiaxing et al., 2009). For infants and adolescents, α-linolenic acid deficiency will seriously affect their intellectual development, so α-linolenic acid is essential for maintaining human health (Liu Feng, 2007). In addition, α-linolenic acid is a precursor of EPA (eicosapentaenoic acid, commonly known as vascular scavenger) and DHA (docosahexaenoic acid, commonly known as brain gold). As long as there is sufficient α-linolenic acid in food, the human body can use it to synthesize the required ω-3 series fatty acids.Erucic acid is a long-chain fatty acid that is not easily decomposed and absorbed in the human body and has a low nutritional value. Excessive erucic acid content will also limit the increase in oleic acid and linoleic acid content (Liu Houli, 2000; Fu Tingdong, 2004). However, erucic acid has a very broad prospect as a fatty acid for industrial use. Erucic acid and its derivatives have been widely used in industrial fields such as cast steel, lubrication, plastics, paints, inks, cosmetics and food. Palmitic acid and stearic acid are saturated fatty acids with high melting points. They are easy to coagulate on the blood vessel wall, which in turn causes hypertension and arteriosclerosis, and also leads to increased blood cholesterol concentration (Liu Lili et al., 2005). The higher the saturated fatty acid content in rapeseed oil, the lower its nutritional value. In summary, various fatty acids have their own different functions, so the improvement of rapeseed fatty acids should set corresponding breeding goals according to different needs and uses. At present, rapeseed oil in my country is still mainly used for food, so the focus of rapeseed fatty acid improvement is still to reduce the erucic acid content and increase the oleic acid, linoleic acid and linolenic acid content.

[0004] Using linkage and / or association mapping methods (Bao et al., 2021; Cai et al., 2016; Li et al., 2016; Liu et al., 2014; Meng et al., 2019; Yang et al., 2010; Ye et al., 2019; Zhang et al., 2008; Burn et al., 2011; Chen et al., 2018; Li et al., 2014; Smooker et al., 2011; Wang et al., 2015; Yan et al., 2011; Zhao et al., 2008), a number of quantitative trait loci (QTLs) controlling the content of seed fatty acid components have been located in rapeseed. Two of the major QTLs are located on chromosomes A8 and C3, corresponding to different copies of FAE1 (Li et al., 2014). However, these QTLs are not sufficient to explain the variation in the content of fatty acid components in rapeseed germplasm resources, indicating that there are still new regulatory sites for fatty acid component content that need to be discovered.

[0005] The present invention uses rapeseed core association population and high-density SNP genotype data to conduct genome-wide association analysis of seed fatty acid components under 8 environments, aiming to find new stable association sites and develop practical high-throughput and low-cost molecular markers based on them for molecular improvement of rapeseed seed fatty acid composition. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a reagent for detecting base 3,592,310 on chromosome C09 of Brassica napus in screening and breeding of fatty acid components in Brassica napus seeds.

[0007] Another object of the present invention is to provide a primer for detecting base 3,592,310 on chromosome C09 of Brassica napus for use in screening and breeding of fatty acid components in Brassica napus seeds.

[0008] The last object of the present invention is to provide a method for screening and breeding Brassica napus seeds based on the fatty acid component content.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] Obtaining PARMS markers significantly associated with the fatty acid content of Brassica napus seeds:

[0011] (1) Total DNA was extracted from 331 samples of the core association population of Brassica napus constructed by our team (Li et al., 2020), and the genotype of each sample was analyzed using the rapeseed 60K SNP chip (Clarke et al., 2016).

[0012] (2) The heterozygous rate, missing rate, and minor allele frequency of each locus of the population material were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Markers with no polymorphism, high missing rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain position, and multiple copies were removed, and finally 24,508 high-quality SNP markers were obtained for subsequent analysis.

[0013] (3) A total of 331 samples of the core associated population of Brassica napus constructed by our team were planted in eight environments (codenamed N14, W12, W13, W14, W15, W16, Z13, and Z14) in Nanchang in 2014, Wuhan in 2012-2016, and Zhengzhou in 2013-2014. Ten plants were harvested from each plot at maturity, dried, and threshed. The fatty acid content was determined by near-infrared imaging (Qiu et al., 2006), including arachidic acid (ARA), erucic acid (ERU), linoleic acid (LOL), linolenic acid (LON), oleic acid (OLE), palmitic acid (PAL), and stearic acid (STE).

[0014] (4) Combining the phenotypic data, genotypic data and population structure of the core association population, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). Finally, a locus qFAC.C9-1 significantly associated with multiple fatty acid components was obtained on chromosome C09 of the DarmorV4 reference genome of rapeseed, and its peak SNP marker Bn-scaff_17190_1-p9206 was located at base 3,592,310 (base A or G), which could be repeatedly detected in eight environments.

[0015] (5) Extract 100 bp sequences upstream and downstream of base 3,592,310 on chromosome C09 of rapeseed, and obtain the PARMS detection primer sequences according to the primer design principles: qFAC.C9-1F: TGTAAAAGACATGTGATGATGGTTC; qFAC.C9-1Ra: gaaggtgaccaagttcatgctTTTGCATAGATCATAAGCCAAACTA; qFAC.C9-1Rg: gaaggtcggagtcaacggattTTGCATAGATCATAAGCCAAACTG.

[0016] The protection scope of the present invention includes:

[0017] Application of a reagent for detecting base 3,592,310 on chromosome C09 of Brassica napus in screening and breeding of fatty acid components in Brassica napus seeds.

[0018] The reagents described above are preferably primers.

[0019] The primers mentioned above are preferably the PARMS detection primers provided by the present invention.

[0020] A method for screening and breeding of Brassica napus seeds by fatty acid component content comprises using conventional schemes in the art to detect bases at positions 3,592,310 on chromosome C09 of Brassica napus, wherein the conventional schemes include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0021] The determination method is:

[0022] If the AA genotype is detected, it indicates that the content of arachidic acid and erucic acid in the seeds of this variety is relatively low, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively high.

[0023] If the GG genotype is detected, it indicates that the content of arachidic acid and erucic acid in the seeds of this variety is relatively high, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively low.

[0024] The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genoscope.cns.fr / brassicanapus / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention obtains a locus qFAC.C9-1 that is significantly associated with the fatty acid composition of rapeseed, and can be repeatedly detected, explaining an average of 8.6% of the phenotypic variance, and can be effectively applied to the genetic improvement of the fatty acid composition of rapeseed.

[0027] (2) The present invention obtains PARMS markers significantly associated with rapeseed fatty acid components. The detection method is simple and low-cost, and high-throughput screening of genomic haplotype regions of rapeseed fatty acid components can be performed to improve selection efficiency and accuracy. DETAILED DESCRIPTION

[0028] The technical solutions described in the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genoscope.cns.fr / brassicanapus / . Most of the materials tested in the examples of this application are pure lines, so there is no data on heterozygous genotypes.

[0029] Example 1: Obtaining SNP markers significantly associated with the fatty acid content of rapeseed seeds

[0030] (1) A total of 1063 rapeseed inbred lines from various countries around the world were collected (Li et al., 2015), and 331 materials were selected from them based on their genotype and phenotypic data to construct a core association population (Li et al., 2020). Individual leaves of each line in the association population were collected, and total DNA was extracted using the CTAB method. The rapeseed 60K SNP chip (Clarke et al., 2016) was used to perform genotyping on each sample.

[0031] (2) The heterozygous rate, missing rate, and minor allele frequency of each locus of the population material were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). The kinship among 331 Brassica napus germplasm resources was calculated using SPAGeDi software (Hardy and Vekemans, 2002). SNP markers were filtered using the criteria of missing rate ≤ 0.2, heterozygosity ≤ 0.2, minor allele frequency > 0.05, and unique match of SNP markers in the Brassica napus genome. Finally, 24,508 high-quality SNP markers were obtained for genome-wide association analysis.

[0032] (3) 331 strains of the core-associated population were planted in eight environments (codenamed N14, W12, W13, W14, W15, W16, Z13, and Z14) in Nanchang 2014, Wuhan 2012-2016, and Zhengzhou 2013-2014. Ten representative plants were harvested from each plot at maturity, dried and threshed, and the fatty acid content was determined using a near-infrared spectrometer (Qiu et al., 2006): arachidonic acid (ARA), erucic acid (ERU), linoleic acid (LOL), linolenic acid (LON), oleic acid (OLE), palmitic acid (PAL), and stearic acid (STE).

[0033] (4) Combining the genotype data of the association population and the phenotypic data of fatty acid components, a genome-wide association analysis was performed using TASSEL 5.0 software. By integrating the significant association SNP markers detected in different environments and models, a site qFAC.C9-1 with significant association with fatty acid components and good repeatability was obtained on chromosome C09. It can be repeatedly detected in four environments, and its peak SNP marker Bn-scaff_17190_1-p9206 is located at the 3,592,310th base (T / A or C / G) of the DarmorV4.1 reference genome, with an average contribution rate of 8.6%. This site was significantly associated with arachidonic acid content in three environments, with an average additive effect of -1.42(%) and a contribution rate of 8.2%; this site was significantly associated with erucic acid content in five environments, with an average additive effect of -4.97(%) and a contribution rate of 9.1%; this marker was significantly associated with oleic acid content in five environments, with an average additive effect of 5.76(%) and a contribution rate of 8.7%; this marker was significantly associated with palmitic acid in two environments, with an average additive effect of 0.21(%) and a contribution rate of 7.6%.

[0034] Table 1. Information on QTL-qFAC.C9-1 associated with fatty acid content in rapeseed seeds

[0035]

[0036] Embodiment 2:

[0037] Development and use of a PARMS marker significantly associated with the content of rapeseed fatty acid components:

[0038] The associated markers obtained in Example 1 are derived from the SNP chip, which only has probe sequence information for molecular hybridization. The rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is relatively cumbersome and requires special equipment. In addition, it is expensive to use the rapeseed SNP chip to detect a large number of intermediate breeding materials, so it is necessary to convert it into a simple and low-cost PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System, five-primer amplification blocked mutation system) labeling. The labeling system includes a pair of fluorescent universal primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers and a reverse shared primer, which can quickly and easily perform SNP allele type detection.

[0039] (1) For the peak SNP marker Bn-scaff_17190_1-p9206 associated with qFAC.C9-1, extract the 100 bp sequence upstream and downstream of the 3,592,310th base of the C09 chromosome of the rapeseed Darmor V4.1 reference genome. According to the primer design principle, the PARMS marker detection primer sequence is obtained as follows:

[0040] qFAC.C9-1Ft:gaaggtgaccaagttcatgctTCCAGTCCACTTTGACAAAGCT;

[0041] qFAC.C9-1Fc:gaaggtcggagtcaacggattCCAGTCCACTTTGACAAAGCC;

[0042] qFAC.C9-1R: TATGCTTGTTCCAACGGGTCT;

[0043] (2) Using the genomic DNA of the rapeseed-associated population as a template, the above primers were used for fluorescence quantitative PCR amplification, and Tecan F200 was used to scan the FAM, HEX and ROX signals and output the results, which were finally converted into genotypes.

[0044] Using the above primers, the sequence amplified in the rapeseed variety Double 11 is: TCCAGTCCACTTTGACAAAG CT GACTGTATCTCACCTCCATCCCCTGTTAAAGTTG AGACCCGTTGGAACAAGCATA .

[0045] Using the above primers, the sequence amplified in the rapeseed variety Tapidor is: CCAGTCCACTTTGACAAAGCC GACTGTATCTCACCTCCATCCCCTGTTAAAGTTG AGACCCGTTGGAACAAGCATA .

[0046] The determination method is:

[0047] If the AA genotype is detected, it indicates that the content of arachidic acid and erucic acid in the seeds of this variety is relatively low, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively high.

[0048] If the GG genotype is detected, it indicates that the content of arachidic acid and erucic acid in the seeds of this variety is relatively high, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively low.

[0049] Example 3: Application of PARMS markers in the selection of fatty acid components in rapeseed

[0050] 96 samples were randomly selected from 732 materials of non-core associated groups (i.e., 1063 rapeseed inbred lines in Example 1 excluding 331 core associated groups) (for convenience of PCR amplification), and 83 samples of genotype AA and 13 samples of genotype GG were detected using the PARMS marker qFAC.C9-1 provided in Example 2. There were significant differences in the contents of six fatty acid components (except linolenic acid) between the two genotypes (Tables 2-7). There were extremely significant differences in the arachidic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of -5.37(%); there were extremely significant differences in the erucic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of -19.17(%); there were significant differences in the linoleic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of 3.23(%); there were extremely significant differences in the oleic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of 22.67(%); there were extremely significant differences in the palmitic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of 0.69(%); there were extremely significant differences in the stearic acid content in the seeds of the two genotype materials of AA and GG in all eight environments, with an average difference of 0.20(%).

[0051] The following fatty acid components were detected by near infrared method (Qiu et al., 2006).

[0052] Table 2. Comparison of arachidonate content (%) between two genotypes of PARMS-marked qFAC.C9-1 in 96 Brassica napus seeds

[0053] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 2.85 3.03 2.06 3.07 3.24 3.06 3.72 3.12 3.02 GG(13) 8.38 7.81 7.96 9.41 8.69 9.06 7.92 7.86 8.39 AA-GG -5.53 -4.79 -5.90 -6.34 -5.45 -6.01 -4.20 -4.74 -5.37 Pt-test 2.8E-09 1.1E-04 2.8E-09 2.0E-09 1.4E-08 7.5E-10 1.7E-04 3.4E-08

[0054] Table 3. Comparison of erucic acid content (%) of two genotypes of PARMS-marked qFAC.C9-1 in 96 Brassica napus seeds

[0055] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 2.91 1.60 0.66 0.91 3.28 3.50 3.59 3.02 2.43 GG(13) 22.47 20.95 22.29 23.94 23.49 24.88 19.04 15.73 21.60 AA-GG -19.55 -19.35 -21.63 -23.03 -20.21 -21.39 -15.45 -12.71 -19.17 Pt-test 8.1E-10 2.0E-05 9.0E-10 4.1E-10 2.1E-09 4.5E-10 5.7E-05 1.4E-07

[0056] Table 4. Comparison of linoleic acid content (%) of two genotypes of PARMS-marked qFAC.C9-1 in 96 Brassica napus seeds

[0057] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 18.20 20.17 19.31 20.15 17.35 19.25 20.06 16.75 18.90 GG(13) 15.14 16.24 15.69 16.33 14.16 16.03 17.34 14.46 15.67 AA-GG 3.05 3.93 3.61 3.83 3.18 3.22 2.71 2.29 3.23 Pt-test 1.1E-06 9.2E-06 2.5E-08 1.8E-07 2.2E-06 1.6E-06 9.2E-04 1.0E-05

[0058] Table 5. Comparison of oleic acid content (%) of two genotypes of PARMS-marked qFAC.C9-1 in 96 Brassica napus seeds

[0059] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 58.45 60.74 60.31 58.13 58.53 59.83 56.79 61.01 59.22 GG(13) 35.45 38.85 35.46 31.94 35.17 34.82 39.51 41.23 36.55 AA-GG 22.99 21.88 24.86 26.19 23.36 25.01 17.28 19.78 22.67 Pt-test 7.0E-10 6.9E-05 1.4E-09 5.2E-10 2.2E-09 2.0E-10 1.1E-04 6.7E-08

[0060] Table 6. Comparison of palmitic acid content (%) of two genotypes of PARMS-marked qFAC.C9-1 in 96 Brassica napus seeds

[0061] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 3.91 4.28 3.98 4.29 3.94 4.42 4.18 3.57 4.07 GG(13) 3.24 3.46 3.16 3.51 3.28 3.69 3.63 3.07 3.38 AA-GG 0.67 0.81 0.82 0.78 0.67 0.73 0.55 0.51 0.69 Pt-test 1.3E-08 7.7E-07 2.8E-10 1.7E-09 3.8E-08 2.5E-09 1.1E-04 8.7E-08

[0062] Table 7. Comparison of stearic acid content (%) of two genotypes of qFAC.C9-1 labeled by PARMS in 96 Brassica napus seeds

[0063] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 Mean AA(83) 1.67 1.32 1.69 1.08 1.21 0.98 1.20 1.55 1.34 GG(13) 1.42 1.13 1.52 0.83 1.04 0.80 1.00 1.39 1.14 AA-GG 0.24 0.19 0.17 0.25 0.18 0.18 0.20 0.16 0.20 Pt-test 8.5E-07 1.1E-04 2.5E-06 5.7E-11 4.3E-05 4.2E-07 1.5E-04 2.6E-04

[0064] The above results are sufficient to show that the PARMS molecular marker qFAC.C9-1 we prepared is highly correlated with the main fatty acid components of rapeseed and has a good selection effect.

Claims

1. Application of a reagent for detecting base 3,592,310 on chromosome C09 of Brassica napus in screening and breeding of fatty acid components in Brassica napus seeds.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: qFAC.C9-1R: TATGCTTGTTCCAACGGGTCT; qFAC.C9-1Ft: gaaggtgaccaagttcatgctTCCAGTCCACTTTGACAAAGCT; qFAC.C9-1Fc: gaaggtcggagtcaacggattCCAGTCCACTTTGACAAAGCC.

4. A method for screening and breeding of Brassica napus seeds by fatty acid component content, the method comprising detecting base 3,592,310 on chromosome C09 of Brassica napus, the method comprising: Sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, mass spectrometry; The determination method is: If the AA genotype is detected, it indicates that the seeds of this variety have low arachidic acid and erucic acid content, and high linoleic acid, oleic acid, palmitic acid and stearic acid content; If the GG genotype is detected, it indicates that the seeds of this variety have high content of arachidic acid and erucic acid, and low content of linoleic acid, oleic acid, palmitic acid and stearic acid.

Images