Serratia marcescens, vaccine, preparation method and application thereof

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a Serratia marcescens, a vaccine, and a preparation method and application thereof. The deposit number of the Serratia marcescens is CGMCC No.31403. The present invention proves through experiments that the Serratia marcescens has high environmental stress tolerance, and has biological effects such as scavenging free radicals, regulating body immunity, and anti-tumor, so it has good practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to Serratia marcescens, a vaccine and a preparation method and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Serratia is called Serratia marcescens, which belongs to the genus Serratia. At present, the research on Serratia marcescens at home and abroad is mostly focused on its secondary metabolites prodigiosin, exoenzymes and its plant biocontrol effects. In addition, there are reports that Serratia marcescens can produce high levels of chitinase, esterase, etc. Therefore, Serratia marcescens has important practical application value.

[0004] At the same time, during the fermentation production and application of Serratia marcescens, it is inevitably faced with environmental stress effects from the external environment, such as temperature stress, acid-base stress, salt stress, etc., and these external environmental stresses affect the physiological activity of Serratia marcescens, thereby limiting its fermentation performance and practical application. Therefore, it is of great significance to further screen Serratia marcescens with stronger environmental adaptability and good biological activity. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide a Serratia marcescens, a vaccine and a preparation method and application thereof. Specifically, the present invention screens and obtains a strain of Serratia marcescens that has high environmental stress tolerance and has biological effects such as scavenging free radicals, regulating body immunity, and anti-tumor. Based on the above research results, the present invention is completed.

[0006] The first aspect of the present invention provides a Serratia marcescens HL-1, wherein the deposit number of the Serratia marcescens is CGMCC No.31403.

[0007] The strain was obtained by the inventor after mutagenesis. 16S rRNA of the strain was amplified and sequenced by PCR (16SrDNA sequence is shown in SEQ ID NO.1), and combined with physiological and biochemical indicators, it was shown that the bacterium was Serratia marcescens.

[0008] The second aspect of the present invention provides the use of the above-mentioned Serratia marcescens HL-1 in any one or more of the following:

[0009] (a) preparing immunomodulatory products;

[0010] (b) preparing products for the prevention, treatment and / or adjuvant treatment of tumors;

[0011] The present invention proves through research that the above-mentioned Serratia marcescens HL-1 and its fermentation liquid have the activity of scavenging free radicals (ABTS free radicals, DPPH free radicals and hydroxyl free radicals), improving the body's antioxidant capacity, thereby further regulating and improving the body's immunity.

[0012] In another specific embodiment of the present invention, the product may include fermentation broth, fermentation broth supernatant, fermentation broth precipitate, live bacteria and / or dead bacteria of Serratia marcescens HL-1.

[0013] The fermentation liquid refers to the liquid obtained by inoculating the HL-1 strain of Serratia marcescens into a culture medium and culturing the culture medium. In the present invention, the culture medium can be any culture medium for culturing bacteria. In a specific embodiment of the present invention, the culture medium is LB culture medium.

[0014] The fermentation liquid supernatant refers to the clarified liquid on the upper layer of the fermentation liquid after centrifugation; it contains metabolites (mainly extracellular metabolites) and a part of bacterial fragments during the growth and reproduction of Serratia marcescens.

[0015] The fermentation broth precipitate refers to the liquid precipitate obtained by centrifugation of the fermentation broth, including but not limited to the residual bacteria of Serratia marcescens, broken cells and residues of the culture matrix.

[0016] The live bacteria are live bacteria of Serratia marcescens, which can be colonized and reproduced in the intestinal tract of the host, thereby increasing the number of strains of Serratia marcescens.

[0017] The dead bacteria are Serratia marcescens that have lost their vitality and are unable to grow and reproduce. Specifically, the Serratia marcescens may be devitalized during the production process, such as by inactivation with chemical reagents (such as β-propiolactone, formaldehyde, etc.) or physical methods (such as high-temperature heating or radiation).

[0018] The product can be a medicine, a pharmaceutical raw material or an industrial raw material.

[0019] When the product is a medicine, specifically, the medicine also includes pharmaceutically acceptable excipients.

[0020] More specifically, the pharmaceutically acceptable excipient is selected from any one or more of a buffer, an excipient, a diluent, a preservative, a wetting agent, an emulsifier, a lubricant, a thickener, a stabilizer, a solubilizer, a suspending agent and a suspending aid.

[0021] Preferably, the pharmaceutically acceptable excipients may be selected from glucose, water, lactose, sucrose, glycerol, ethanol, propylene glycol, mannitol, corn starch, gelatin, alginic acid, microcrystalline cellulose, kaolin, dicalcium phosphate, sodium chloride, cross-linked sodium carboxymethyl cellulose and sodium starch glycolate, etc., without specific limitation herein.

[0022] Specifically, the tumor is used in the present invention as known to those skilled in the art, and includes benign tumors and / or malignant tumors. Benign tumors are defined as excessive proliferation of cells that are unable to form aggressive, metastatic tumors in the body. Conversely, malignant tumors are defined as cells with multiple cellular and biochemical abnormalities that are capable of forming systemic diseases (e.g., forming tumor metastases in distant organs).

[0023] In another embodiment of the present invention, the drug of the present invention can be used to treat malignant tumors. Examples of malignant tumors that can be treated with the drug of the present invention include solid tumors and hematological tumors.

[0024] Solid tumors may be of the breast, bladder, bone, brain, central and peripheral nervous system, colon, endocrine glands (such as thyroid and adrenal cortex), esophagus, endometrium, germ cell, head and neck, liver, lung, larynx and hypopharynx, mesothelioma, ovary, pancreas, prostate, rectum, kidney, small intestine, soft tissue, testis, stomach, skin (such as melanoma), ureter, vagina and vulva.

[0025] More specifically, the tumor may be an ascites tumor.

[0026] The third aspect of the present invention provides a drug, wherein the active ingredient of the drug at least includes Serratia marcescens HL-1; the deposit number of the Serratia marcescens HL-1 is CGMCC No. 31403. The drug can be used to regulate the immune activity of the body and / or improve tumors.

[0027] Specifically, the Serratia marcescens is one or more of its fermentation broth, fermentation broth supernatant, fermentation broth precipitate, live bacteria and dead bacteria.

[0028] Furthermore, the active ingredients of the drug may also include any other known products for regulating the body's immune activity and / or improving tumors, and the products may be known chemotherapy drugs (such as cisplatin, docetaxel, etc.).

[0029] The drug can be a vaccine.

[0030] The vaccine is a preparation for enhancing immunity and producing specific antibodies against a specific infectious disease, including preparations made from dead microorganisms, vaccines made from live microorganisms but with their toxicity reduced by screening or genetic engineering, and vaccines made from live and fully toxic microorganisms. Generally, vaccines are divided into live vaccines and dead vaccines. In the present invention, the vaccine can be a dead vaccine.

[0031] The medicine of the present invention can be administered to the body in a known manner. For example, it can be delivered to the tissue of interest by intravenous systemic delivery or local injection (such as intratumoral injection). Such administration can be carried out via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be administered in the present invention can vary depending on a variety of factors to a great extent, such as target cells, biological types or their tissues, the general condition of the subject to be treated, routes of administration, modes of administration, etc.

[0032] In another specific embodiment of the present invention, the subjects of drug administration can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, gorillas, etc.

[0033] The fourth aspect of the present invention provides a method for preparing the above-mentioned drug, which comprises culturing the above-mentioned Serratia marcescens HL-1.

[0034] Specifically, the culture medium for Serratia marcescens HL-1 can be any culture medium for culturing bacteria. In a specific embodiment of the present invention, the culture medium is LB culture medium.

[0035] Furthermore, when the drug is a vaccine preparation, the preparation method further comprises inactivating the Serratia marcescens, such as using chemical reagents (such as β-propiolactone, formaldehyde, etc.) or physical methods (such as high temperature heating or radiation, etc.), which are not specifically limited here.

[0036] The fifth aspect of the present invention provides a method for regulating immune activity of an organism, characterized in that the method comprises administering the Serratia marcescens HL-1 or the drug to a subject.

[0037] The sixth aspect of the present invention provides a method for preventing, treating and / or assisting in treating tumors, characterized in that the method comprises administering the Serratia marcescens HL-1 or the drug to a subject.

[0038] In the fifth and sixth aspects of the present invention, the subject refers to an animal that has been the subject of treatment, observation or experiment, preferably a mammal, and most preferably a human.

[0039] The technical effects achieved by one or more of the above technical solutions are:

[0040] The above technical scheme discloses for the first time a strain of Serratia marcescens HL-1, which has been verified by experiments to not only have good tolerance to environmental stress, but also have biological effects such as scavenging free radicals, regulating the body's immunity, and anti-tumor.

[0041] Storage Instructions:

[0042] Strain HL-1

[0043] Deposit number: CGMCC No.31403;

[0044] Classification name: Serratia marcescens;

[0045] Deposit date: July 25, 2024;

[0046] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0047] Abbreviation of depository unit: CGMCC;

[0048] Address of the preservation unit: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The scratch test of CGMCC No.31403 in Example 4 of the present invention was used to detect the cell migration ability. (a) The cell scratch test results of the negative group at a magnification of 8×40. (b) The cell scratch test results of the positive group at a magnification of 8×40. (c) 0.2×10 6 The cell scratch results of the CFU group at a magnification of 8×40. (d) 0.4×10 6 The cell scratch results of the CFU group at a magnification of 8×40. (e) 0.8×10 6 The cell scratch results of the CFU group at a magnification of 8×40. (f) 2×10 6 The cell scratch results of the CFU group at a magnification of 8×40. (g) 4×10 6 The cell scratch results of the CFU group at a magnification of 8×40. (h) 8×10 6 Cell scratch results of the CFU group at a magnification of 8×40.

[0050] Figure 2 The cell invasion ability was detected by Transwell assay of CGMCC No.31403 in Example 4 of the present invention. (a) Transwell assay staining results of negative group (magnification 8×40). (b) Transwell assay staining results of positive group (magnification 8×40). (c) 0.2×106 Transwell staining results of cfu group (magnification 8×40). (d) 0.4×10 6 Transwell assay staining results of cfu group (magnification 8×40). (e) 0.8×10 6 Transwell staining results of cfu group (magnification 8×40). (f) 2×10 6 Transwell assay staining results of cfu group (magnification 8×40). (g) 4×10 6 Transwell staining results of cfu group (magnification 8×40). (h) 8×10 6 Transwell assay staining results of the cfu group (magnification 8×40).

[0051] Figure 3 Trypan blue staining of CGMCC No.31403 in Example 4 of the present invention to detect cell viability. (a) Trypan blue staining results of the negative group (magnification: 8×10). (b) Trypan blue staining results of the positive group (magnification: 8×10). (c) 0.2×10 6 Trypan blue staining results of the cfu group (magnification: 8×10). (d) 0.4×10 6 Trypan blue staining results of cfu group (magnification: 8×10). (e) 0.8×10 6 Trypan blue staining results of cfu group (magnification: 8×10). (f) 2×10 6 Trypan blue staining results of cfu group (magnification: 8×10). (g) 4×10 6 Trypan blue staining results of cfu group (magnification: 8×10). (h) 8×10 6 Trypan blue staining results of the cfu group (magnification: 8×10). (i) Cell death rate of each group.

[0052] Figure 4 The following are the typical morphological observation results of mice in the experimental group and the control group in Example 5 of the present invention.

[0053] Figure 5 This is the ascites cell analysis of animals after intraperitoneal administration of CGMCC No.31403 in Example 5 of the present invention; A: blank control group; B: negative control group; C: positive control group; D: experimental group 1; E: experimental group 2; F: experimental group 3.

[0054] Figure 6 This is an analysis of the IL-6 cytokine detection results after intraperitoneal administration of CGMCC No.31403 in Example 5 of the present invention.

[0055] Figure 7 This is an analysis of the TNF-α cytokine detection results after intraperitoneal administration of CGMCC No.31403 in Example 5 of the present invention.

[0056] Figure 8 This is an analysis of the IL-2 cytokine detection results after intraperitoneal administration of CGMCC No.31403 in Example 5 of the present invention.

[0057] Fig. 9 This is an analysis of the IFN-γ cytokine detection results after intraperitoneal administration of CGMCC No.31403 in Example 5 of the present invention. DETAILED DESCRIPTION

[0058] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0059] The Serratia marcescens HL-1 of the present invention has been deposited in the General Microbiology Center of the China National Microbiological Culture Collection Administration on July 25, 2024, with a deposit number of CGMCC No. 31403, and may also be referred to as CGMCC No. 31403 in the following embodiments.

[0060] Example 1

[0061] Serratia marcescens HL-1 is a strain obtained by the inventor from a self-screened strain library. The 16S rRNA of the strain was amplified and sequenced by PCR (the 16S rDNA sequence is shown in SEQ ID NO.1), and the strain was determined to be Serratia marcescens in combination with physiological and biochemical indicators. Its colonies on LB solid culture medium are round protrusions, milky white; the LB fermentation broth is light yellow and does not produce red pigment.

[0062] Study on its tolerance to environmental stress:

[0063] 1.1 The activated CGMCC No.31403 was inoculated into LB liquid medium with a salinity of 0-11%, and the bacterial solution was inoculated at a ratio of 3% (v / v). After culturing at 30°C and 180rpm for 24 hours, the growth of each group of strains under different salt concentrations was observed. The results are shown in Table 1 below. The results show that CGMCC No.31403 has excellent salt tolerance and can still grow when the salt concentration reaches 9%.

[0064] Table 1 Growth of CGMCC No.31403 under different concentrations of NaCl

[0065]

[0066] Note: “-” indicates no bacterial growth, “+” indicates bacterial growth and the count is less than 10 4 cfu / mL, "++" means the number of bacteria counted is 10 4 -10 6 cfu / mL, "+++" means the number of counted bacteria is greater than 10 6 cfu / mL.

[0067] 1.2 The activated CGMCC No.31403 was inoculated into LB liquid medium with a pH of 4.0-10.0, and the bacterial solution was inoculated at a ratio of 3% (v / v). After culturing at 30°C and 180rpm for 24 hours, the growth of each group of strains under different pH conditions was observed. The results are shown in Table 2 below. The results show that it can grow in the pH range of 4.5-10, has a wide range of adaptability, and has good acid and alkali resistance.

[0068] Table 2 Growth of CGMCC No.31403 at different pH

[0069]

[0070] Note: “-” indicates no bacterial growth, “+” indicates bacterial growth and the count is less than 10 4 cfu / mL, "++" means the number of bacteria counted is 10 4 -10 6 cfu / mL, "+++" means the number of counted bacteria is greater than 10 6 cfu / mL.

[0071] 1.3 The activated CGMCC No.31403 was inoculated into LB liquid culture medium at a ratio of 3% (v / v), and the growth of each group of strains under different temperature conditions was observed after culturing at 15-45°C and 180rpm for 24 hours. The results are shown in Table 3 below. The strain can grow at a temperature range of 15-45°C, indicating that the strain has good low temperature and high temperature resistance.

[0072] Table 3 Growth of CGMCC No.31403 at different temperatures

[0073]

[0074] Note: “++” means the number of bacteria counted is within 10 4 -10 6 cfu / mL, "+++" means the number of counted bacteria is greater than 10 6 cfu / mL.

[0075] In summary, the strain has good salt tolerance and can still grow in 9% NaCl culture medium. At the same time, its growth pH and growth temperature ranges are relatively wide. It can grow well in pH 4.5-10 and 15-45°C environments, showing excellent environmental stress tolerance, which is very beneficial for its practical application.

[0076] Example 2

[0077] The free radical scavenging activity and total antioxidant capacity of the CGMCC No.31403 sample were determined. The CGMCC No.31403 sample solution was prepared by the following method: the activated CGMCC No.31403 was inoculated into LB liquid culture medium at a ratio of 3% (v / v), and cultured at 30°C and 180rpm for 24 hours to obtain the bacterial solution. The bacterial solution was subjected to pure strain inspection and live bacteria count, and the results showed that the pure strain was qualified. The qualified bacterial solution was mixed with 0.5% (v / v) formaldehyde aqueous solution at 1% of the total bacterial solution, and placed at 30°C for 48 hours for inactivation. After the qualified inactivated bacterial solution was concentrated by centrifugation, the concentration of the inactivated bacterial solution was adjusted to 2×10 with sterile water according to the live bacteria count result before inactivation. 8 cfu / mL, and used it as the sample solution for subsequent free radical scavenging activity and total antioxidant capacity experiments.

[0078] 1.1 Hydroxyl radical scavenging ability

[0079] The determination was carried out using the salicylic acid method, specifically, 1 mL of FeSO4 solution (9 mmol / L), 1 mL of salicylic acid ethanol solution (9 mmol / L), 1 mL of the above sample solution and 1 mL of hydrogen peroxide solution (9 mmol / L) were mixed evenly in a test tube. After fully mixing, react at room temperature for 30 minutes, centrifuge at 10000 r / min for 10 minutes, and measure the absorbance of the supernatant at 510 nm. 2 mg / mL V C As a positive control, deionized water was used as a blank control, and the hydroxyl radical scavenging rate was calculated according to the following formula:

[0080] Clearance rate (%) = [1-(A0-A) / A0] × 100%

[0081] Where: A0 is the absorbance of the blank control, A is the absorbance of the sample.

[0082] After testing, the hydroxyl radical scavenging rate of the sample solution was 72.25%.

[0083] 1.2DPPH free radical scavenging ability

[0084] Take 1mL of sample solution in a test tube, add 1mL of DPPH-ethanol solution (0.15mmol / L), mix well and let it stand for 30min (protected from light), mix 1mL of sample solution with 1mL of anhydrous ethanol, and measure its absorbance at 517nm. C As a positive control, the DPPH free radical scavenging rate is:

[0085] Clearance (%) = [l-(A-A0) / A1] × 100

[0086] Where: A is the absorbance of the mixture of 1 mL sample solution and 1 mL DPPH-ethanol solution;

[0087] A0 is the absorbance of a mixture of 1 mL of sample solution and 1 mL of ethanol;

[0088] A1 is the absorbance of a mixture of 1 mL of deionized water and 1 mL of DPPH-ethanol solution.

[0089] After testing, the DPPH free radical scavenging rate of the sample solution was 64.32%.

[0090] 1.3 ABTS free radical scavenging ability

[0091] Mix equal volumes of ABTS solution (7mmol / L) and K2S2O8 solution (4.9mmol / L), and keep it in the dark for 12 hours to obtain ABTS stock solution. Dilute the ABTS stock solution with PBS buffer (0.1mol / L, pH 7.4) to make its absorbance at 734nm 0.7±0.02, and obtain ABTS working solution. Take 0.8mL ABTS working solution in a test tube, add 0.2mL sample solution, and keep it in the dark for 6 minutes at room temperature. Measure the absorbance at 734nm, and use PBS buffer as a control. Use V C As a positive control. The ABTS free radical scavenging rate is: scavenging rate (%) = [1-(AA s ) / A0]×100

[0092] Where: As is the absorbance of the sample tube;

[0093] A0 is the absorbance of the phosphate buffer control tube.

[0094] After testing, the ABTS free radical scavenging rate of the sample solution was 59.85%.

[0095] 1.4 Determination of total antioxidant capacity

[0096] The total antioxidant capacity (T-AOC) was determined according to the operating instructions of the Nanjing Jiancheng Bioengineering Research Institute kit (Cat. No. A015-1, colorimetric method). After testing, the total antioxidant capacity of the sample solution was 105.23 U / mL.

[0097] In summary, the Serratia marcescens preparation has good total antioxidant capacity and free radical scavenging (ABTS free radical, DPPH free radical and hydroxyl free radical) activity, thereby effectively improving the body's immune activity.

[0098] Example 3

[0099] The antitumor activity of the Serratia marcescens preparation in Example 2 was studied. The concentration of the inactivated CGMCC No.31403 bacterial solution was adjusted to 2×10 8 cfu / mL. Sterile water was used as a control, and different tumor cells were inoculated in a 96-well plate, with 1×10 cells in each well. 4 cells / mL, the sample volume was 20μL, and after culturing for 48h at 37℃ in a CO2 incubator, the inhibition rate of proliferation of different tumor cells (non-small cell lung cancer A549, liver cancer cell Huh7, gastric cancer cell SGC-7901, colon cancer cell HT-29, breast cancer cell MDA-MB-231, osteosarcoma cell 143B) after 72h was calculated based on the MTT method. The test results are shown in Table 4 below. The results show that it has an inhibitory effect on different tumor cells. It shows that it has a broad-spectrum anti-tumor activity.

[0100] Table 4 Antitumor effect of Serratia marcescens preparations

[0101]

[0102] To further explore its anti-tumor efficacy, in vitro and in vivo experiments were performed on the inactivated Serratia marcescens preparation based on ascites tumor cells S180.

[0103] Example 4

[0104] 1.1 The preparation of Serratia marcescens was prepared as shown in Table 5 below.

[0105] Table 5 Serratia marcescens preparations

[0106]

[0107] Note: The preparation method of the stock solution is as follows: inoculate the activated CGMCC No.31403 into LB liquid culture medium at a ratio of 3% (v / v), culture at 30°C and 180rpm for 24h to obtain the bacterial solution, and perform a pure strain test and live bacteria count on the bacterial solution. The pure strain is qualified. Add 0.5% (v / v) formaldehyde aqueous solution to the qualified bacterial solution at 1% of the total bacterial solution, mix well, and place at 30°C for 48h for inactivation. After the qualified inactivated bacterial solution is concentrated by centrifugation, the concentration of the inactivated bacterial solution is adjusted to 500×10 with sterile water according to the live bacteria count result before inactivation. 6 cfu / mL.

[0108] 1.2 Cell scratch assay

[0109] S180 cells were made into 1×10 4 cells / mL of cell suspension, add 0.2×10 6 cfu, 0.4×10 6 cfu, 0.8×10 6 cfu, 2×10 6 cfu, 4×10 6 cfu, 8×10 6 Each group was treated with drugs for 24 h and the cells were made into 5×10 3 cells / mL cell suspension and inoculate it in a 6-well plate. When the cells grow to 80%-90% of the full plate, use a 100μL sterile pipette tip to vertically and evenly scratch from top to bottom, rinse the cell debris with PBS solution, add new 1640 complete medium for cell culture, and take out and place on an inverted microscope for observation and recording after 24h of culture. Combined with the results of microscopic observation, the cell migration rate is calculated using the formula, and the migration rate calculation formula is: scratch healing rate (%) = (0h cell scratch distance-24h cell scratch distance) / 0h cell scratch distance.

[0110] The results are as follows Figure 1 As shown, the intervals at the scratches were measured and the migration rate of cells in each group was calculated. The cell migration rates of each group were compared, and the data between the groups were statistically significant (P<0.05). 8 The cell migration rate of the cfu group did not change much (<10%). 8 Although the cfu group was higher than the drug group with 0.2×10 6 The cell migration rate of the cfu group decreased slightly, but the overall magnitude was still small (<10%).6 The migration rate of the cfu group changed slightly (>10%, <20%). 6 cfu, 4×10 6 cfu, 8×10 6 The cfu group showed a large change and the change increased with the increase of the dosage. 6 cfu, 8×10 6 The change range of cfu was even greater than that of the cisplatin group, indicating that the Serratia marcescens preparation had an inhibitory effect on S180 cells and the inhibitory effect showed a trend of gradually increasing with increasing concentration.

[0111] 1.3 Transwell cell invasion assay

[0112] S180 cells were prepared into 1 × 10 4 cells / mL of cell suspension, add 0.2×10 6 cfu, 0.4×10 6 cfu, 0.8×10 6 cfu; 2×10 6 cfu, 4×10 6 cfu, 8×10 6 Each group of 20 μL of the Serratia marcescens preparation containing cfu was set up as a negative group and a cisplatin administration group (10 μM) for 24 hours. The upper layer was added with 1640 complete medium and the cell suspension and the Serratia marcescens preparation. The lower chamber was added with complete medium containing 10% fetal bovine serum. The culture medium was placed in a CO2 sterile incubator at 37°C for 24 hours and then the chamber was taken out. The cells were stained with crystal violet and observed under an inverted microscope. The results are shown in Figure 2. Figure 2 Each group had a certain degree of cell invasion. Compared with the Serratia marcescens and cisplatin-treated groups, there were more cells in the negative group. 6 cfu group, 0.4×10 6 cfu group and 0.8×10 6 The number of invasive cells in the cfu group decreased, and the number of invasive cells in the cfu group decreased. 6 cfu group, 4×10 6 cfu group, 8×10 8 The number of cells invading in the cfu group was smaller. The cell invasion rate was calculated, which proved that the cells in the negative group had stronger invasion ability, indicating that the Serratia marcescens preparation could inhibit the invasion ability of S180 cells, and 4×10 6 cfu group, 8×10 6 The ability of the cfu group to inhibit invasion was even stronger than that of cisplatin.

[0113] 1.4 Trypan blue staining experiment

[0114] S180 cells were prepared into 1 × 10 4 cells / mL of cell suspension, add 0.2×10 6 cfu, 0.4×10 6 cfu, 0.8×10 6 cfu; 2×10 6 cfu, 4×10 6 cfu, 8×10 6 Each group of 20 μL of the Serratia marcescens preparation containing cfu was set up as a negative group and a cisplatin administration group (10 μM). Each group was stained with trypan blue, and the cell suspension of different groups was aspirated with a 10 μL pipette at full scale and dropped on a glass slide and pushed, and observed under an inverted microscope at the same magnification. The cells stained light blue in the field of view were counted under an inverted microscope at the same magnification, and the cell mortality rate of each group was calculated. The mortality rate of each group was as follows: 66.82% in the positive group, 0.2×10 6 cfu group 29.33%, 0.4×10 6 cfu group 41.11%, 0.8×10 6 cfu group 44.21%, 2×10 6 cfu group 53.91%, 4×10 6 cfu group 67.41%, 8×10 6 cfu group 70.07%. Compared with the negative group, the Serratia marcescens administration group had more cells stained blue, proving that under the influence of the Serratia marcescens preparation, the cell viability was attenuated and the number of dead cells increased. At the same time, the S180 cell viability in the high-dose administration group was worse, and the high-concentration Serratia marcescens preparation had a stronger killing ability, which was even better than cisplatin. At the same time, the Serratia marcescens preparations (4×10 6 cfu / 20μL and 8×10 6 cfu / 20μL) and cisplatin (10μM) were co-administered to S180 cells, and it was unexpectedly found that both produced a certain synergistic anti-tumor effect. 6 The drug combination index CI of cfu / 20 μL Serratia marcescens preparation + 10 μM cisplatin was 0.84, 8×10 6 cfu / 20 μL Serratia marcescens preparation + 10 μM cisplatin has a drug combination index of 0.76), indicating that the Serratia marcescens of the present invention has the potential to be used in combination with other anti-tumor drugs.

[0115] Example 5

[0116] 1.1 Establishment of tumor-bearing mouse model

[0117] Kunming mice were intraperitoneally inoculated with 1.0×10 6 On the 10th day after the inoculation of S-180 cells, ascites was extracted under sterile conditions, diluted with PBS and counted, and used for the establishment of tumor models after 3 generations of intraperitoneal inoculation. The cultured cell suspension was transferred to a 5 ml centrifuge tube, centrifuged at 1000 rpm for 3 min, the supernatant was removed, 3 mL of PBS was added to resuspend the cells, and the cells were counted on a counting plate. Finally, the concentration of the cell suspension was 5 × 10 6 cells / mL. Place the cell suspension on ice. Before inoculation, use trypan blue staining to detect cell activity to ensure that the number of live cells is above 95%. Grab the mouse, disinfect the abdomen with alcohol cotton balls, and inject 0.2mL of cell suspension in the right lower abdomen to construct a tumor-bearing Kunming mouse model.

[0118] 1.2 Intraperitoneal administration of Serratia marcescens

[0119] 1.2.1 Experimental Materials

[0120] (1) Experimental reagents: inactivated Serratia marcescens (CGMCC No. 31403) stock solution. The stock solution preparation method is the same as that in Example 4, except that the concentration of the inactivated bacteria stock solution is adjusted to 500×10 8 cfu / mL. Dilute to the corresponding concentration with physiological saline before use.

[0121] (2) Experimental animals: Kunming mice, S180 cells.

[0122] 1.2.2 Animal grouping

[0123] Fifty tumor-bearing Kunming mice were randomly divided into five groups, with 10 mice in each group, and three experimental groups: 0.2×10 8 cfu / each dose group (experimental group 1), 0.4×10 8 cfu / each dose group (experimental group 2), 0.8×10 8 cfu / mouse / time dose group (experimental group 3) as well as positive control group and negative control group; at the same time, 10 normal Kunming mice formed a blank control group.

[0124] 1.2.3 Dosage regimen

[0125] (1)0.2×10 8 cfu / mouse / time dose group: mice were injected intraperitoneally with Serratia marcescens preparation 1 day after tumor bearing, 0.5 mL per mouse, once a week for a total of 8 times.

[0126] (2)0.4×10 8cfu / mouse / time dose group: mice were injected intraperitoneally with Serratia marcescens preparation 1 day after tumor bearing, 0.5 mL per mouse, once a week for a total of 8 times.

[0127] (3)0.8×10 8 cfu / mouse / time dose group: mice were injected intraperitoneally with Serratia marcescens preparation 1 day after tumor bearing, 0.5 mL per mouse, once a week for a total of 8 times.

[0128] (4) Positive control group: One day after the mice were tumor-bearing, docetaxel was intraperitoneally injected. The docetaxel solution was diluted to 0.9 mg / mL, and 0.62 mL / mouse / time was administered to the tumor-bearing mice once a week for a total of 8 times.

[0129] (5) Negative control group: 0.5 mL / mouse / time injection of normal saline was administered once a week for a total of 8 times to tumor-bearing Kunming mice.

[0130] (6) Blank control group: 0.5 mL / mouse / time injection of normal saline, once a week, for a total of 8 times, was administered to normal Kunming mice.

[0131] 1.3 ELISA assay for cytokines

[0132] After 8 doses of drug administration, blood was collected from the tail vein of all mice in the experimental group and the control group at 1h, 12h, 24h, 36h, and 48h, respectively, and the blood was centrifuged at 1000r / min to obtain serum. Cytokines IL-6, TNF-α, IL-2, and IFN-γ were detected using cytokine ELISA kits and microplate reader.

[0133] 1.4 Experimental Results

[0134] 1.4.1 Effects of intraperitoneal administration of Serratia marcescens preparations on the physiology of tumor-bearing mice

[0135] Table 6 Death of animals in each group after intraperitoneal administration

[0136]

[0137]

[0138] After stopping the drug, each experimental group continued to be fed for 1 month, and the mortality of mice in each group was counted. The experimental results are shown in Table 6. The mortality rate of the positive drug docetaxel group was 40%, and the mortality rate of experimental group 1 was 20%. The mortality rate of experimental group 1 was 20%, the mortality rate of experimental group 2 was 10%, and the mortality rate of experimental group 3 was 10%. The experiment confirmed that 0.4×10 8The Serratia marcescens preparation with a concentration of more than cfu / mouse is safe and has a significant tumor inhibition effect. From the experimental results, the blank control group had normal activity and body shape. The negative control group had poor activity, messy fur, and a significantly enlarged abdomen. The positive control group had poor activity, smooth fur, and a hunched back. In the implementation groups 1-3, some mice had messy fur and hunched backs, but most of them had strong activity and normal abdominal morphology. The results are shown in Figure 4 .

[0139] In order to further detect the presence of tumor cells in the peritoneal cavity of mice, the ascites of each group of animals was extracted for cell detection one month after drug withdrawal. Mice without ascites were rinsed with normal saline, and 2.0 μL of peritoneal fluid was taken for smear. After Wright staining, the peritoneal fluid cells were observed under a microscope. The results are shown in Table 1. Figure 5 The results showed that there were basically no tumor cells or some dead cell fragments in the ascites of the surviving mice. And the anti-tumor effect of the Serratia marcescens preparation was better than that of the positive drug docetaxel.

[0140] 1.4.2 Effects of intraperitoneal administration on cytokines in tumor-bearing mice

[0141] Analysis of IL-6 cytokine experimental results Figure 6 As shown in the figure, the expression of IL-6 cytokines in experimental group 1 increased from 1 to 24 hours, decreased from 24 to 36 hours, and increased gently from 36 to 48 hours. The expression at each time point was lower than that of the negative control group and the blank control group. The expression of IL-6 cytokines in experimental group 2 increased from 1 to 24 hours, decreased from 24 to 36 hours, and increased from 36 to 48 hours. The expression at each time point was lower than that of the negative control group and the blank control group. The expression of IL-6 cytokines in experimental group 3 increased from 1 to 24 hours, decreased from 24 to 36 hours, and increased from 36 to 48 hours. Except that the expression at 24 hours was equal to that of the negative control group and slightly greater than that of the blank control group, the expression at the other time points was lower than that of the negative control group and the blank control group. The expression of IL-6 cytokines in the negative control group was higher than that in the blank control group, and the change was stable. The expression of IL-6 cytokine in the positive control group increased from 1 to 12 hours, decreased from 12 to 24 hours, was flat from 24 to 36 hours, and slightly increased from 36 to 48 hours. The expression at each time point was lower than that of the negative control group. IL-6 cytokine has a strong potential in cancer cells to promote tumor growth, development and release. Serratia marcescens preparations have an inhibitory effect on IL-6 cytokine.

[0142] Analysis of TNF-α cytokine experimental results Figure 7As shown in the figure, the expression of TNF-α cytokines in experimental group 1 increased from 1 to 12 hours and decreased from 12 to 48 hours. The expression at each time point was lower than that of the blank control group. The expression at 12 hours and 24 hours was slightly higher than that of the negative control group, and the expression at other times was lower than that of the negative control group. The expression of TNF-α cytokines in experimental group 2 increased from 1 to 24 hours, decreased from 24 to 36 hours, and increased from 36 to 48 hours. The expression at 24 hours was higher than that of the blank control group, and the expression at other time points was lower than that of the blank control group. The expression at 24 hours was higher than that of the negative control group, and the expression at other time points was lower than that of the negative control group. The expression of TNF-α cytokines in experimental group 3 increased from 1 to 12 hours and decreased from 12 to 48 hours. The expression at each time point was lower than that of the blank control group. The expression at 12 hours and 24 hours was higher than that of the negative control group, and the expression at other time points was lower than that of the negative control group. The negative control group and the blank control group fluctuated gently. The expression of TNF-α cytokines in the negative control group was relatively gentle, and was lower than that of the blank control group at each time point. The expression of TNF-α cytokine in the positive control group showed a trend of slightly increasing from 1 to 12 hours, decreasing from 12 to 24 hours, being stable from 24 to 36 hours, and increasing from 36 to 48 hours. It was slightly lower than that in the negative control group at 1 hour, 12 hours, and 48 hours, and was lower than that in the negative control group at 24 hours and 36 hours.

[0143] Analysis of IL-2 cytokine experimental results Figure 8 As shown, the expression of IL-2 cytokines in experimental group 1 showed a trend of increasing from 1 to 12 hours, flat from 12 to 24 hours, and decreasing from 24 to 48 hours. The expression levels at 1 hour and 48 hours were lower than those in the blank control group, and the expression levels at other time points were higher than those in the blank control group, and the expression levels at each time point were higher than those in the negative control group. The expression of IL-2 cytokines in experimental group 2 showed a trend of increasing from 1 to 12 hours and decreasing from 12 to 48 hours. The expression levels at 1 hour and 48 hours were lower than those in the blank control group, and the expression levels at other time points were higher than those in the blank control group. The expression levels at 1 hour and 48 hours were slightly equal to those in the negative control group, and the expression levels at other time points were higher than those in the negative control group. The expression of IL-2 cytokines in experimental group 3 showed a trend of increasing from 1 to 12 hours and decreasing from 12 to 48 hours. The expression levels at 1 hour and 48 hours were lower than those in the blank control group, and the expression levels at other time points were higher than those in the blank control group, and the expression levels at each time point were higher than those in the negative control group. The expression of IL-2 cytokines in the negative control group showed a flat trend, and were lower than those in the blank control group at each time point. The expression level of IL-2 cytokine in the positive control group increased from 1 to 12 hours, slightly increased from 12 to 24 hours, slightly decreased from 24 to 36 hours, and decreased from 36 to 48 hours. The expression levels at 1 hour and 48 hours were lower than those in the negative control group, and the expression levels at other time points were higher than those in the negative control group.

[0144] Analysis of IFN-γ cytokine experimental results Fig. 9As shown in the figure, the expression of IFN-γ cytokines in experimental group 1 showed a trend of decreasing from 1 to 12 hours, increasing from 12 to 24 hours, and decreasing from 24 to 48 hours. The expression levels at each time point were lower than those in the blank control group. The expression levels at 24 hours and 36 hours were higher than those in the negative control group, and the expression levels at other time points were lower than those in the negative control group. The expression of IFN-γ cytokines in experimental group 2 showed a trend of increasing from 1 to 24 hours and decreasing from 24 to 48 hours. The expression level at 24 hours was higher than that in the blank control group, and the expression levels at other time points were lower than those in the blank control group, and the expression levels at other time points were higher than those in the negative control group. The expression of IFN-γ cytokines in experimental group 3 showed a trend of decreasing from 1 to 12 hours, increasing from 12 to 36 hours, and decreasing from 36 to 48 hours. The expression levels at each time point were lower than those in the blank control group, and the expression level at 12 hours was equal to that in the negative control group, and the expression levels at other time points were higher than those in the negative control group. The expression of IFN-γ cytokines in the negative control group showed a gentle trend, and were lower than those in the blank control group at each time point. The expression of IFN-γ cytokine in the positive control group increased from 1 to 12 hours, decreased from 12 to 24 hours, was stable from 24 to 36 hours, and decreased from 36 to 48 hours. The expression at 48 hours was equal to that of the negative control group, and the expression at other time points was higher than that of the negative control group. The above results show that CGMCC No. 31403 can exert anti-tumor effects by affecting the expression of different cytokines.

[0145] Serratia marcescens HL-1 (CGMCC No.31403) 16S rDNA sequence:

[0146] CTCAGATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAGCGGTAGCACAG

[0147] GGGAGCTTGCTCCCTGGGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAAC

[0148] TGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGC

[0149] AAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGAT

[0150] TAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGA

[0151] GGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC

[0152] AGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGAAGCCATGCCGCGTGTGTGA

[0153] AGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGTGGTGAACTTAAT

[0154] ACGTTCATCAATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCA

[0155] GCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA

[0156] CGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCA

[0157] TTTGATACTGGCAAGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGG

[0158] TGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGA

[0159] AGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGT

[0160] AGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCC

[0161] GGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCA

[0162] AATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAA

[0163] CGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGT

[0164] GCCTTCGGGAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAA

[0165] ATGTTGGGTTAAGTCGCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGGTTCG

[0166] GCCGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGACG

[0167] TCAAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCATATACA

[0168] AAGAGAAGCGACCTCGCGAGAGCAAGCGGACCTCATAAAGTATGTCGTAGTCCGGA

[0169] TTGGAGTCTGCAACTCGACTCCATGAAGTCGGAATCGCTAGTAATCGTAGATCAGAATGCTACGGTGAATACGTTCCCGGGCCTTGTACACA (SEQ ID NO. 1)

[0170] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to perform equivalent replacements on parts thereof. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention. Although the above describes the specific implementation methods of the present invention, it is not intended to limit the protection scope of the present invention. Those skilled in the art should understand that, based on the technical solution of the present invention, various modifications or deformations that can be made by those skilled in the art without creative labor are still within the protection scope of the present invention.

Claims

1. A Serratia marcescens ( Serratia marcescens )HL-1, the deposit number of the Serratia marcescens HL-1 is CGMCC No.31403.

2. Use of the Serratia marcescens HL-1 according to claim 1 in any one or more of the following: (a) preparing immunomodulatory products; (b) preparing products for the prevention, treatment and / or adjuvant treatment of tumors; The product is any one or more of a drug, a pharmaceutical raw material or an industrial raw material; The product contains dead bacteria of Serratia marcescens HL-1; The immune regulation is manifested in scavenging free radicals and improving antioxidant capacity; the free radicals are ABTS free radicals, DPPH free radicals and hydroxyl free radicals; The tumor is non-small cell lung cancer, liver cancer, stomach cancer, colon cancer, breast cancer, osteosarcoma or ascites tumor.

3. A drug, characterized in that The active ingredient of the medicine at least comprises Serratia marcescens HL-1; the preservation number of the Serratia marcescens HL-1 is CGMCC No.31403, and the Serratia marcescens HL-1 is a dead bacterium.

4. The drug according to claim 3, characterized in that The drug is used to regulate the body's immune activity and / or improve tumors; The regulation of the body's immune activity is manifested in the removal of free radicals and the improvement of antioxidant capacity; the free radicals are ABTS free radicals, DPPH free radicals and hydroxyl free radicals; The tumor is non-small cell lung cancer, liver cancer, stomach cancer, colon cancer, breast cancer, osteosarcoma or ascites tumor.

5. The drug according to claim 3, characterized in that The medicine is a dead vaccine.

Images