Application of MmpE gene in regulating and controlling virulence of mycobacterium bovis

Abstract

The invention discloses application of an MmpE gene in regulating and controlling virulence of mycobacterium bovis, the nucleotide sequence of the MmpE gene is shown as SEQ ID NO.1, the amino acid sequence of encoded protein is shown as SEQ ID NO.2, the protein encoded by the MmpE gene is nuclear regulatory protein and is positioned in a host cell nucleus, and the MmpE gene can be used for regulating and controlling the virulence of mycobacterium bovis. The MmpE protein can inhibit the inflammation level of a host and enhance the survival and colonization functions of the mycobacterium bovis in host cells after entering the nucleus, the MmpE protein plays a nuclear localization function by depending on two nuclear localization signal sequences (NLS), the two NLSs are respectively located at the 20th-22th site and the 460th-462th site of the amino acid sequence shown as SEQ ID NO.2, and then the MmpE gene or the two NLSs thereof is modified, so that the activity of the MmpE protein in the host cells is improved, and the activity of the MmpE protein in the host cells is improved. And obtaining the mycobacterium bovis attenuated strain. The invention finds an important target capable of inhibiting mycobacterium bovis infection, and has important application value in preparation of novel mycobacterium bovis vaccines and drugs.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, relates to the application of MmpE gene in regulating the virulence of Mycobacterium bovis, and also relates to a Mycobacterium bovis attenuated strain and a preparation method thereof. Background Art

[0002] Tuberculosis has always been a major challenge in the field of global public health. Mycobacterium tuberculosis (Mtb) and its Mycobacterium tuberculosis Complex (MTBC) are the main pathogens that cause tuberculosis in humans and animals. Mtb is the main pathogen that causes human pulmonary tuberculosis, while Mycobacterium bovis and Mycobacterium caprae in MTBC are called bovine variants and caprine variants of Mtb, which mainly cause bovine tuberculosis and caprine tuberculosis. The Bacillus Calmette-Guérin (BCG) vaccine, a weakly virulent strain of Mycobacterium bovis, is the only vaccine licensed on the market for the prevention of human tuberculosis, but its protective effect is limited and cannot completely prevent the occurrence and spread of pulmonary tuberculosis in children, and has no protective effect on adults. Therefore, in-depth research on the pathogenic mechanism and immune escape strategy of Mtb is crucial for developing new prevention and treatment programs and curbing this serious zoonosis.

[0003] As a typical intracellular pathogen, Mtb faces many defense strategies of host cells during infection, such as macrophage-mediated antigen presentation, lysosomal maturation, and apoptosis. At the same time, Mtb has also successfully evolved a complex and sophisticated intracellular survival mechanism in the long-term confrontation with the host. Among them, the strategy of counteracting and weakening the host immune response by secreting a variety of virulence factors has received widespread attention. For example, Mtb can not only inhibit T cell-mediated specific immune responses by secreting antigens such as Ag85B, ESAT-6, and CFP10, but also inhibit the innate immune response of macrophages by secreting virulence factors such as phosphatase SapM, serine / threonine protein kinase PknG, and nucleoside diphosphate kinase A (NdkA), thereby enhancing the survival ability of bacteria. At present, the research on the pathogenic mechanism of Mtb mainly focuses on the interaction between secreted or non-secreted proteins of pathogens and host cell plasma membrane, cytoplasm or organelle proteins, and rarely involves the mechanism by which its virulence factors enter the host cell nucleus to play a role. Therefore, screening and identifying Mtb nuclear regulatory proteins and in-depth exploration of their mechanism of action in the host cell nucleus are important breakthroughs in studying pathogens, and can lay a solid foundation for the development of new vaccines and therapeutic drugs for pathogens.

[0004] The present invention uses Mycobacterium bovis as the research object. First, the conserved nuclear regulatory proteins in mycobacteria are screened by using bioinformatics analysis technology combined with a high-content cell imaging system. Then, the strain BCG (ATCC: 35734) is used as the research object to identify the effect of nuclear regulatory proteins on the virulence of Mycobacterium bovis during host infection. In this process, we found that (1) the hypothetical protein MmpE has the function of entering the nucleus and can significantly enhance the virulence of bacteria; (2) the virulence factor MmpE depends on RRR 20-22 (R1) and RRK 460-462 (R2) The amino acid sequence enters the host cell nucleus; (3) After entering the host cell nucleus, MmpE can significantly inhibit the level of inflammation in the host and enhance the survival and colonization of Mycobacterium bovis in the host cell. Therefore, MmpE and its mutants RRR 20 -22 (ΔR1) and RRK 460-462 (ΔR2) is expected to be used as a new target for the development of new anti-tuberculosis vaccines or drugs, and play a role in the prevention and treatment of tuberculosis in animals and humans. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the MmpE gene in regulating the virulence of Mycobacterium bovis, and also to provide a Mycobacterium bovis attenuated strain and a preparation method thereof. The present invention utilizes genetic engineering technology to recombinant Mycobacterium bovis, and the obtained attenuated strain has the advantages of good immunogenicity and high production safety.

[0006] To achieve the above objectives, the applicant identified the conserved nuclear regulatory proteins of mycobacteria through bioinformatics analysis combined with a high-content cell imaging system, and screened out multiple target proteins that can enter the host cell nucleus and contain nuclear localization signal sequences (NLS). One of the proteins is encoded by the MmpE gene, the nucleotide sequence of the MmpE gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. The protein contains two NLSs, namely, RRR 20-22 (R1) and RRK 460-462 (R2).

[0007] Next, the MmpE gene was amplified from the BCG genome and a recombinant plasmid was constructed. The recombinant plasmid was used to transfect HEK293T cells, and the nuclear entry ability of the MmpE protein was detected by qRT-PCR and Western blot experiments, confirming that the protein encoded by the MmpE gene is a nuclear regulatory protein.

[0008] Furthermore, the applicant used homologous recombination technology to introduce the exogenous hyg resistance gene into the genome of Mycobacterium bovis, and through homologous sequence exchange, the DNA fragment of the exogenous hyg gene replaced the MmpE gene at the original site, and successfully constructed a recombinant BCG hyg:: mmpE in which the MmpE gene was replaced. At the same time, the MmpE gene sequence was subjected to point mutation by overlapping extension PCR to obtain truncated mutant fragments mmpE-ΔR1, mmpE-ΔR2, and mmpE-ΔR1R2 in which the two NLS of the MmpE gene were modified separately or simultaneously, and the truncated mutant fragments were fused and connected with the linearized complementation plasmid pLJR965 vector to obtain the MmpE gene complementation plasmid and transform the successfully constructed MmpE gene knockout strain BCG hyg:: mmpE, and finally successfully constructed the MmpE gene partial complementation strain Comp-MmpE-ΔR1 (RRR) in which the two NLS were modified separately or simultaneously. 20-22 Deletion), Comp-MmpE-ΔR2(RRK 460-462 Deletion), Comp-MmpE-ΔR1R2(RRR 20-22 and RRK 460-462 double deletion).

[0009] The knockout strain and each complemented strain were used to infect macrophages, respectively, and the survival ability of Mycobacterium bovis in host cells was detected. The results showed that compared with the wild-type strain, the survival ability of the knockout strain BCG hyg:: mmpE and the complemented strains Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2 in macrophages was significantly weakened; compared with the knockout strain BCG hyg:: mmpE, the survival ability of the complemented strains Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2 in macrophages was significantly enhanced. This result proves that the MmpE gene can promote the survival and colonization of pathogens in the host, thereby enhancing the virulence of pathogens, while the knockout of the MmpE gene can reduce the survival and colonization of pathogens in the host, thereby reducing virulence, and in this process, the nuclear localization signal sequence RRR 20-22 (R1) and RRK 460-462 (R2) played an important role.

[0010] In addition, mice were infected with wild-type strain BCG / pLJR965, MmpE gene knockout strain KoMmpE, MmpE gene complete complement strain Comp-MmpE, and R1 and R2 double-deficient MmpE gene partial complement strain Comp-MmpE-ΔR1R2, and the bacterial survival in lung tissue and the level of inflammatory factors in spleen were detected. The results of bacterial survival showed that compared with wild-type strain BCG / pLJR965, the survival ability of knockout strain KoMmpE and gene partial complement strain Comp-MmpE-ΔR1R2 in mice was significantly reduced; compared with knockout strain KoMmpE, the survival ability of complement strains Comp-MmpE and Comp-MmpE-ΔR1R2 in mouse lungs was significantly enhanced, and the complete complement strain Comp-MmpE was more significant; compared with the complete complement strain Comp-MmpE, the survival ability of the partial complement strain Comp-MmpE-ΔR1R2 in mouse lungs was significantly reduced. The results of inflammation level detection showed that in the innate immunity stage, compared with the wild-type strain BCG / pLJR965 and the complete complemented strain Comp-MmpE, the knockout strain KoMmpE and the partial complemented strain Comp-MmpE-ΔR1R2 could significantly induce the production of inflammatory factors (il1α, il1β) in the spleen of mice, indicating that the MmpE gene can significantly inhibit the nonspecific immune response produced by the body after antigen stimulation, and knocking out the MmpE gene or modifying the NLS can enhance the body's innate immunity to antigens.

[0011] In summary, the protein encoded by the MmpE gene is a nuclear regulatory protein that is localized in the host cell nucleus. After entering the cell nucleus, it inhibits the level of inflammation produced by the host and enhances the survival and colonization of pathogens in the host cells. Therefore, the MmpE protein is an important virulence factor of Mycobacterium bovis and depends on two NLSs to function.

[0012] On this basis, the attenuated strain of Mycobacterium bovis provided by the present invention is a recombinant Mycobacterium bovis with MmpE gene function deficiency or nuclear localization function deficiency obtained by modifying the MmpE gene or the two NLSs of the MmpE gene.

[0013] The preparation method of the attenuated strain of Mycobacterium bovis provided by the present invention is to modify the MmpE gene in the genome of Mycobacterium bovis by gene editing technology, so that the MmpE gene function is lost, or the two NLS of the MmpE gene are modified separately or simultaneously by gene editing technology, so that the nuclear localization function of the NLS is lost. For those skilled in the art, gene knockout or silencing belongs to mature technical means, and the gene editing technology applicable to the present invention includes but is not limited to homologous recombination technology (homologous recombination, HR), clustered regularly interspaced short palindromic repeats-associated nuclease (CRISPR-Cas) technology, TALEN gene editing technology and Cre-loxP recombinase system, etc.

[0014] The embodiments of the present invention also provide a specific implementation scheme for modifying the MmpE gene or its NLS sequence based on homologous recombination technology, and the steps are as follows: using homologous recombination technology, an exogenous target gene is introduced into the Mycobacterium bovis genome, and through homologous sequence exchange, the DNA fragment of the exogenous target gene replaces the MmpE gene at the original site to obtain a Mycobacterium bovis strain in which the MmpE gene is replaced; then, the MmpE gene DNA fragment in which the two NLS are modified separately or simultaneously is enzyme-cut and connected to the complementing plasmid; and then, it is electroporated into the Mycobacterium bovis strain in which the MmpE gene is replaced to obtain an MmpE gene complementing strain in which the two NLS are modified separately or simultaneously.

[0015] The attenuated strain of Mycobacterium bovis provided by the present invention can be used to prepare an inactivated Mycobacterium bovis vaccine because it can better induce the body to produce a nonspecific immune response and inhibit the survival and colonization of pathogens in the host. Compared with ordinary inactivated Mycobacterium bovis vaccines, the attenuated strain of Mycobacterium bovis provided by the present invention has the advantages of good immunogenicity and high production safety.

[0016] The present invention discovered for the first time that the MmpE gene and its two nuclear localization signal sequences can serve as important targets for inhibiting bovine Mycobacterium infection, and has important application value in the preparation of bovine Mycobacterium BCG vaccine. It also makes an important contribution to the in-depth study of the pathogenic mechanism and immune escape strategy of bovine Mycobacterium.

[0017] For more detailed technical solutions, please refer to the specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :Two-photon confocal fluorescence microscopy observation of the nuclear entry phenotype of MmpE and its mutant proteins (left) and quantitative analysis of the entry of MmpE and its mutant proteins into the host cell nucleus (right). Among them, mmpE-pEGFP: indicates that the pEGFP vector is connected to the mmpE gene; mmpE-ΔR1-pEGFP: indicates that the N-terminus of the pEGFP vector is connected to the truncated mutant RRR20-22 The amino acid sequence of mmpE gene; mmpE-ΔR2-pEGFP: indicates that the N-terminus of the pEGFP vector is connected to the truncated mutant RRK 460-462 The amino acid sequence of mmpE gene; mmpE-ΔR1R2-pEGFP: indicates that the N-terminal of pEGFP vector is connected to the truncated mutant RRR 20-22 and RRK 460 -462 The amino acid sequence of mmpE gene. In the figure, DAPI nuclear staining appears blue, EGFP and its fusion expression proteins MmpE-EGFP, MmpE-ΔR1-EGFP, MmpE-ΔR2-EGFP and MmpE-ΔR1R2-EGFP appear green, and the light blue area after merging indicates the presence of the target protein in the cell nucleus.

[0019] Figure 2 : qRT-PCR experiments were used to detect the expression levels of the target gene mmpE in HEK293T cells at different transfection time points (left figure), and Western blot experiments were used to detect the content of the target protein MmpE in the nucleus of HEK293T cells at different transfection time points (right figure).

[0020] Figure 3 : Plasmid map of knockout vector pMind-LacZ-UP600-hyg-DN600.

[0021] Figure 4 : PCR verification of knockout strain BCG hyg::mmpE, lane 1: DNA marker; lanes 2-4: wild-type strain BCG / wt; lanes 5-7: knockout strain BCG hyg::mmpE; lanes 2 and 5: DNA fragments amplified by hyg primers; lanes 3 and 6: DNA fragments amplified by mmpE primers; lanes 4 and 7: UP 600 -mmpE-DN 600 Primers amplify DNA fragments.

[0022] Figure 5 : Sequencing results of the DNA fragment of the knockout strain BCGhyg::mmpE amplified by the forward primer 600bp upstream and the reverse primer 600bp downstream of mmpE.

[0023] Figure 6 :qRT-PCR was used to detect the expression level of mmpE in the complemented strain.

[0024] Figure 7 : Determination of the survival quantity of wild-type, knockout and complemented strains in THP-1 macrophages.

[0025] Figure 8: Determination of the survival number of wild-type, knockout and complemented strains in mice.

[0026] Fig. 9 : Determination of the expression levels of inflammatory factors in the spleen of mice infected with wild-type, knockout and complemented strains at different time points. DETAILED DESCRIPTION

[0027] The technical scheme of the present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art on the basis of the following examples should also be deemed to fall within the scope of protection of the present invention. The experimental methods for which specific conditions are not indicated in the following examples are usually implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (NewYork: Cold Spring Harbor Laboratory, 2017), or implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not indicated in the examples are all commonly used materials well known in the art, which can be constructed by themselves according to literature reports or obtained through commercial channels.

[0028] Example 1: Screening of conserved nuclear regulatory proteins of mycobacteria

[0029] (1) Download the following mycobacterial genome information from the NCBI database: Mycobacterium tuberculosis H37Rv (Mtb H37Rv), Mycobacterium tuberculosis H37Ra (Mtb H37Ra), Mycobacterium bovis Bacillus Calmette-Guérin (M. bovis BCG), Mycobacterium marinum (M. marinum) and Mycobacterium avium (M. avium).

[0030] (2) Bioinformatics analysis screened out common genes in five mycobacterial species.

[0031] (3) The secretory protein analysis software SignalP-5.0 (predicting secretory proteins of the classical secretory pathway) and SecretomeP-2.0 (predicting secretory proteins of the non-classical secretory pathway) were used to analyze the common genes, and Score ≥ 0.5 and Score ≥ 0.9 were used as screening criteria to find possible common secretory proteins. The websites used are SignalP-5.0: https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ; SecretomeP-2.0: https: / / services.healthtech.dtu.dk / services / SecretomeP-2.0 / , and screened out 125 and 10 conserved secretory proteins, respectively.

[0032] (4) Based on the nuclear localization signal sequence (NLS) that may be contained in the amino acid sequence of nuclear regulatory proteins as a further screening annotation (NLS is characterized by a highly conserved short sequence composed of several basic amino acids, usually containing arginine and lysine), cNLS Mapper was used to screen out secretory proteins with NLS sequences. The screening criteria were: Score ≥ 2, cNLSMapper URL: NLS Mapper (keio.ac.jp) A total of 56 secretory proteins with nuclear localization signal sequences were screened, of which 26 belonged to the Sec / SPI secretion system, 18 belonged to the Sec / SPII secretion system, 7 belonged to the Tat / SPI secretion system and 8 belonged to unidentified secretion systems.

[0033] (5) The 56 possible nuclear regulatory protein genes screened out were cloned into the pEGFP-N1 vector (the target gene was cloned at the N-terminus of the pEGFP vector) and transformed into the DH5α competent cell to obtain a recombinant expression strain; then, an endotoxin-free plasmid extraction kit was used to obtain the fusion expression plasmid, which was transfected into HEK293T cells in a 96-well plate. At 24 hours, 36 hours, and 48 hours after transfection, the localization of the target protein in the host cells was observed using a high-content cell imaging system to screen out the target protein that could enter the cell nucleus.

[0034] (6) The predicted nuclear localization signal sequence (NLS) in the target protein was truncated by site-directed mutagenesis, and HEK293T cells were transfected again to observe the effect of NLS on the ability of the protein to enter the nucleus.

[0035] The results showed that the secretory protein MmpE (BCG_2600) of the Tat / SPI secretion system, whose homologous gene in Mycobacterium tuberculosis is Rv2577, has a strong ability to enter the nucleus and can be clearly localized in the host cell nucleus during transfection. The nuclear entry process is clearly dependent on the nuclear localization signal sequence RRR. 20-22 (R1) and RRK 460-462 (R2)( Figure 1 ). Literature reports show that MmpE is a virulence factor in mycobacteria with dual functions of phosphatase and phosphodiesterase, which can enhance the survival of Mycobacterium tuberculosis in mice by inhibiting the maturation of lysosomes (Forrellad MA et al., 2020). However, there is currently no report on the molecular mechanism by which MmpE promotes the survival of pathogens in the host by entering the host cell nucleus.

[0036] Example 2: Construction of MmpE recombinant plasmid and determination of nuclear entry ability

[0037] 1. Amplification of target gene fragment: First, query the mmpE gene information on GenBank and download the gene sequence. Use BioEdit software to query the restriction sites inside the mmpE gene. According to the available restriction sites (NheI and Hind3) on the fluorescent reporter vector EGFP, take 18-20bp from the front and back of the coding gene to design the gene forward primer (mmpE-F) and reverse primer (mmpE-R). Use the BCG genome as a template to amplify the mmpE gene sequence; PCR amplification system 50μL, reaction conditions and reaction system are shown in the table below (reagents ordered from Takara):

[0038] mmpE-F(5'-3'):ATATATATGCTAGCCGTGGGCGCCGATCTGAAG;

[0039] mmpE-R(5'-3'):ATATATATAAGCTTTCCGCCGCGGCTTGGTCA

[0040] The PCR amplification system is as follows (Table 1):

[0041] Table 1 PCR amplification system of mmpE gene

[0042]

[0043]

[0044] The PCR reaction conditions are as follows (Table 2):

[0045] Table 2 PCR reaction conditions for amplifying mmpE gene

[0046]

[0047] 2. Enzyme digestion of mmpE gene fragment and pEGFP vector (reagents ordered from Takara):

[0048] (1) DNA double enzyme digestion system

[0049] The DNA double restriction enzyme digestion system of mmpE gene fragment and pEGFP vector is shown in the following table (Table 3).

[0050] Table 3 DNA double restriction enzyme digestion system of mmpE gene fragment and pEGFP vector

[0051]

[0052] (2) 37°C for 3-4 hours;

[0053] (3) The DNA fragments after enzyme digestion are purified and recovered for enzyme ligation reaction.

[0054] 3. Enzyme ligation of target gene fragment and vector (reagents ordered from Takara):

[0055] (1) Enzyme-linked system (5 μL)

[0056] The enzyme ligation system of the target gene fragment and the vector is shown in the following table (Table 4).

[0057] Table 4 Enzyme ligation system of target gene fragment and vector

[0058]

[0059]

[0060] (2) Enzyme incubation at 16°C for 8 hours;

[0061] 4. Transformation: The ligation product was transformed into DH5α competent cells, cultured at 37°C for 16 hours, a single transformant was picked, cultured in 5 mL LB liquid medium containing 30 μg / mL Kan (kanamycin) for 8 hours, and the plasmid was extracted to obtain the recombinant plasmid pEGFP-mmpE;

[0062] 5. Cell transfection: First, HEK293T cells were plated in 12-well plates one day before transfection, with 2×10 cells per well. 5 and cultured in a cell culture incubator at 37°C, 5% CO2 for 12 hours. The cell supernatant was removed half an hour before transfection and 800 μL Opti-MEM culture medium was added. Then, during the infection process, a DNA-Hieff TransTM liposome nucleic acid transfection reagent complex was prepared, wherein each well of cells used 1 μg DNA diluted in 100 μL Opti-MEM and 4.5 μL Hieff TransTM liposome nucleic acid transfection reagent diluted in 100 μL Opti-MEM. The two were co-incubated at room temperature for 20 minutes and then added to the cell well plate. The ability of MmpE to enter the host cell nucleus was detected by qRT-PCR technology and Western blot technology at 4 hours, 12 hours, 24 hours, 36 hours, and 48 hours after transfection, respectively.

[0063] 6. qRT-PCR detection of the expression level of target gene in HEK293T cells at different transfection times

[0064] The detection primers of the internal reference gene hprt and the target gene mmpE are shown in Table 5. Western blot experiments were performed to detect the content of the target protein MmpE entering the nucleus of HEK293T cells at different transfection times. The nuclear protein and cytoplasmic protein extraction kits were purchased from Bio-Tech Biotechnology Co., Ltd. Histone H3 was used as the detection indicator of the nuclear internal reference protein.

[0065] Table 5 Primer sequences in qRT-PCR experiments

[0066]

[0067] The experimental results showed that: (1) The results of qRT-PCR experiments showed that as the transfection time increased, the expression level of the target gene mmpE in the host cells gradually increased and reached the maximum at 24 hours. The expression level of mmpE remained basically unchanged during the subsequent transfection time ( Figure 2 Left); (2) Western blot results showed that as the transfection time increased, the accumulation of the target protein MmpE in the cell nucleus gradually increased ( Figure 2 right).

[0068] Example 3: Construction of MmpE gene knockout strain

[0069] This experiment uses DNA homologous recombination technology to modify endogenous genes, allowing the exchange of exogenous DNA with the homologous sequences of the target gene on the genomic DNA of the recipient cell, and integrating the exogenous vector DNA into the predetermined site of the target gene, completing the precise modification and transformation of the genomic DNA target gene, causing mutations in the structure or composition of the target gene, leading to loss of gene function, and the modified and transformed gene can stably replicate with the replication of the genomic DNA.

[0070] The main steps of gene knockout are: (1) Construction of knockout vector plasmid, cloning the homologous sequence of the target gene into a vector with a marker gene (usually an antibiotic gene, such as hygromycin hyg); (2) Transformation of recipient bacteria with knockout vector plasmid; (3) Screening of recombinant strains with target gene knockout using selective culture medium; (4) Identification of strains with target gene deletion.

[0071] The specific implementation steps are as follows:

[0072] 1. Primer design: Query the mmpE gene information on GenBank and download the gene sequence. Use BioEdit software to query the restriction sites inside the mmpE gene. According to the available restriction sites on the pMind-LacZ vector (Chen L et al., 2022), determine that the PacⅠ, SpeⅠ, HindⅢ and NheⅠ restriction sites on the mmpE gene sequence are available. Select 600 bp sequences upstream and downstream of the target gene sequence, and use the BCG genome as a template to amplify the approximately 600 bp upstream fragment of the mmpE gene (the restriction sites are PacⅠ and SpeⅠ) (UP) and the 600 bp downstream fragment (the restriction sites are HindⅢ and NheⅠ) (DN). At the same time, construct the pMind vector treated with PacⅠ and SpeⅠ restriction endonucleases. The primers for amplifying the 600 bp sequences upstream and downstream of the mmpE gene are shown in Table 6 below.

[0073] Table 6 Primer list in PCR experiment

[0074]

[0075] 2. Clone the upstream fragment into the multiple cloning site of the pMind vector, then double-digest the pMind-LacZ-UP vector with HindⅢ and NheⅠ restriction endonucleases, connect the downstream fragments, and construct the complete knockout vector pMind-LacZ-UP-DN. This vector has the following characteristics: First, it is a suicide vector that cannot replicate autonomously in mycobacteria; second, the successfully constructed knockout strain has three screening markers: (1) Hyg resistance; (2) the reporter gene LacZ will make the strain turn blue in the X-gal environment; (3) when the recombinant vector and the genome undergo double exchange, the strain's Kan resistance will be lost, that is, Kan is a negative screening marker. The specific operations are as follows:

[0076] (1) Upstream fragment cloning: First, according to the designed mmpE-UP 600 Primer sequences, using BCG genome as template, to amplify mmpE-UP with PacI and SpeI restriction sites 600 Then, the DNA fragment and pMind-LacZ were double-digested with PacI and SpeI to obtain mmpE-UP 600 (PacI / SpeI) and pMind-LacZ(PacI / SpeI) DNA fragments (see Table 3 for restriction enzyme digestion system); then, pMind-LacZ(PacI / SpeI) and mmpE-UP 600 The (PacI / SpeI) fragments were ligated and transformed at a ratio of 1:3; finally, a single transformant was obtained, and the plasmid was extracted by amplification culture to obtain the recombinant plasmid pMind-LacZ-UP600 ;

[0077] (2) Downstream fragment connection: First, according to the designed mmpE-DN 600 Primer sequences, using BCG genome as template, to amplify mmpE-DN with HindⅢ and NheⅠ restriction sites 600 Then, the DNA fragment and the recombinant plasmid pMind-LacZ-UP obtained in the previous step were double-digested with HindⅢ and NheⅠ. 600 , respectively mmpE-DN 600 (HindⅢ / NheⅠ) and pMind-LacZ-UP 600 (HindⅢ / NheⅠ) DNA fragment (enzyme digestion system see Table 7 below); then, mmpE-DN 600 (HindⅢ / NheⅠ) and pMind-LacZ-UP 600 The (HindⅢ / NheⅠ) DNA fragments were ligated and transformed at a ratio of 1:3; finally, a single transformant was obtained, and the plasmid was extracted by amplification culture to obtain the recombinant plasmid pMind-LacZ-UP 600 -DN 600 , plasmid map see Figure 3 .

[0078] Table 7 Enzyme digestion reaction system

[0079]

[0080] 3. The constructed recombinant vector pMind-LacZ-UP600-hyg-DN600 was electroporated into BCG competent cells and screened on 7H10 plates containing 10% OADC, 50 μg / mL Hyg and 50 μg / mL X-gal.

[0081] 4. Pick a single white colony from the plate, culture it in 7H9 medium containing 10% OADC and 50μg / mL Hyg, and transfer part of the activated bacterial solution to 7H9 medium containing 30μg / mL Kan. If the bacteria lose Kan resistance, it may be a double-exchange knockout strain.

[0082] 5. We extracted the genome of the successfully constructed mmpE knockout strain, used the wild-type strain genome as a control, performed PCR verification using mmpE gene primers and hyg primers (see Table 8 for relevant primers), and amplified the target DNA fragment from the strain verified to be correct by PCR and sent it to a sequencing company (Qingke Biotechnology) for sequencing.

[0083] Table 8 Primer sequences in PCR experiments

[0084]

[0085] Experimental results: (1) PCR results showed that hyg (999 bp) was not amplified in the wild-type strain BCG / wt, but mmpE (1590 bp) was amplified; hyg (999 bp) was amplified in the knockout strain BCG hyg::mmpE, but mmpE (1590 bp) was not amplified; at the same time, the forward primer was designed with the upstream 600 bp sequence of the target gene mmpE, and the reverse primer was designed with the downstream 600 bp sequence for verification. It was found that a 2790 bp DNA fragment could be amplified in the wild-type strain BCG / wt, but only a 2199 bp DNA fragment could be amplified in the knockout strain BCG hyg::mmpE, indicating that the hyg gene successfully replaced the mmpE gene on the BCG genome, and the BCG hyg::mmpE knockout strain was successfully constructed ( Figure 4 ).

[0086] (2) The 2199 bp DNA fragment amplified from the knockout strain was further sent to a biological company for sequencing. The results showed that the hyg gene sequence could be successfully determined, indicating that the BCG hyg::mmpE knockout strain was successfully constructed ( Figure 5 ).

[0087] Example 4: Construction of complementation strains

[0088] To further explore the MmpE and nuclear localization signal sequence RRR 20-22 (R1),RRK 460-462 (R2) In the process of BCG virulence, we used the pLJR965 vector to construct the following series of recombinant strains:

[0089] (1) BCG / pLJR965: The empty vector pLJR965 plasmid was electroporated into the wild-type strain BCG to obtain the wild-type strain BCG without mutation of the mmpE gene, which was used as a control in the experiment;

[0090] (2) Knockout strain BCG hyg:: mmpE / pLJR965 (KoMmpE): The empty vector pLJR965 plasmid was electroporated into the knockout strain BCG hyg:: mmpE constructed above to obtain a BCG strain in which the MmpE gene was completely knocked out;

[0091] (3) Complementation strain BCG hyg::mmpE / pLJR965-MmpE (Comp-MmpE): A fusion expression plasmid pLJR965-mmpE was constructed based on the pLJR965 complementation vector, and it was electroporated into the knockout strain BCG hyg::mmpE to obtain a BCG strain with a complete complementation of the MmpE gene;

[0092] (4) Complementation strain BCG hyg:: mmpE / pLJR965-mmpE-ΔR1 (Comp-MmpE-ΔR1): RRR was obtained by gene point mutation technology 20-22 The mmpE DNA sequence with the amino acid sequence (ΔR1) deleted was ligated to the pLJR965 vector to obtain the fusion expression plasmid pLJR965-mmpE-ΔR1; then, it was electroporated into the knockout strain BCG hyg:: mmpE to obtain the RRK 460-462 (R2) BCG strain in which the MmpE gene of amino acids was partially complemented;

[0093] (5) Complementation strain BCG hyg:: mmpE / pLJR965-mmpE-ΔR2 (Comp-MmpE-ΔR2): RRK was obtained by gene point mutation technology 460-462 The mmpE DNA sequence with the amino acid sequence (ΔR2) deleted was ligated to the pLJR965 vector to obtain the fusion expression plasmid pLJR965-mmpE-ΔR2; then, it was electroporated into the knockout strain BCG hyg:: mmpE to obtain the RRR-containing 20-22 (R1) BCG strain in which the MmpE gene of amino acids was partially complemented;

[0094] (6) Complementation strain BCG hyg:: mmpE / pLJR965-MmpE-ΔR1R2 (Comp-MmpE-ΔR1R2): RRR was obtained by gene point mutation technology 20-22 (R1) and RRK 460-462 (R2) The mmpE DNA sequence with double amino acid sequence deletion was ligated to the pLJR965 vector to obtain the fusion expression plasmid pLJR965-mmpE-ΔR1R2; then, it was electroporated into the knockout strain BCG hyg:: mmpE to obtain the double deletion RRR 20-22 (R1) and RRK 460-462 (R2) BCG strain in which the MmpE gene of amino acids was partially complemented.

[0095] The specific construction method is as follows:

[0096] During the experiment, the vector was constructed using seamless cloning technology, and the point mutation DNA fragment was amplified using overlapping extension PCR technology. The principle of seamless cloning is to design 15-25 homologous bases (homologous arms) at the ends of the vector and primers. Through T5 exonuclease, DNA polymerase, and DNA ligase, the three enzymes function simultaneously to achieve the connection of a single fragment or multiple fragments to the vector. The principle of overlapping extension PCR is to use primers with complementary ends to form a short overlapping chain of the PCR product, and then in the subsequent amplification reaction, the amplified fragments from different sources are overlapped and spliced ​​together by extending the overlapping chain.

[0097] 1. Linearization of pLJR965 vector (For detailed information on pLJR965 vector, see https: / / www.addgene.org / 115163 / )

[0098] According to the sequence information of pLJR965 vector, two pairs of primers were designed and two fragments of pLJR965 vector (pLJR965L, pLJR965R) were amplified using pLJR965 vector as template, and then linearized pLJR965 vector was obtained by overlap extension PCR (primer information is shown in Table 9 below);

[0099] 2. Construction of mmpE and truncated mutant fragments (mmpE-ΔR1, mmpE-ΔR2, mmpE-ΔR1R2)

[0100] (1) Amplification of mmpE fragment: First, the DNA sequence of the mmpE gene and its upstream 400 bp bases were obtained from GenBank and KEGG databases (www.kegg.jp); then, based on the linearized pLJR965 vector information, mmpE gene primers (mmpE-F, mmpE-R) containing the homology arms of the pLJR965 vector were designed (primer sequences are shown in Table 9 below); then, PCR amplification was performed using the BCG genome as a template to obtain the mmpE DNA fragment (the 400 bp base sequence upstream of mmpE contains the gene's own promoter, and the target gene needs to carry its own promoter to initiate gene transcription when cloning using the pLJR965 vector);

[0101] (2) Construction of mmpE-ΔR1 truncated mutant fragments: First, determine the RRR 20-22(R1) The base sequence cgccgtagg on the mmpE gene; then, a sequence of 15-18bp on each of the left and right fragments (mmpE-ΔR1L, mmpE-ΔR1R) was selected with the sequence as the center to synthesize a sequence as the forward primer (mmpE-ΔR1R-F) for the synthesis of the truncated mutant fragment mmpE-ΔR1R, and after reverse complementation, it was used as the reverse primer (mmpE-ΔR1L-R) for the synthesis of the truncated mutant fragment mmpE-ΔR1L (primer information is shown in Table 9 below); then, using the BCG genome as a template, mmpE-F / mmpE-ΔR1L-R and mmpE-ΔR1R-F / mmpE-R were used as primers, respectively, and RRR was obtained after amplification. 20-22 (ΔR1) DNA fragments on both sides; finally, the fragments were subjected to overlap extension PCR to obtain mmpE-ΔR1 truncated mutant fragments (overlap extension PCR system see Tables 10 and 12 below, reaction conditions see Tables 11 and 13 below);

[0102] (3) Construction of mmpE-ΔR2 truncated mutant fragments: First, determine the RRK 460-462 (R2) The base sequence cggcgtaag on the mmpE gene; then, taking the sequence as the center, the left and right fragments (mmpE-ΔR2L, mmpE-ΔR2R) of 15-18 bp each were selected to synthesize a sequence as the forward primer (mmpE-ΔR2R-F) for the synthesis of the truncated mutant fragment mmpE-ΔR2R, and after reverse complementation, it was used as the reverse primer (mmpE-ΔR2L-R) for the synthesis of the truncated mutant fragment mmpE-ΔR2L (primer information is shown in Table 9 below); then, using the BCG genome as a template, mmpE-F / mmpE-ΔR2L-R and mmpE-ΔR2R-F / mmpE-R were used as primers, and RRK was obtained after amplification. 460-462 (ΔR2) DNA fragments on both sides; finally, the fragments were subjected to overlap extension PCR to obtain the mmpE-ΔR2 truncated mutant fragment;

[0103] (4) Construction of mmpE-ΔR1R2 truncated mutant fragment: First, based on the construction of mmpE-ΔR1 and mmpE-ΔR2 truncated mutant fragments, the BCG genome was used as a template and mmpE-ΔR1R-F / mmpE-ΔR2L-R were used as primers to amplify the DNA fragment between the R1 and R2 mutant sequences (mmpE-ΔR1R2M); then, mmpE-ΔR1R2M was subjected to overlapping extension PCR with the fragments mmpE-ΔR1L and mmpE-ΔR2R to obtain the mmpE-ΔR1R2 truncated mutant fragment.

[0104] 3. Construction of recombinant plasmids (pLJR965-mmpE, pLJR965-mmpE-ΔR1, pLJR965-mmpE-ΔR2, pLJR965-mmpE-ΔR1R2)

[0105] First, the obtained mmpE and truncated mutant fragments were reacted with the linearized pLJR965 vector using the Uniclone OneStep Seamless Cloning Kit (Jinsha Biotechnology SC612) (see Table 14 below for the seamless cloning reaction system), placed at 50°C for 30 minutes, and then placed on ice for 2 minutes; then, the reaction product was transformed into DH5α competent cells and spread on LB solid culture medium containing 30 μg / mL Kan, and cultured at 37°C for 16 hours; finally, a single transformant was picked, expanded and cultured on 5 mL of LB liquid culture medium containing 30 μg / mL Kan, and the recombinant plasmid was extracted.

[0106] 4. Electroporation

[0107] The recombinant plasmid was electroporated into BCG hyg:: mmpE competent cells and plated on 7H10 medium containing 10% OADC and 30 μg / mL Kan. The cells were cultured at 37°C for 14 days. A single colony was then picked and cultured in 5 mL of 7H9 liquid medium containing 10% OADC and 30 μg / mL Kan. The OD 600 ≈1.0 is used for experiments.

[0108] 5. Identification

[0109] The recombinant strain was inoculated into 10 mL of 7H9 liquid medium containing 30 μg / mL Kan and cultured until OD 600 qRT-PCR experiment was performed when ≈1.0 to detect the expression level of mmpE gene in each strain. First, the bacteria were collected in a 50mL sterile centrifuge tube, centrifuged at 6000rpm for 5 minutes, and the supernatant was removed; then, the bacteria were washed twice with PBS, centrifuged at 6000rpm for 5 minutes, and the supernatant was removed; finally, RNA of each sample was extracted with an RNA extraction kit (Aidlab Biological Company, RN2802) and RNA reverse transcription (Novozyme, R423-01) was performed to detect the expression level of mmpE gene in each strain (identification primers are shown in Table 15, where sigA is a bacterial internal reference gene).

[0110] Table 9 Primer list in PCR experiment

[0111]

[0112]

[0113] Overlap extension PCR steps (taking mmpE-ΔR1 as an example, the parameters of the other fragment operation steps are the same) Step 1:

[0114] Table 10 Overlap extension PCR amplification system 1

[0115]

[0116] Table 11 Overlap extension PCR reaction conditions 1

[0117]

[0118] After the reaction is completed, place on ice and add primers and enzymes for subsequent reactions.

[0119] Step 2:

[0120] Table 12 Overlap extension PCR amplification system 2

[0121]

[0122] Table 13 Overlap extension PCR reaction conditions 2

[0123]

[0124] After the reaction, mmpE and truncated mutant fragments (mmpE-ΔR1, mmpE-ΔR2, mmpE-ΔR1R2) were obtained.

[0125] Table 14 Seamless cloning reaction system

[0126]

[0127] Table 15 Primer sequences in qRT-PCR experiments

[0128]

[0129] The results of qRT-PCR experiments showed that the mmpE gene could not be detected in the knockout strain; in the complemented strain, the complementation efficiencies of MmpE, MmpE-ΔR1, MmpE-ΔR2, and MmpE-ΔR1R2 were 89.3%, 85.7%, 89.3%, and 79.1%, respectively, indicating that the mmpE gene was successfully complemented ( Figure 6 ). Error values ​​represent the standard deviation of three biological replicates, and P values ​​were obtained using unpaired two-tailed Student's t-test in GraphPadPrism 7. Asterisks (*) represent significant differences between two groups of data: *, p < 0.1; **, p < 0.01, ***, p < 0.001.

[0130] Example 5. Detection of the survival ability of mutants in macrophage THP-1

[0131] The above recombinant strains were inoculated into 50 mL of liquid culture medium containing 30 μg / mL Kan 7H9 and cultured until OD 600 When the concentration of THP-1 cells was ≈1.0, the cell infection experiment was performed. First, 3 days before the infection experiment, the cultured THP-1 cells were evenly plated in a 24-well plate, with the number of cells in each well being 0.5×10 6 cfu / mL, and 200 ng / mL of PMA was added for 48 hours; then, 500 μL of LPS containing 200 ng / mL was added for 24 hours. Before the infection experiment, the culture medium was removed and 500 μL of 1640+10% FBS culture medium was added; then, the cultured recombinant strain was infected with THP-1 cells at an infection multiplicity of 10:1, and cultured in a cell culture incubator at 37°C and 5% CO2 for 4 hours, and then the supernatant was removed, and 500 μL of 1640+10% FBS culture medium containing double antibodies (penicillin + streptomycin) was added and cultured for 4, 24, 48, and 72 hours respectively; finally, the adherent cells were digested with 0.05% SDS and the infected cell samples were collected.

[0132] The collected cell samples were diluted with PBS (5 -1 , 5 -2 , 5 -3 ), and 100 μL was applied to 7H10 medium containing 10% OADC and 30 μg / mL Kan, and cultured at 37°C for 14 days, and the number of surviving recombinant strains in macrophages at each infection time point was counted (the error value represents the standard deviation of 3 biological replicates, and the P value is calculated using the unpaired two-tailed Student's t-test in GraphPadPrism 7. Asterisks (*) represent significant differences between the two groups of data: *, p < 0.1; **, p < 0.01, ***, p < 0.001).

[0133] Experimental results ( Figure 7 ):

[0134] (1) Compared with the wild-type strain, the survival ability of the knockout strain KoMmpE and the partially complemented strains Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2 in host cells was significantly weakened. This indicates that MmpE can enhance the survival ability of pathogens in the host, and this process depends on the assistance of nuclear localization signal sequences (R1, R2);

[0135] (2) Compared with the knockout strain KoMmpE, 48 hours after infection, the survival abilities of the complement strains Comp-MmpE, Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2 in host cells were significantly enhanced, and Comp-MmpE was the most significant.

[0136] (3) Compared with the complemented strain Comp-MmpE, the survival ability of the complemented strains Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2 in host cells was significantly weakened 48 hours after infection;

[0137] (4) There was no significant difference in virulence among the recombinant strains Comp-MmpE-ΔR1, Comp-MmpE-ΔR2, and Comp-MmpE-ΔR1R2.

[0138] In summary, in BCG strains, MmpE can significantly enhance the virulence of pathogens and promote the survival and colonization of pathogens in the host, while knocking out the MmpE gene can reduce virulence and thus reduce the survival and colonization of pathogens in the host. In this process, the nuclear localization signal sequence RRR 20-22 (R1) and RRK 460-462 (R2) played an important role.

[0139] Example 6. Detection of the survival ability of mutant strains in C57BL / 6 mice and detection of spleen inflammation level

[0140] The constructed recombinant strains (BCG / pLJR965, KoMmpE, Comp-MmpE, Comp-MmpE-ΔR1R2) were inoculated into 5 mL of 7H9 liquid medium containing 30 μg / mL Kan and cultured until OD 600 ≈1.0, according to 1×10 7 cfu / 40μL were used to infect C57BL / 6 female mice (bacterial infection method: nasal drops; mouse weight: SPF grade, 6-8 weeks, 16-18g), with 6 biological replicates in each group, and the infection time was 2, 14, 21, 28, and 56 days; at different time points after infection, the lung and spleen tissues of the mice were collected, the lung tissues were used to detect the number of bacterial survival, and the spleen samples were used to detect the expression levels of inflammatory factors.

[0141] Detection of the number of surviving bacteria in the lungs: First, the infected mouse lung samples were ground; then, 1 mL of PBS was taken to perform gradient dilutions (5 -1 , 5 -2 , 5 -3), and 100 μL was applied to 7H10 medium containing 10% OADC and 30 μg / mL Kan, and cultured at 37°C for 14 days; finally, the number of surviving strains in the lungs of each mouse at each infection time point was counted.

[0142] Detection of spleen inflammation level: spleen samples of infected mice were taken, tissue RNA was extracted, and qRT-PCR was performed to detect the expression of spleen inflammatory factors (il1α, il1β) after reverse transcription into cDNA. Among them, the RNA extraction steps and reagents used in tissue samples were the same as those of Aidlab Biological Company (RN2802), and the RNA reverse transcription operation steps were the same as those of Novozyme reverse transcription kit (R423-01).

[0143] The results of bacterial survival showed that compared with the wild-type strain BCG / pLJR965, the survival ability of the knockout strain KoMmpE and the recombinant strain Comp-MmpE-ΔR1R2 in mice was significantly reduced; compared with the knockout strain KoMmpE, the survival ability of the recombinant strains Comp-MmpE and Comp-MmpE-ΔR1R2 in the mouse lungs was significantly enhanced, and Comp-MmpE was more significant; compared with the complemented strain Comp-MmpE, the survival ability of the partially complemented strain Comp-MmpE-ΔR1R2 in the mouse lungs was significantly decreased ( Figure 8 ).

[0144] The results of the inflammatory level test showed that in the first 28 days of bacterial infection in mice, compared with the wild-type strain BCG / pLJR965 and the complemented strain Comp-MmpE, the knockout strain KoMmpE and the partially complemented strain Comp-MmpE-ΔR1R2 could significantly induce the production of inflammatory factors (IL-1α, IL-1β) in the spleen of mice ( Fig. 9 ). This indicates that MmpE can significantly inhibit inflammatory factors during BCG infection of mice, and that nuclear localization signal sequences R1 and R2 play an important role in this process.

Claims

1. Application of the MmpE gene in regulating the virulence of Mycobacterium bovis, the nucleotide sequence of the MmpE gene is shown in SEQ ID NO.1, the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, the protein encoded by the MmpE gene is a nuclear regulatory protein, which is localized in the host cell nucleus. After entering the nucleus, it inhibits the host's inflammation level and enhances the survival and colonization of Mycobacterium bovis in the host cell. The MmpE gene depends on two NLSs to exert its nuclear localization function, and the two NLSs are respectively located at positions 20-22 and 460-462 of the amino acid sequence shown in SEQ ID NO.

2.

2. A weak strain of Mycobacterium bovis, wherein the MmpE gene of the weak strain is modified to result in loss of function, or the two NLSs of the MmpE gene are modified separately or simultaneously to result in loss of nuclear localization function, the nucleotide sequence of the MmpE gene is shown in SEQ ID NO.1, the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and the two NLSs are respectively located at positions 20-22 and 460-462 of the amino acid sequence shown in SEQ ID NO.

2.

3. A method for reducing the virulence of Mycobacterium bovis, characterized in that: The MmpE gene in the genome of Mycobacterium bovis is modified using gene editing technology to cause the MmpE gene to lose its function, or the two NLSs of the MmpE gene are modified separately or simultaneously using gene editing technology to cause the nuclear localization function of the NLS to lose its function. The nucleotide sequence of the MmpE gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.

2. The two NLSs are respectively located at positions 20-22 and positions 460-462 of the amino acid sequence shown in SEQ ID NO.

2.

4. The method for reducing the toxicity of Mycobacterium bovis according to claim 3, characterized in that: Using homologous recombination technology, an exogenous target gene is introduced into the genome of Mycobacterium bovis. Through homologous sequence exchange, the DNA fragment of the exogenous target gene replaces the MmpE gene at the original site to obtain a Mycobacterium bovis weak virulence strain in which the MmpE gene is replaced. Alternatively, the MmpE gene DNA fragment in which the two NLSs are modified separately or simultaneously is digested and connected with a complementing plasmid, and then electroporated into the Mycobacterium bovis weak virulence strain in which the MmpE gene is replaced, to obtain a MmpE gene complementing weak virulence strain in which the two NLSs are modified separately or simultaneously.

5. The method for reducing the virulence of Mycobacterium bovis according to claim 4, characterized in that: The exogenous target gene is a hyg resistance gene.

6. The method for reducing the virulence of Mycobacterium bovis according to claim 4, characterized in that: The complementing plasmid is the pLJR965 plasmid.

7. Use of the attenuated strain according to claim 2 in the preparation of a Mycobacterium bovis vaccine or medicine.

8. A Mycobacterium bovis vaccine comprising the attenuated strain according to claim 2.

Images