A cytochrome P450BM3 mutant and its application in the synthesis of 2-hydroxy-1,8-cineole

Abstract

The present invention discloses a cytochrome P450BM3 mutant and application thereof in highly selectively oxidizing 1,8-cineole to generate 2-hydroxy-1,8-cineole. In the mutant, at least one amino acid in four positions, namely, positions 172, 88, 308, and 438 of the amino acid sequence shown in SEQ ID No.1, is replaced; the histidine His at position 172 is mutated to leucine Leu, the phenylalanine Phe at position 88 is mutated to alanine Ala, the glutamine Gln at position 308 is mutated to histidine His, and the leucine Leu at position 438 is mutated to valine Val. By mutating the active site of the cytochrome P450BM3, a P450BM3 mutant capable of highly selectively oxidizing 1,8-cineole to generate 2-hydroxy-1,8-cineole is finally obtained.

Description

Technical Field

[0001] The present invention relates to the technical fields of enzyme engineering and genetic engineering, and in particular to a cytochrome P450BM3 mutant and application thereof in synthesizing 2-hydroxy-1,8-cineole. Background Art

[0002] 1,8-cineole is a bicyclic monoterpene compound with a distinctive camphoraceous and herbal aroma, making it commonly used as a flavoring and fragrance. 1,8-cineole has also been shown to regulate Nrf2 signaling pathways and other pharmacological activities, and can be used to treat a variety of conditions, including scabies, digestive system, respiratory system, and neurodegenerative diseases. It is widely used in pharmaceuticals, food, and cosmetics. 2-Hydroxy-1,8-cineole, a major metabolite of 1,8-cineole, could be developed into a value-added chemical with potential applications to address environmental pollution and waste of natural resources during 1,8-cineole production.

[0003] One feasible strategy is to convert consumed biomass energy or waste into industrial-related raw materials or value-added compounds through microbial fermentation, thereby achieving the production purpose of reduction, regeneration and reuse. For example, by inoculating oyster mushrooms and other fungi with eucalyptus leaves used for essential oil extraction as a matrix, 1,8-cineole can be converted into two new aromatic compounds, 2-hydroxy-1,8-cineole and 2-carbonyl-1,8-cineole. Although this waste utilization strategy has shown certain application prospects, the product's heterogeneity and the difficulty of separation and production cost caused by low yield limit the application scenarios of microbial fermentation. How to selectively produce 2-hydroxy-1,8-cineole and improve production efficiency is of great practical significance. Summary of the Invention

[0004] Purpose of the invention: The first purpose of the present invention is to solve the problems of poor reaction regioselectivity, non-single product and low catalytic efficiency in the process of cytochrome P450BM3 oxidation of 1,8-cineole, by carrying out directed evolution of amino acids in the substrate binding pocket of cytochrome P450BM3, thereby achieving a cytochrome P450BM3 mutant that can highly selectively oxidize 1,8-cineole to obtain 2-hydroxy-1,8-cineole; the second purpose of the present invention is to provide an application of the cytochrome P450BM3 mutant in the highly selective oxidation of 1,8-cineole to synthesize 2-hydroxy-1,8-cineole.

[0005] Technical solution: The cytochrome P450BM3 mutant of the present invention is a mutant in which at least one amino acid is replaced at positions 172, 88, 308, and 438 of the amino acid sequence shown in SEQ ID No. 1; the histidine His at position 172 is mutated to leucine Leu, the phenylalanine Phe at position 88 is mutated to alanine Ala, the glutamine Gln at position 308 is mutated to histidine His, and the leucine Leu at position 438 is mutated to valine Val.

[0006] The wild-type cytochrome P450BM3 is the enzyme corresponding to PDB ID: 1FAG, originating from Bacillus megaterium, with an amino acid sequence of SEQ ID NO.1 and a gene sequence of SEQ ID NO.2.

[0007] Preferably, the mutants include H172L, H172L / F88A, H172L / F88A / Q308H or H172L / F88A / Q308H / L438V.

[0008] The mutant H172L, that is, the histidine His at position 172 is mutated to leucine Leu.

[0009] The mutant H172L / F88A is a mutant in which the histidine His at position 172 is mutated to the leucine Leu, and the phenylalanine Phe at position 88 is mutated to the alanine Ala.

[0010] In the mutant H172L / F88A / Q308H, the histidine at position 172 (His) is mutated to leucine (Leu), the phenylalanine at position 88 (Phe) is mutated to alanine (Ala), and the glutamine at position 308 (Gln) is mutated to histidine (His).

[0011] In the mutant H172L / F88A / Q308H / L438V, the histidine at position 172 His is mutated to leucine Leu, the phenylalanine Phe at position 88 is mutated to alanine Ala, the glutamine Gln at position 308 is mutated to histidine His, and the leucine Leu at position 438 is mutated to valine Val.

[0012] The coding gene of the cytochrome P450BM3 mutant of the present invention is obtained by the following method: using the recombinant plasmid pET22b-P450BM3 derived from the wild-type cytochrome P450BM3 gene of Bacillus megaterium as a template, PCR amplification is performed using site-directed mutagenesis primers, and the target mutant gene is screened.

[0013] The gene described in the present invention is a gene encoding the cytochrome P450BM3 mutant protein described in the present invention.

[0014] The recombinant plasmid of the present invention is a recombinant plasmid containing the gene of the present invention.

[0015] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.

[0016] The recombinant bacteria of the present invention carry the gene of the mutant or the recombinant plasmid.

[0017] Preferably, the host is Escherichia coli.

[0018] The method for constructing the recombinant bacteria comprises the following steps:

[0019] (1) Construction of recombinant plasmid pET22b-P450BM3: ligating the cytochrome P450BM3 gene P450BM3 with the enzyme-digested plasmid pET22b to obtain the recombinant expression vector pET22b-cytochrome P450BM3;

[0020] (2) Construction of recombinant E. coli BL21 (DE3) / pET22b-P450BM3: The constructed recombinant expression vector pET22b-P450BM3 was heat-transformed into competent E. coli BL21 (DE3), and the recombinant E. coli BL21 (DE3) / pET22b-P450BM3 was obtained by culture and screening.

[0021] The invention relates to the use of the cytochrome P450BM3 mutant, the recombinant plasmid or the recombinant bacteria in highly selectively oxidizing 1,8-cineole to generate 2-hydroxy-1,8-cineole.

[0022] The application includes the following steps: using a cytochrome P450BM3 mutant as a catalyst and 1,8-cineole as a substrate, highly selectively catalytically oxidizing the 2nd position to produce 2-hydroxy-1,8-cineole. The catalytic process is as follows:

[0023]

[0024] Preferably, the reaction temperature of the catalytic oxidation is 25-35° C., and the pH is 6-8.

[0025] Invention Mechanism: After extensive and in-depth research, the present invention provides a cytochrome P450BM3, its preparation method, and application. Specifically, by amplifying the cytochrome P450BM3 gene from Bacillus megaterium and using rational design to perform directed evolution, a cytochrome P450BM3 mutant with enhanced regioselectivity for 1,8-cineole oxidation was obtained, thereby achieving efficient synthesis of 2-hydroxy-1,8-cineole.

[0026] In the present invention, the sequence and structural information of publicly reported cytochrome P450BM3 were used to screen for potential enzyme genes by performing non-redundant searches in databases such as NCBI, based on principles such as protein structure similarity, conserved site analysis, and host-source diversity. These genes were functionally expressed in an E. coli expression system and subsequently purified to obtain a pure enzyme. The preferred cytochrome P450BM3 is derived from Bacillus megaterium and has a certain catalytic activity, capable of catalyzing the oxidation reaction of 1,8-cineole.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) By mutating the active site of cytochrome P450BM3, the mutant finally obtained has improved selectivity and catalytic efficiency in the biocatalytic reaction of oxidizing 1,8-cineole to 2-hydroxy-1,8-cineole; (2) the catalytic efficiency of the mutant H172L / F88A / Q308H / L438V is 96%, and the selectivity ratio of 2-hydroxy-1,8-cineole is as high as 9.3:1. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Graph showing the yield and selectivity of the highly selective oxidation of 1,8-cineole by the cytochrome P450BM3 mutants of Examples 1 to 4;

[0029] Figure 2 This is the NMR spectrum of the product 2-hydroxy-1,8-cineole produced by the highly selective oxidation of 1,8-cineole by the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V);

[0030] Figure 3 This is the mass spectrum of the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V);

[0031] Figure 4This is a kinetic diagram of the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by a cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V);

[0032] Figure 5 This is the Michaelis-Menten kinetic parameter diagram for the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V). DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0034] Example 1

[0035] 1. Construction of cytochrome P450BM3 mutant plasmid

[0036] (1) Obtaining pET22b-P450BM3

[0037] The wild-type gene for cytochrome P450BM3 from Bacillus megaterium was synthesized by Jinweizhi (Suzhou) and constructed on the pET22b vector (the pET22b vector was provided by Jinweizhi). The vector was then transformed into the E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The recombinant E. coli DH5α / pET22b-P450BM3 was inoculated into a 5 mL test tube of culture medium and cultured at 37°C with shaking at 220 rpm for 12 hours. After the incubation period, the cells were centrifuged at 12,000 rpm for 1 minute and harvested. Plasmids were extracted from the E. coli DH5α / pET22b-P450BM3 using a high-purity plasmid miniprep kit and used as templates for iterative mutagenesis to construct mutants of the plasmid pET22b-P450BM3.

[0038] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-P450BM3 mutant

[0039] The target mutant gene was obtained by whole-plasmid PCR. The required primers were specifically designed using H172L as an example. Other mutants were designed using this principle and single-point iterative mutagenesis was performed.

[0040] H172L upstream primer: GATCAGCCTCTTCCATTTATTACAAG

[0041] H172L downstream primer: CTTGTAATAAATGGAAGAGGCTGATC

[0042] The PCR system is shown in Table 1.

[0043] Table 1 PCR reaction system

[0044]

[0045] PCR reaction conditions are shown in Table 2.

[0046] Table 2 PCR reaction conditions

[0047]

[0048] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0049] The purified gene fragments were digested with DpnI to remove the template and then recombined using a recombinase. The recombinant product was transformed into E. coli DH5α competent cells and plated on the surface of LB solid medium containing 100 μg / mL ampicillin. The cells were incubated at 37°C for 12 hours, and single colonies were picked and transferred to LB liquid culture. Successful transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a portion of the cells was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until further use. A portion of the cells was used to extract the plasmid using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C.

[0050] The recombinant expression plasmid pET22b that was successfully sequenced was transformed into E. coli BL21 (DE3) (E. coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-P450BM3.

[0051] 2. Cultivation of cytochrome P450BM3 mutants and preparation of crude enzyme solution

[0052] The recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-P450BM3 was successfully constructed and spread onto a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured overnight at 37°C at 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance and cultured at an OD of 4. 600 When the elongation reaches about 0.6, IPTG and 0.3 mM δ-aminolevulinic acid (δ-ALA) are added at a final concentration of 0.04 mM and induced at 18°C ​​for about 36 h.

[0053] After centrifugation, the cells were resuspended in buffer and disrupted by sonication in an ice bath (2-second on-time, 5-second interval, 30-minute on-time). The supernatant was collected and filtered through a 0.22-μm aqueous filter to obtain the crude enzyme solution. 200 μL of the supernatant was collected for P450 concentration determination and diluted to a P450 concentration of 5 μM with 200 mM potassium phosphate buffer (pH 7.5).

[0054] Example 2

[0055] The H172L / F88A mutant was prepared based on Example 1. The plasmid obtained in Example 1 was used as the DNA template in step (2). The primers were changed while the other conditions remained unchanged. The primers were as follows:

[0056] H172L / F88A upstream primer: GACGGGTTAGCGACAAGCTGGACGC

[0057] H172L / F88A downstream primer: GCGTCCAGCTTGTCGCTAACCCGTC.

[0058] Example 3

[0059] The H172L / F88A / Q308H mutant was prepared based on Example 1. The plasmid obtained in Example 2 was used as the DNA template in step (2). The primers were changed while the other conditions remained unchanged. The primers were as follows:

[0060] H172L / F88A / Q308H upstream primer

[0061] CCAAGCTACAAACATGTCAAACAGCTTAAATATG

[0062] H172L / F88A / Q308H downstream primer

[0063] CATATTTAAGCTGTTTGACATGTTTTGTAGCTTGG.

[0064] Example 4

[0065] The H172L / F88A / Q308H / L438V mutant was prepared based on Example 1. The plasmid obtained in Example 3 was used as the DNA template in step (2). The primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0066] H172L / F88A / Q308H / L438V upstream primer:

[0067] GGATATTAAAGAAACTGTGACGTTAAAACCTG

[0068] H172L / F88A / Q308H / L438V downstream primers:

[0069] CAGGTTTTAACGTCACAGTTTCTTTAATATCC.

[0070] Performance Testing

[0071] 1. Cytochrome P450BM3 and its mutants highly selectively oxidize 1,8-cineole

[0072] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Examples 1 to 4 and the crude enzyme solution obtained was used as a catalyst.

[0073] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer (pH = 7.5). The reaction temperature was controlled at 30°C in a water bath with magnetic stirring and the reaction was carried out for 60 min.

[0074] An equal volume of ethyl acetate was added to the reaction mixture, and the mixture was shaken at 400 rpm for 10 minutes to thoroughly mix. The mixture was then centrifuged at 10,000 rpm for 10 minutes. The upper ethyl acetate phase was collected and analyzed by GC. The GC analysis was performed using an Agilent CycloSil-B column (30 m × 250 μm × 0.25 μm). The temperature was increased from 60°C to 240°C over 3.6 minutes, and then maintained at 240°C for 4 minutes.

[0075] The test results are shown in Table 3 and Figure 1 .

[0076] Table 3 Highly selective oxidation of 1,8-cineole by cytochrome P450BM3 and its mutants

[0077]

[0078] Depend on Figure 1 The catalytic conversion rates of all mutants were higher than those of wild-type cytochrome P450BM3. In particular, the mutant H172L / F88A / Q308H / L438V had a catalytic efficiency of 96% and an oxidation product selectivity of 9.3:1.

[0079] 2. Characterization and verification of the physicochemical properties of the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V) that highly selectively oxidizes 1,8-cineole to 2-hydroxy-1,8-cineole

[0080] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0081] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction was buffered with 200 mM potassium phosphate buffer (pH 7.5) and scaled up to 100 mL. The reaction temperature was controlled at 30°C in a water bath and magnetically stirred for 60 min before the reaction was terminated.

[0082] After the reaction, 100 mL of ethyl acetate was added for extraction and the extraction was repeated three times. The organic phase was washed once with a saturated sodium chloride solution, and dried over anhydrous sodium sulfate. The organic phase was concentrated by rotary evaporation and purified by column chromatography to obtain a selective oxidation product.

[0083] Characterization: The NMR instrument model is 600 MHz Bruker AVANCE III-600; the LCMS model is GCMS-QP2020 NX, and the chromatographic column is Rtx-5MS (30 m × 250 μm × 0.25 μm).

[0084] NMR results are shown in Figure 2 , which is consistent with the NMR results of 2-hydroxy-1,8-cineole reported in the relevant literature (ChemPlusChem 2014, 79, 634–655); GCMS results are shown in Figure 3 This is consistent with the mass spectrometry results of 2-hydroxy-1,8-cineole reported in the literature (Folia Microbiol 2016, 61, 149–157). This confirms that the product of the highly selective oxidation of 1,8-cineole by the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V) is 2-hydroxy-1,8-cineole.

[0085] 3. Kinetics of highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by a cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V)

[0086] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0087] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer (pH = 7.5). The reaction temperature was controlled at 30°C in a water bath with magnetic stirring, and the reaction was terminated at 0.5 min, 1 min, 2 min, 5 min, 10 min, 15 min, 20 min, 30 min, and 60 min.

[0088] An equal volume of ethyl acetate was added to the reaction solution, shaken at 400 rpm for 10 minutes, and shaken thoroughly. Centrifuged at 10,000 rpm for 10 minutes. The upper ethyl acetate phase was taken for GC detection. The GC analysis method was: chromatographic column Agilent CycloSil-B (30m×250μm×0.25μm); the operating program was to increase the temperature from 60°C to 240°C within 3.6 minutes and maintain at 240°C for 4 minutes. The kinetic curve of the highly selective synthesis of 2-hydroxy-1,8-cineole by the obtained cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V) is shown in Figure 4 .

[0089] Depend on Figure 4 It can be seen that as the reaction proceeds, the concentration of 2-hydroxy-1,8-cineole product gradually increases, and the yield reaches 96% at 60 min.

[0090] 4. Determination of Michaelis-Menten kinetic parameters for the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by a cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V)

[0091] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0092] The reaction system is: 5 μM protein concentration of crude enzyme solution, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer (pH 7.5), and the concentrations of the substrate 1,8-cineole were 1 mM, 1.5 mM, 2 mM, and 5 mM, respectively. The reaction temperature was controlled at 30°C in a water bath with magnetic stirring, and the reaction was terminated after 1 min.

[0093] Add an equal volume of ethyl acetate to the reaction solution, shake at 400 rpm for 10 minutes, and shake thoroughly. Centrifuge at 10000 rpm for 10 minutes. Take the upper ethyl acetate phase and use GC detection. The GC analysis method is: chromatographic column Agilent CycloSil-B (30m×250μm×0.25μm); the operating program is to increase the temperature from 60℃ to 240℃ within 3.6 minutes and maintain at 240℃ for 4 minutes. Determine the enzymatic reaction rate, and draw a double reciprocal curve based on the reciprocal of the reaction rate and substrate concentration to calculate the Michaelis-Menten kinetic parameters. The test results are shown in Figure 5 .

[0094] Depend on Figure 5 The Michaelis-Menten kinetic parameters for the highly selective synthesis of 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H172L / F88A / Q308H / L438V) were K m =1.1mM, K cat =13.4s -1 .

Claims

1. A cytochrome P450BM3 mutant, characterized in that The mutant is mutated based on the amino acid sequence shown in SEQ ID No. 1; the mutant is selected from H172L, H172L / F88A, H172L / F88A / Q308H or H172L / F88A / Q308H / L438V; the mutant H172L is that the histidine His at position 172 is mutated to leucine Leu; the mutant H172L / F88A is that the histidine His at position 172 is mutated to leucine Leu, and the phenylalanine Phe at position 88 is mutated to alanine Ala; the mutant H172L / F 88A / Q308H, the histidine at position 172 His mutated to leucine Leu, the phenylalanine at position 88 Phe mutated to alanine Ala, and the glutamine Gln at position 308 mutated to histidine His; the mutant H172L / F88A / Q308H / L438V, the histidine at position 172 His mutated to leucine Leu, the phenylalanine at position 88 Phe mutated to alanine Ala, the glutamine Gln at position 308 mutated to histidine His, and the leucine Leu at position 438 mutated to valine Val.

2. A gene encoding the cytochrome P450BM3 mutant protein according to claim 1.

3. A recombinant plasmid containing the gene according to claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The expression vector of the recombinant plasmid is a PET series expression vector.

5. A recombinant bacterium carrying the gene of the mutant according to claim 2 or the recombinant plasmid according to claim 3.

6. The recombinant bacterium according to claim 5, characterized in that The host is Escherichia coli.

7. Use of the cytochrome P450BM3 mutant according to claim 1, the recombinant plasmid according to claim 3, or the recombinant bacterium according to claim 5 in highly selective oxidation of 1,8-cineole to produce 2-hydroxy-1,8-cineole.

8. The use according to claim 7, characterized in that The application comprises the following steps: using a cytochrome P450BM3 mutant as a catalyst and 1,8-cineole as a substrate, and highly selectively catalyzing and oxidizing position 2 to generate 2-hydroxy-1,8-cineole.

9. The use according to claim 8, characterized in that The reaction temperature of the catalytic oxidation is 25-35° C., and the pH is 6-8.

Images