Application of GhACR10 gene expression inhibitor in promoting plant defoliation

Abstract

The present invention relates to the technical field of plant breeding, and specifically discloses the use of a GhACR10 gene expression inhibitor in promoting plant defoliation, wherein the GhACR10 gene expression inhibitor promotes plant defoliation by inhibiting the expression of the GhACR10 gene, and the nucleotide sequence of the GhACR10 gene is shown in SEQ ID NO. 1. The present invention increases the sensitivity of the plant to a defoliant by inhibiting the expression of the GhACR10 gene in the plant, thereby promoting plant defoliation.

Description

Technical Field

[0001] The invention relates to the technical field of plant breeding, and in particular to application of a GhACR10 gene expression inhibitor in promoting plant defoliation. Background Art

[0002] Traditional cotton picking relies on manual labor, which is time-consuming, labor-intensive and inefficient. With the gradual advancement of agricultural modernization, full mechanization of cotton production has become inevitable, among which chemical defoliation by spraying defoliants is an important step before mechanical cotton picking. However, the current cotton defoliation effect is uneven, and is often accompanied by the phenomenon of scorching but not falling off, which seriously restricts the mechanized production efficiency of cotton.

[0003] Therefore, promoting cotton defoliation is an urgent problem to be solved. Summary of the invention

[0004] In order to promote cotton defoliation, the present invention provides the use of a GhACR10 gene expression inhibitor in promoting plant defoliation. The present invention increases the sensitivity of plants to defoliants by inhibiting the expression of the GhACR10 gene in plants, thereby promoting plant defoliation and reducing the phenomenon of scorching but not falling leaves.

[0005] The present invention provides an application of a GhACR10 gene expression inhibitor in promoting plant defoliation. The GhACR10 gene expression inhibitor promotes plant defoliation by inhibiting the expression of the GhACR10 gene. The nucleotide sequence of the GhACR10 gene is shown in SEQ ID NO.1, and the plant is cotton.

[0006] The present invention uses CRISPR / Cas9 technology to mutate the GhACR10 gene in the plant, thereby achieving the purpose of inhibiting the expression of the GhACR10 gene in the plant, thereby increasing the sensitivity of cotton to defoliants, promoting cotton defoliation, and reducing the phenomenon of scorching without falling.

[0007] Furthermore, the active ingredient of the GhACR10 gene expression inhibitor is a sgRNA targeting the GhACR10 gene; the sequence of the sgRNA targeting the GhACR10 gene undergoes the following mutation:

[0008] The base A is inserted after the 14th base of the GhACR10 gene, and 42 bases are deleted and 4 bases ATAT are inserted after the 413th base;

[0009] Or, the 15th base C of the GhACR10 gene is deleted, and 42 bases are deleted after the 423rd base and 4 bases ATAT are inserted;

[0010] Alternatively, four bases CGAC are deleted after the 14th base of the GhACR10 gene, and two bases CC are deleted after the 450th base.

[0011] Furthermore, the sgRNA sequence is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0012] Furthermore, the GhACR10 gene expression inhibitor is a CRISPR / Cas9 gene editing expression vector or recombinant cell containing sgRNA.

[0013] Furthermore, the CRISPR / Cas9 gene editing expression vector is obtained by recombining the sgRNA shown in SEQ ID NO.2 or SEQ ID NO.3 with the Crispr vector plasmid.

[0014] Furthermore, the GhACR10 gene expression inhibitor is used to increase the sensitivity of plants to defoliants and promote plant defoliation;

[0015] The GhACR10 gene expression inhibitor is used to reduce anti-defoliation hormone and increase pro-defoliation hormone.

[0016] Furthermore, the defoliant is any one or more of thiodiphenylmethane, diuron, thidiazuron and tributyl trithiophosphite.

[0017] Furthermore, the anti-defoliation hormone is any one of auxin, cytokinin and gibberellin, or a combination of several of them; the defoliation-promoting hormone is any one of brassinolide, abscisic acid and jasmonic acid, or a combination of several of them.

[0018] The present invention also provides an sgRNA, the nucleotide sequence of the sgRNA is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0019] The present invention also provides a method for increasing the sensitivity of plants to defoliants and promoting plant defoliation, comprising the following steps:

[0020] Construction of gene editing vector: constructing a recombinant vector containing the sgRNA shown in SEQ ID NO.2 or SEQ ID NO.3 by CRISPR / Cas9 gene editing technology;

[0021] The recombinant vector is transformed into Agrobacterium and then infects the plant explants to obtain callus tissue, which is then differentiated and induced to obtain a transgenic strain sensitive to defoliants.

[0022] The present invention also provides a composition for promoting plant defoliation, comprising a pTN vector containing sgRNA.

[0023] The present invention also provides a plant breeding method, comprising: inhibiting the expression of the GhACR10 gene in plants to obtain transgenic plants that are easy to shed leaves.

[0024] In the field of plant biotechnology, there are various technical means to inhibit gene expression, including gene silencing, RNAi and CRISPR-Cas9. These methods accurately regulate the transcription and translation of specific genes in plants through different mechanisms to achieve fine control of growth and development. Those skilled in the art will understand that as long as the expression of the GhACR10 gene can be effectively inhibited, the technical effect of promoting plant defoliation described in this application can be achieved.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention proposes for the first time the application of inhibiting the expression of the GhACR10 gene in promoting plant defoliation. By inhibiting the expression of the plant GhACR10 gene, the sensitivity of the plant to defoliants is increased, and plant defoliation is promoted. The transgenic plants obtained by gene editing are more sensitive to defoliants, defoliate faster, reduce the phenomenon of scorching but not falling, and have a better defoliation effect.

[0027] The transgenic strain obtained after the GhACR10 gene in the cotton plant of the present invention is suppressed has reduced anti-defoliation hormone and increased defoliation-promoting hormone compared with the wild plant in which the GhACR10 gene is not suppressed. Due to the change of the above hormones, the cotton is very sensitive to the defoliant, thereby promoting defoliation. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 Schematic diagram of the mutation of the sequence of the GhACR10 gene in the plant described in the embodiment of the present invention.

[0030] Figure 2 This is a schematic diagram of the phenotype of indoor defoliation results of plants in which the GhACR10 gene is suppressed as described in an embodiment of the present invention.

[0031] Figure 3 This is a schematic diagram of the indoor defoliation rate measurement results of the plant in which the GhACR10 gene is suppressed according to the embodiment of the present invention;

[0032] In the figure, A is the statistical results of the total leaf loss rate within 0, 24, 48, 72, and 96 h after treatment with thidiazuron in HM-1 and three knockout lines, line 1, line 2, and line 3;

[0033] B is the statistical results of the defoliation rate of 1 or 2 leaves in HM-1 and three knockout lines line 1, line 2, and line 3 within 0, 24, 48, 73, and 96 hours after treatment with thidiazuron;

[0034] C is the statistical results of the defoliation rate of 3 or 4 leaves in HM-1 and three knockout lines line 1, line 2, and line 3 after treatment with thidiazuron within 0, 24, 48, 72, and 96 hours;

[0035] D is the statistical results of the leaf loss rate of 5 and 6 leaves in HM-1 and three knockout lines line 1, line 2, and line 3 within 0, 24, 48, 72, and 96 hours after treatment with thidiazuron.

[0036] Figure 4 This is a schematic diagram of the results of measuring the defoliation-related hormone levels of plants in which the GhACR10 gene is suppressed according to an embodiment of the present invention;

[0037] In the figure, A shows the changes in ZR (cytokinin) content in cotton leaves within 0, 6, 24, 48, and 72 hours after treatment with thidiazuron in HM-1 and two knockout lines, line 1 and line 2;

[0038] B shows the changes of DHZR (dihydrozeatin) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0039] C shows the changes of IPA (indolepropionic acid) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0040] D is the changes of IAA (auxin) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0041] E shows the changes of BR (brassinolide) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0042] F is the changes of ABA (abscisic acid) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0043] G shows the changes of JA (jasmonic acid) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 after treatment with thidiazuron within 0, 6, 24, 48, and 72 hours;

[0044] H is the change of GA3 (gibberellin) content in cotton leaves of HM-1 and two knockout lines line 1 and line 2 within 0, 6, 24, 48 and 72 hours after treatment with thidiazuron. DETAILED DESCRIPTION

[0045] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0046] The present invention uses CRISPR / Cas9 technology to mutate the sequence of the GhACR10 gene in plants, specifically including three mutations: (1) inserting base A after the 14th base of the GhACR10 gene, deleting 42 bases after the 413th base and inserting 4 bases ATAT; (2) deleting the 15th base C of the GhACR10 gene, deleting 42 bases after the 423rd base and inserting 4 bases ATAT; (3) deleting 4 bases CGAC after the 14th base of the GhACR10 gene, and deleting two bases CC after the 450th base.

[0047] The CRISPR / Cas9 technology was used to induce the cotton (Huamian HM-1) plants to undergo the above three mutations, and the transgenic plant lines 1, 2 and 3 of the cotton were constructed, which were respectively recorded as line 1, line 2 and line 3. Specifically, the base A was inserted after the third base after PAM1 of the plant, and the 43 bases before PAM2 were deleted and ATAT4 bases were inserted, to obtain transgenic plant line 1 (line 1); or the 4th base C after PAM1 of the plant was deleted and the 43 bases before PAM2 were deleted and ATAT4 bases were inserted, to obtain transgenic plant line 2 (line 2); or the 4 bases CGAC were deleted after the third base after PAM1 of the plant, and the 4th and 5th bases before PAM2 were deleted, to obtain transgenic plant line 3 (line 3).

[0048] According to the above three mutations, sgRNA (including sgRNA-1 and sgRNA-2) were designed, and the sgRNA coding sequence was constructed into the pTN vector, and then the recombinant vector was co-cultured with cotton callus tissue by infection with GV3101 Agrobacterium strain, so as to transfer the recombinant vector containing the sgRNA coding sequence into the callus tissue. The cotton callus tissue can be grown into a transgenic cotton plant strain (transgenic plant strain) with suppressed GhACR10 gene through conventional differentiation, rooting, seedling hardening and transplanting, and subculture screening.

[0049] Through experimental research, it was found that line1, line2 and line3 are more sensitive to defoliants. Compared with the wild type, the transgenic plant strains have a higher defoliation rate and shed leaves faster, indicating that the transgenic plant strains are more sensitive to defoliants, and the transgenic plant strains shed leaves faster and reduce the phenomenon of burning but not falling. Therefore, genetic modification can increase the sensitivity of cotton plants to defoliants, thereby promoting cotton defoliation.

[0050] The nucleotide sequence of the GhACR10 gene is shown in SEQ ID NO.1.

[0051] SEQ ID NO.1:

[0052]

[0053] Example 1: Application of inhibiting GhACR10 gene expression in promoting plant defoliation.

[0054] 1. Construction of transgenic plants

[0055] 1. sgRNA design

[0056] The cotton variety used in the present invention is Huamian HM-1, denoted as HM-1.

[0057] The base A is inserted after the 14th base of the GhACR10 gene, and 42 bases are deleted and 4 bases ATAT are inserted after the 413th base; or the 15th base C of the GhACR10 gene is deleted, and 42 bases are deleted and 4 bases ATAT are inserted after the 423rd base; or the 4 bases CGAC are deleted after the 14th base of the GhACR10 gene, and two bases CC are deleted after the 450th base.

[0058] According to the mutation site, sgRNAs are designed, including sgRNA-1 and sgRNA-2. The upstream and downstream primers for amplifying double-stranded DNA fragments corresponding to the target sequence of sgRNA-1 are shown in SEQ ID NO.4-5, and the upstream and downstream primers for amplifying double-stranded DNA fragments corresponding to the target sequence of sgRNA-2 are shown in SEQ ID NO.6-7.

[0059] sgRNA-1: ACACGACGACGTAGTGATCA (SEQ ID NO. 2).

[0060] sgRNA-2: AAGGTATCGACGACTCCAGT (SEQ ID NO. 3).

[0061] SEQ ID NO. 4(F1):TTTCCCCAAAATGAGATATACT.

[0062] SEQ ID NO. 5(R1): CATTTCCCATCTGTAGATACAT.

[0063] SEQ ID NO. 6 (F2): AAAAGTACAGGGACTGATATCAG.

[0064] SEQ ID NO. 7(R2):ATACGTCTCCTCCTGCC.

[0065] Artificially synthesize sgRNA-1 and sgRNA-2. Dissolve the single-stranded DNA of sgRNA1 and sgRNA2 in ultrapure water to 10 μM respectively. Take 10 μL of each and place it in a 1.5 mL centrifuge tube to mix thoroughly. Then put it in a 98°C water bath and cool it naturally to room temperature to obtain sgRNA double-stranded DNA.

[0066] 2. Construction of recombinant vector

[0067] (1) The CRISPR vector plasmid was digested with enzymes and the reaction system was prepared as shown in Table 3.

[0068] Table 3 Empty plasmid restriction reaction system

[0069] Reagents Dosage Crispr vector plasmid 10 μg Restriction endonuclease IBSA1 4μL Cutsmart Buffer 10μL <![CDATA[ddH2O]]> Add to 100 μL

[0070] According to the system in Table 3, each substance was mixed evenly and then subjected to enzyme digestion reaction at 37° C. for 4 hours to obtain a linearized vector fragment.

[0071] After the enzyme digestion reaction is completed, take 4 μL and add 1 μL of 10× loading buffer, mix well and perform agarose gel electrophoresis, use the empty plasmid as a control to observe whether the enzyme digestion is successful. After success, you can choose heat inactivation according to whether the restriction endonuclease has a heat inactivation temperature, or use an agarose gel DNA recovery kit for recovery, determine the concentration by Nano-Drop2000, and store at -20℃ for later use.

[0072] (2) Construction of recombinant vector

[0073] The sgRNA double-stranded DNA is connected to the linearized Crispr vector fragment to obtain the CRISPR / Cas9 gene editing expression vector (recombinant vector). Specifically, it includes: using Novazon's IIOne Step Cloning Kit reagent uses homologous recombination to connect the target gene and the linearized vector fragment (vector plasmid). Mix according to the connection system in Table 4 and incubate in a 37°C metal bath for 30 minutes. Collect the connection product to obtain the recombinant vector.

[0074] Table 4 Connection system

[0075] Reagents Dosage CE buffer 2μL CExnase II enzyme 1μL Target gene (length*0.02) / concentration: 100ng Vector fragment (length*0.01) / concentration: 100ng Sterile water Add to 10 μL

[0076] (3) Recombinant vector transformation

[0077] Transform the ligation product into E. coli: Take 50 μL of E. coli DH5α competent cells and 10 μL of ligation product, mix well, and place on ice for 30 minutes. Heat shock at 42°C for 45 seconds. Immediately take out the centrifuge tube and place on ice for 2 minutes. Add 700 μL of liquid LB medium without antibiotics, and culture at 37°C and 200 rpm for 1 hour. After centrifugation at room temperature for 3 minutes at 5000 rpm, remove part of the supernatant, and use the remaining 100 μL of medium to mix the bacteria evenly. Use a sterile coating rod to evenly spread the remaining bacterial liquid on the LB plate containing the corresponding antibiotics, and invert the plate at 37°C.

[0078] (4) Colony PCR identification: Pick a monoclonal colony of Escherichia coli that grows normally on the plate, add 500 μL of LB liquid culture medium containing the corresponding antibiotics, and culture it in a shaker at 37°C at 200 rpm for about 12 hours. Take 1 μL as a template and use vector sequencing primers to perform PCR reaction. The PCR product is subjected to agarose gel electrophoresis. The monoclonal bacterial solution with the correct electrophoresis band size is cut and sent to the company for sequencing. The results are compared by software, indicating that the recombinant vector is successfully constructed.

[0079] (5) The seeds of the cotton recipient variety HM-1 were disinfected, and the hypocotyls of the sterile seedlings were cut after the seeds germinated. The hypocotyls were cut into 6 mm stem segments, and each group of stem segments was prepared in batches and groups to obtain cotton callus tissue, i.e., explants.

[0080] (6) The recombinant vector was infected with Agrobacterium tumefaciens strain GV3101 and the explant was soaked for 10 min to transfer the Crispr vector into the cotton callus tissue. The excess bacterial solution was then absorbed with sterile filter paper and the cotton callus tissue was cultured in the dark on the co-culture medium covered with filter paper for 2 days.

[0081] (7) The cotton callus tissue co-cultured in (5) was transferred to the resistant callus induction medium, and 500 mg·L-1 Cef was added to inhibit the growth of Agrobacterium. -2 ·s -2 , cultured under a 16-h light and 8-h dark cycle at 28±2℃ for 3 months to induce the growth of resistant callus, and subcultured once every 30 days.

[0082] (8) Inducing differentiation of the resistant callus in (7), i.e., cutting off the loose yellowish or white callus at both ends of the explant, and when the callus grows to the size of a fingernail, transferring it to a differentiation medium for continued proliferation induction until embryonic callus is produced.

[0083] The differentiation medium formula is: 1 / 2MS + 16 mg·L-1 abscisic acid (ABA, filter sterilized, product of Gibco) + 50 g·L-1 PEG4000 (product of Merck) + 30 g·L-1 sucrose + 1 g·L-1 activated carbon (product of Sigma) + 4 g·L-1 gel, additionally 500 mg·L-1 glutamine and 1 g·L-1 hydrolyzed casein (product of Sigma), pH 5.8.

[0084] (9) The embryonic callus tissue was subjected to induction culture of embryoids and plant seedlings. When the seedlings sprouted true leaves and were about 3-4 cm tall, the seedlings were transferred to rooting medium for further culture. When the seedlings grew to 6-8 cm, the regenerated seedlings were in a semi-lignified state and were grafted in a greenhouse until they survived. Molecular testing was performed and positive plants (including transgenic plant lines 1, 2, and 3) were retained until the T1 generation seeds of the transgenic lines were harvested.

[0085] (10) DNA was extracted from the leaves of the transgenic plant strains using the CTAB method, and PCR detection was performed by screening marker gene-specific primers to determine whether the transgenic plant strains were successfully obtained.

[0086] Example 2: Indoor defoliation experiment of transgenic plants susceptible to defoliation.

[0087] In this example, an indoor defoliation experiment was conducted on the transgenic plant lines 1, 2, 3 and the control group HM-1 obtained in Example 1 that were prone to defoliation.

[0088] (1) Seeds obtained from pure breeding of T1 generation transgenic plant lines 1, 2, and 3 of uniform size and seeds of the control group HM-1 were selected and soaked in 9% hydrogen peroxide for 15 minutes.

[0089] (2) Rinse the seeds several times with deionized water and soak them for more than 12 hours until they turn white.

[0090] (3) When the light temperature is 12h (28±2℃) / 12h (22±2℃), the indoor relative humidity is 75%, and the light intensity is 450μmol m-2s -1 Under the conditions, the soil potting method is adopted. Four seeds that turn white after soaking are sown in each pot in a pot filled with water-saturated nutrient soil. The diameter of the pot is 10 cm and the height is 8.5 cm.

[0091] (4) After the seedlings emerge and grow true leaves, two plants are selected and each line is replicated in 10 pots, for a total of 20 cotton plants.

[0092] (5) Pour 300 ml of Hoagland nutrient solution (a mixture of 1 mol / L magnesium sulfate, 2.5 mol / L calcium nitrate, 0.5 mol / L ammonium dihydrogen phosphate, 0.1 mol / L sodium ferric diethylaminoacetate, 1.25 mol / L potassium nitrate, 0.02 mol / L boric acid, 0.001 mol / L zinc sulfate, 0.0002 mol / L copper sulfate, 0.001 mol / L manganese sulfate and 0.000005 mol / L ammonium molybdate) into the pot every 3 days and store it at room temperature for later use. Supply 300 ml of water and fertilizer every 3 days until the 30th day.

[0093] (6) The defoliant Thidiazuron (Sichuan Guoguang Agrochemical Co., Ltd.) was sprayed with a concentration of 100 mg / L using a spray bottle, and plain water was used as a control treatment.

[0094] (7) Evenly spray an equal amount of defoliant on the leaves from 1 to 6 above the ground, where the leaves from 1 to 2 below the ground, leaves from 3 to 4 below the ground, and leaves from 5 to 6 below the ground are groups with similar growth.

[0095] (7) The leaf-shedding rate in each time period was calculated as follows: leaf-shedding rate = (number of leaves before medication - number of leaves after medication) / number of leaves before medication * 100%.

[0096] The results of the indoor defoliation experiment of the transgenic plants that are easy to defoliate according to the embodiment of the present invention are as follows: Figure 3 and Figure 4 The experimental results showed that the three crispr-GhACR10 transgenic lines (line1, line2, line3) had a higher defoliation rate and faster defoliation than the control group HM-1, indicating that the knockout material was more sensitive to the defoliant, the knockout material defoliated faster and reduced the phenomenon of scorching without falling.

[0097] Example 3: Field defoliation experiment of transgenic plants susceptible to defoliation.

[0098] In this example, a field defoliation experiment was conducted on the transgenic plant strains 1, 2, 3 and the control group HM-1 obtained in Example 1. The experiment was carried out in Alaerbu, Xinjiang Uygur Autonomous Region, China (average temperature 17.4°C) in May 2023, using a completely randomized block experimental design.

[0099] (1) According to steps (1)-(2) in Example 2, 150 seeds of each of transgenic plant lines 1, 2, 3 and the control group HM-1 were prepared.

[0100] (2) Field defoliation experiment Three biological replicates were designed for each strain, and each experimental plot was 36.8 m2 (4.6 m × 8.0 m) and managed uniformly.

[0101] (3) About 135 days after planting, a uniform concentration of 300 mg / L of defoliant thidiazuron wettable powder (Sichuan Guoguang Agrochemical Co., Ltd.) was sprayed, and clean water spraying was used as a control treatment. Manual backpack electric sprayers were used for uniform spraying. In order to prevent the liquid from drifting during spraying, plastic film was used to cover the adjacent plots during spraying.

[0102] (4) Count the defoliation results.

[0103] The results of the field defoliation experiment of the easily defoliated transgenic plants of the embodiments of the present invention showed that the three crispr-GhACR10 lines (line 1, line 2, line 3) were more sensitive to the defoliant, defoliated faster and reduced the phenomenon of scorching but not falling, and had a better defoliation effect than the control group HM-1.

[0104] Example 4: Determination of defoliation-related hormone levels in transgenic plants susceptible to defoliation.

[0105] In this example, the defoliation-prone transgenic plant lines 1 and 2 and the control group HM-1 obtained in Example 1 were used to measure the levels of defoliation-related hormones.

[0106] (1) Prepare leaves of transgenic plant lines 1, 2 and control group HM-1 according to steps (1) to (6) in Example 2.

[0107] (2) The hormone content in leaves was determined by enzyme-linked immunosorbent assay.

[0108] Figure 4 Schematic diagram of the results of measuring the defoliation-related hormone levels of the transgenic plants that are prone to defoliation as described in the embodiments of the present invention. Figure 4 It can be found that in transgenic lines 1 and 2 (line1, line2), zeatin riboside (ZR), dihydrozeatin riboside (DHZR), isopentenyl adenosine (IPA), auxin (IAA) and gibberellin (GA3) decreased faster than HM-1, while brassinosteroids (BR), abscisic acid (ABA) and jasmonic acid (JA) increased faster than HM-1. Among them, ZR, DHZR, IPA, IAA, BR and ABA all had significantly different time points from HM-1, which was consistent with the requirements for changes in hormone levels to promote defoliation, confirming the hormone level. GhACR10 After the gene was knocked out, cotton plants became more sensitive to defoliants.

[0109] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0110] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of a GhACR10 gene expression inhibitor in promoting plant defoliation, characterized in that: The GhACR10 gene expression inhibitor promotes plant defoliation by inhibiting the expression of the GhACR10 gene, the nucleotide sequence of the GhACR10 gene is shown in SEQ ID NO.1, and the plant is cotton; The GhACR10 gene expression inhibitor is a CRISPR / Cas9 gene editing expression vector containing sgRNA, and the sgRNA sequence is shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. The use of the GhACR10 gene expression inhibitor according to claim 1 in promoting plant defoliation, characterized in that: The CRISPR / Cas9 gene editing expression vector is obtained by recombining the sgRNA shown in SEQ ID NO.2 or SEQ ID NO.3 with the CRISPR vector plasmid.

3. Use of the GhACR10 gene expression inhibitor according to claim 1 in promoting plant defoliation, characterized in that: The GhACR10 gene expression inhibitor is used to increase the sensitivity of plants to defoliants and promote plant defoliation; The GhACR10 gene expression inhibitor is used to reduce anti-defoliation hormone; The anti-defoliation hormone is any one of cytokinin, zeatin and auxin or a combination of several of them; the defoliant is thidiazuron.

4. A sgRNA, characterized in that The sgRNA is the sgRNA in claim 1, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO.2 or SEQ ID NO.

3.

5. A method for increasing the sensitivity of plants to defoliants and promoting plant defoliation, characterized in that: The steps include: Constructing a gene editing vector: constructing a recombinant vector containing the sgRNA according to claim 4 by using CRISPR / Cas9 gene editing technology; The recombinant vector is transformed into Agrobacterium and then infects the plant explants to obtain callus tissue, which is then differentiated and induced to obtain a transgenic strain that is sensitive to defoliants; The defoliant is thidiazuron; and the plant is cotton.

Images