Function research of ATP synthase beta subunit in growth development and color formation of pleurotus ostreatus

Abstract

The invention discloses functional research of ATP synthase beta subunit in growth development and color formation of pleurotus ostreatus, and belongs to the technical field of gene engineering. The technical problem to be solved by the invention is how to regulate and control the fruiting body pileus color of the pleurotus and the primordium formation of the pleurotus. In order to solve the technical problem, the invention provides application of the ATP-F1 beta protein or a substance for regulating and controlling the expression of an ATP-F1 beta protein coding gene or a substance for regulating and controlling the content of the ATP-F1 beta protein in regulating and controlling the color of a pleurotus fungus pileus. The ATP-F1 beta protein can be a protein with an amino acid sequence as shown in SEQ ID NO. 3. The invention discloses the effect of the ATP-F1 beta gene in regulating and controlling the color of the pleurotus fungus pileus for the first time. The pleurotus citrinopileatus gene ATP-F1 beta can be widely applied to the fields of pleurotus citrinopileatus genetic breeding, germplasm resource screening, genetic engineering breeding and the like, and plays an important role in pleurotus citrinopileatus breeding.

Description

Technical Field

[0001] The present application belongs to the field of genetic engineering technology, and specifically relates to a functional study of ATP synthase β subunit in the growth, development and color formation of Pleurotus ostreatus. Background Art

[0002] ATP synthase is a high-energy phosphate bond based on the water-soluble ATP molecule. It is a macromolecular machine that couples soluble bulk bioenergy with membrane bioenergy formed by transmembrane electrochemical ion potential. ATP synthase consists of two bound subunits: intramembrane F0 and hydrophilic F1. The energy needs of aerobic organisms are mainly met by the action of ATP synthase. These enzymes are present in the inner membrane of mitochondria, the chloroplast thylakoid membrane of photosynthetic organisms, and the plasma membrane of bacteria, and catalyze the synthesis of ATP from ADP and Pi using the energy of the electrochemical transmembrane proton gradient. F1 has three catalytic and three non-catalytic nucleotide binding sites. The F1 part of ATP synthase consists of five subunits: α3, β3, γ, δ, and ε, of which the β subunit is the catalytic unit on F1.

[0003] The establishment of the basic principle of ATP synthase function is mainly based on the chemiosmotic hypothesis and the conformational change mechanism. ATP synthase plays an important role in fungal growth and development, catalyzing the synthesis of proteins, lipids and polysaccharides, participating in the synthesis of DNA and RNA, and providing energy for active transport across the membrane. F1 is a direct participant in the oxidative phosphorylation reaction. Protons act as activators of F1 conformational changes, and protons transferred through F0 form a pH gradient between acidified F0 and alkaline F1. It promotes the directional transfer of protons between subunits to F1 and is used for ATP synthesis reactions. Previous studies have shown that ATP synthase in chloroplasts can dynamically regulate the transthylakoid potential, indicating that ATP synthase is a key factor in the formation of transmembrane proton rings. Reduced ATP synthase activity in mitochondria plays a vital role in the pathogenesis of metabolic disorders. Studies have shown that the F1F0-ATP synthase β subunit is involved in the formation and development of diseases and can be used as an antifungal drug target. In the study of nematodes, the ATP-F1β subunit can regulate the activity of ATP synthase, which also lays the foundation for the study of ATP synthase in fungi.

[0004] my country is a major producer of Pleurotus ostreatus, which is also one of the most delicious and inexpensive edible mushrooms on the daily table. The color of the Pleurotus ostreatus cap is an important reference standard for consumers when purchasing. Summary of the invention

[0005] The technical problem to be solved by the present application is: how to regulate the growth and development of Pleurotus eryngii. Specifically, the technical problem to be solved by the present application is: how to regulate the color of the fruiting body cap of Pleurotus eryngii and the formation of the primordium of Pleurotus eryngii.

[0006] In order to solve the above technical problems, the present application provides the use of ATP-F1β protein or a substance for regulating the expression of a gene encoding the ATP-F1β protein or a substance for regulating the content of the ATP-F1β protein in any of the following items:

[0007] A1) Application in regulating the color of Pleurotus eryngii cap;

[0008] A2) Application in the preparation of products for regulating the color of Pleurotus eryngii caps;

[0009] A3) Application in regulating the number of primordium formation of Pleurotus eryngii;

[0010] A4), application in the preparation of products for regulating the amount of primordium formation of Pleurotus eryngii;

[0011] A5) Use in regulating ATP content and / or complex V activity of Pleurotus erythrocytes;

[0012] A6) Use in the preparation of products for regulating ATP content and / or complex V activity of Pleurotus eryngii;

[0013] A7) Application in Pleurotus eryngii breeding or Pleurotus eryngii assisted breeding;

[0014] A8) Use in the preparation of products for Pleurotus eryngii breeding or Pleurotus eryngii assisted breeding;

[0015] The ATP-F1β protein may be any of the following proteins:

[0016] a1), the amino acid sequence contains the protein shown in SEQ ID NO.3;

[0017] a2), a protein having more than 80% identity with the amino acid sequence shown in a1) and related to the color of the Pleurotus ostreatus cap obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in a1);

[0018] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0019] Furthermore, the protein described in a1) may also be a protein having an amino acid sequence of SEQ ID NO.3.

[0020] In the present application, the Pleurotus eryngii may be a macrofungus of the family Pleurotus eryngii.

[0021] Furthermore, the Pleurotus macrofungus may be a Pleurotus macrofungus.

[0022] Further, the Pleurotus macrofungus may be Pleurotus ostreatus, Pleurotus florida Eger., Pleurotus cornucopiae, Pleurotus sapidus and / or Pleurotus pulmonaria.

[0023] (Pleurotus pulmonarius).

[0024] In the present application, the index for Pleurotus eryngii breeding may include the cap color of the Pleurotus eryngii fruiting body.

[0025] In the present application, the purpose of Pleurotus ostreatus breeding may include cultivating Pleurotus ostreatus with a changed color of the fruiting body cap.

[0026] In the present application, the regulation may be increasing, promoting or upregulating.

[0027] In the present application, the regulation may also be reduction, inhibition or down-regulation.

[0028] In the present application, the protein may be derived from Pleurotus ostreatus.

[0029] In the present application, SEQ ID NO. 3 consists of 537 amino acid residues.

[0030] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0031] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0032] Further, the connection described in a3) may be a peptide bond connection formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2). Or, the connection described in a3) may be a peptide bond connection formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0033] Furthermore, in the application, the substance regulating the expression of the gene encoding the ATP-F1β protein or the substance regulating the content of the ATP-F1Β protein is a biological material, and the biological material can be any one of the following:

[0034] B1), a nucleic acid molecule encoding the ATP-F1β protein;

[0035] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0036] B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0037] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0038] B5), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ATP-F1β protein;

[0039] B6), an expression cassette containing the nucleic acid molecule described in B5);

[0040] B7), a recombinant vector containing the nucleic acid molecule described in B5) or a recombinant vector containing the expression cassette described in B6);

[0041] B8), a recombinant microorganism containing the nucleic acid molecule described in B5), a recombinant microorganism containing the expression cassette described in B6), or a recombinant microorganism containing the recombinant vector described in B7).

[0042] Furthermore, in the application, the nucleic acid molecule described in B1) may be a DNA molecule described in any one of g1) to g3) below:

[0043] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO.2;

[0044] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID NO.1;

[0045] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the color of the Pleurotus eryngii cap.

[0046] Furthermore, in the application, the nucleic acid molecule in B5) may be an RNA targeting the gene encoding the above-mentioned ATP-F1β protein or a DNA encoding the RNA.

[0047] Furthermore, the nucleotide sequence in the gene encoding the ATP-F1β protein targeted by the RNA is the segment of positions 1-600 of SEQ ID NO.2. Or the target sequence of the RNA is positions 1-600 of SEQ ID NO.2.

[0048] B5) The nucleic acid molecule may specifically be a double-stranded RNA molecule, wherein one strand of the double-stranded RNA molecule is an RNA sequence obtained by transcribing the nucleotide sequence of the DNA fragment from position 1 to position 600 of sequence 4 in the sequence list.

[0049] B5) The nucleic acid molecule may also be a gene encoding the double-stranded RNA molecule. The structural formula of the gene is formula (I):

[0050] SEQ forward-X-SEQ reverse (I).

[0051] The SEQ forward is a double-stranded DNA fragment whose nucleotide sequence of the coding chain is from position 1 to position 600 of SEQ ID NO.4; the SEQ reverse is a double-stranded DNA fragment whose coding chain is reversely complementary to positions 1 to 600 of SEQ ID NO.4; the X is a spacer fragment between the SEQ forward and the SEQ reverse, and the nucleotide sequence of the X is not complementary to either the coding chain of the SEQ forward or the coding chain of the SEQ reverse.

[0052] The gene of the double-stranded RNA molecule can be a DNA molecule whose coding strand nucleotide sequence is SEQ ID NO. 4, wherein SEQ ID NO. 4 positions 1-600 are the sequence of the SEQ forward fragment, SEQ ID NO. 4 positions 601-657 are the sequence of the X fragment, and SEQ ID NO. 5 positions 658-1257 are the sequence of the SEQ reverse fragment.

[0053] The present application also provides a method for regulating the cap color of Pleurotus eryngii, which comprises regulating the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or regulating the content of the ATP-F1β protein in the recipient Pleurotus eryngii to regulate the cap color of the recipient Pleurotus eryngii.

[0054] Furthermore, in the method described above, the regulation may be increasing, promoting or upregulating.

[0055] Furthermore, in the method described above, the regulation may also be reduction, inhibition or down-regulation.

[0056] Further, the method may include M1) and / or M2),

[0057] M1), increasing the expression of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or increasing the content of the ATP-F1β protein in the recipient Pleurotus eryngii to improve the cap color of the recipient Pleurotus eryngii;

[0058] M2), reducing the expression of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or reducing the content of the ATP-F1β protein in the recipient Pleurotus eryngii to reduce the cap color of the recipient Pleurotus eryngii, wherein the recipient Pleurotus eryngii contains the gene encoding the ATP-F1β protein.

[0059] Furthermore, in the method described above, in M1), the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or the content of the ATP-F1β protein in the recipient Pleurotus eryngii are increased by introducing the gene encoding the ATP-F1β protein into the recipient Pleurotus eryngii;

[0060] Furthermore, in the method described above, in M2), the expression level of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or the content of the ATP-F1β protein in the recipient Pleurotus eryngii are reduced by introducing the gene encoding RNA targeting the gene encoding the ATP-F1β protein into the recipient Pleurotus eryngii.

[0061] In the present application, the improving the cap color of the recipient Pleurotus eryngii may be making the color of the recipient Pleurotus eryngii darker.

[0062] In the present application, reducing the cap color of the recipient Pleurotus eryngii may be making the color of the recipient Pleurotus eryngii lighter.

[0063] In the present application, the cap color can be measured by a colorimeter.

[0064] The present application also provides a method for obtaining a target Pleurotus eryngii with a changed cap color, the method may include N1) and / or N2),

[0065] N1), obtaining a target Pleurotus eryngii having a darker cap color than that of the recipient Pleurotus eryngii by increasing the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or increasing the content of the ATP-F1β protein in the recipient Pleurotus eryngii;

[0066] N2), by reducing the expression level of the gene encoding the ATP-F1β protein in the recipient Pleurotus and / or reducing the content of the ATP-F1β protein in the recipient Pleurotus, obtaining a target Pleurotus with a cap color lighter than that of the recipient Pleurotus, wherein the recipient Pleurotus contains the gene encoding the ATP-F1β protein.

[0067] Furthermore, in the method described above, in N1), the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or the content of the ATP-F1β protein in the recipient Pleurotus eryngii are increased by introducing the gene encoding the ATP-F1β protein into the recipient Pleurotus eryngii;

[0068] Furthermore, in the method described above, in N2), the expression level of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or the content of the ATP-F1β protein in the recipient Pleurotus eryngii are reduced by introducing the gene encoding RNA targeting the ATP-F1β protein encoding gene into the recipient Pleurotus eryngii.

[0069] In the present application, the coding gene of the ATP-F1β protein may be a DNA molecule as described in any one of g1) to g3) below:

[0070] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO.2;

[0071] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID NO.1;

[0072] g3), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the color of the Pleurotus eryngii cap;

[0073] Furthermore, the target sequence of the RNA is located at positions 1-600 of SEQ ID NO.2. Or the target sequence of the RNA is positions 1-600 of SEQ ID NO.2.

[0074] Furthermore, the RNA encoding gene is a DNA molecule whose nucleotide sequence is SEQ ID NO.4.

[0075] The above-mentioned recombinant microorganism and / or the target Pleurotus eryngii prepared by the above-mentioned method are also within the protection scope of this application.

[0076] The ATP-F1β protein and the biological material described in this application are also within the protection scope of this application.

[0077] In the present application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or a nucleotide sequence) can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gapcost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the value of identity (%) can then be obtained.

[0078] The above-mentioned 80% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0079] The 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 85% or more identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 90% or more identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0080] Our team's previous research found that H2O2 can affect the formation of the color of the cap of Pleurotus ostreatus, and through transcriptomics, we found that energy production and metabolism are involved in regulating the formation of the cap color. On this basis, this study conducted a bioinformatics analysis of the ATP-F1β gene and constructed an overexpression strain and RNAi strain of Pleurotus ostreatus ATP-F1β through genetic transformation technology, and explored its regulatory effect on the formation of the color of the cap of Pleurotus ostreatus through mushroom fruiting experiments and enzyme activity determination.

[0081] The beneficial technical effects achieved by this application are as follows:

[0082] This application first reveals the role of the ATP-F1β gene in regulating the color of the Pleurotus eryngii cap. The Pleurotus eryngii gene ATP-F1β can be widely used in the fields of Pleurotus eryngii genetic breeding, germplasm resource screening, genetic engineering breeding, etc., and plays an important role in the breeding of Pleurotus eryngii and the study of the mechanism of the color formation of the Pleurotus eryngii fruiting body cap. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 Cloning of the ATP-F1β gene from Pleurotus ostreatus

[0084] Figure 2 The structure and phylogenetic tree of the ATP-F1β gene of Pleurotus ostreatus. (A) ATP-F1β(g11242) gene structure; (B) phylogenetic tree.

[0085] Figure 3 Comparison of amino acid sequences of ATP-F1β of Pleurotus ostreatus CCMSSC00389 and ATP-F1β of other fungi

[0086] Figure 4The secondary structure diagram and 3D structure model of the ATP-F1β protein of Pleurotus ostreatus. (A) The secondary structure diagram of the ATP-F1β protein of Pleurotus ostreatus; (B) The 3D structure of the ATP-F1β protein of Pleurotus ostreatus; (C) NADH; (D) NAD + .

[0087] Figure 5 YH-ATP-F1β plasmid map

[0088] Figure 6 SDS-PAGE analysis of recombinant protein ATP-F1β

[0089] Figure 7 OE-ATP-F1β plasmid map

[0090] Figure 8 This is the plasmid map of RNAi-ATP-F1β.

[0091] Fig. 9 Screening and obtaining of ATP-F1β transformation strains; (A) Detection of the expression level of ATP-F1β gene in the transformation strains; (B) Amplification of the hyg gene in the transformation strains.

[0092] Fig.10 ATP-F1β is involved in regulating the cap color formation of Pleurotus ostreatus. (A) WT and transformed young mushrooms of Pleurotus ostreatus CCMSSC00389; (B) Difference in cap brightness.

[0093] Fig.11 The effects of ATP-F1β transformed strain on energy metabolism. (A) Detection of ATP content in ATP-F1β transformed strain; (B) Detection of complex V activity in ATP-F1β transformed strain.

[0094] Fig.12 The primordium stages of the WT and transformed strains of Pleurotus ostreatus CCMSSC00389. DETAILED DESCRIPTION

[0095] Through transcriptomics, our team discovered that energy production and metabolism are involved in regulating the formation of the cap color. On this basis, this study conducted bioinformatics analysis on the ATP-F1β gene and constructed an overexpression strain and RNAi strain of Pleurotus ostreatus ATP-F1β through genetic transformation technology, and explored its regulatory effect on the formation of the cap color of Pleurotus ostreatus through mushroom fruiting experiments and enzyme activity determination.

[0096] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0097] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0098] In the following embodiments, Pleurotus ostreatus CCMSSC00389, OE plasmid and RNAi plasmid are owned by the applicant and disclosed in the document "Ludan Hou, etc. Mnsod1 promotes the development of Pleurotus ostreatus and enhances the tolerance of mycelia to heat stress. Microbial Cell Factories. 2022 Aug 8; 21(1): 155. doi: 10.1186 / s12934-022-01878-2." The public can obtain the above-mentioned biological materials from the applicant. The obtained above-mentioned biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0099] In the following embodiments, the manufacturer and product number of the colorimeter are products of Shenzhen Sanenshi Technology Co., Ltd., and the product number is Colorimeter YS3060.

[0100] In the following examples, the components of the IM medium and the CYM medium used in the genetic transformation are shown in Table 1.

[0101] Table 1 IM medium components and CYM medium components

[0102]

[0103] The components and preparation method of K-buffer are as follows: 13.099g K2HPO4·3H2O and 7.25g KH2PO4, dissolve one in ddH2O first, then dissolve the other, and then dilute to 50mL with ddH2O, sterilize at high temperature and high pressure for later use. The components and preparation method of MN-Solution are as follows: 1.5g MgSO4·7H2O and 0.75g NaCl, dilute to 50mL with ddH2O, sterilize at high temperature and high pressure for later use.

[0104] Table 2 Experimental reagents and sources

[0105]

[0106]

[0107] Table 3 Instruments and manufacturers

[0108] Instrument Name company Gel imaging analysis system Bio-rad High-speed refrigerated centrifuge Thermo Fisher PCR instrument Bio-rad qPCR instrument Bio-rad Ultra-micro-volume UV-visible spectrophotometer Thermo Fisher Edible fungus intelligent mushroom box Beijing Smart Kangxing Electrophoresis Apparatus Bio-rad Ultrasonic cell disruptor Ningbo Xinzhi Biotechnology Co., Ltd.

[0109] In the following examples, the antibiotic Kan represents kanamycin, the antibiotic Rif represents rifampicin, the antibiotic Cef represents cephalexin, and the antibiotic Hyg represents hygromycin.

[0110] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0111] The following examples used SPSS statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Duncan test was used, and p < 0.05 indicated that there was a statistically significant difference between the experimental groups.

[0112] Example 1: Effects of ATP-F1β gene and its encoded protein on the growth and development of Pleurotus ostreatus

[0113] 1.1. ATP-F1β gene cloning

[0114] The mycelium of Pleurotus ostreatus CCMSSC00389 strain was ground with liquid nitrogen and then total DNA was extracted using a DNA extraction kit, and total RNA was extracted using an RNA extraction kit, and then converted to cDNA for later use; the ATP-F1β gene sequence was retrieved from the Pleurotus ostreatus PC15 genome through the JCR database, and primers were designed using Primer 5 (Table 4), and gDNA and cDNA of the ATP-F1β gene of the Pleurotus ostreatus CCMSSC00389 strain were obtained by PCR cloning. The electrophoretic patterns of the ATP-F1β gene gDNA and cDNA are shown in Figure 1 The sequencing results show that the gDNA of the ATP-F1β gene is SEQ ID NO.1. The cDNA (i.e., coding sequence, CDS) of the ATP-F1β gene is SEQ ID NO.2. The amino acid sequence of the ATP-F1β protein encoded by the ATP-F1β gene is SEQ ID NO.3.

[0115] Table 4 ATP-F1β cloning primers

[0116] Primers Forward sequence (5′-3′) Reverse sequence (3′-5′) ATP-F1β_gDNA ATGCTCACCTCTCGCGGT TTAGTTGCCCATCTCCTTCG ATP-F1β_cDNA ATGCTCACCTCTCGCGGT TTAGTTGCCCATCTCCTTCG

[0117] The PCR amplification system (50 μL reaction system) is as follows:

[0118] Reagents volume 2×Phanta Max Master Mix 25μL ATP-F1β-gDNA-F or ATP-F1β-cDNA-F 1μL ATP-F1β-gDNA-R or ATP-F1β-cDNA-R 1μL Pleurotus ostreatus gDNA or cDNA / 2μL <![CDATA[ddH2O]]> 21μL

[0119] The PCR amplification system is as follows:

[0120]

[0121] PCR product purification and recovery: follow the instructions of the kit.

[0122] 1.2 Bioinformatics analysis of ATP-F1β

[0123] The ATP-F1β gene structure was analyzed through the online website (http: / / gsds.cbi.pku.edu.cn / ); the amino acid sequence was obtained through the Sequence Manipulation Suite website; the prediction of the conserved domain was obtained in the Conserved Domain Database on the NCBI website; the tertiary structure of the ATP-F1β protein was constructed through the online website (http: / / www.sbg.bio.ic.ac.uk / phyre2 / html / page.cgi?id=index); the comparison sequence was obtained by blasting on the NCBI website, and then the amino acid sequence was aligned using the Jalview software; and the phylogenetic tree was drawn using the MEGA5 software.

[0124] Results Figure 2 , Figure 3 and Figure 4 The ATP-F1β gene of Pleurotus ostreatus CCMSSC00389 strain consists of 7 exons and 6 introns. The entire gene is 1933 bp long (gDNA) and 1614 bp long (cDNA). Figure 2 ). A phylogenetic tree was constructed by selecting 33 amino acid sequences of fungal ATP-F1β from the NCBI database. The results showed that ATP-F1β of Pleurotus ostreatus was most closely related to the genus Pleurotus; followed by Hydrangea, Lederma, and Boletus; and clustered into a large branch with the basidiomycetes such as Tricholoma matsutake, Flammulina velutipes, and Schizophyllum as well as the model organisms Coprinus cinereus and Leptospermum bicolor ( Figure 2 (middle B).

[0125] The conserved domains detected by the SMART website showed a low complexity domain and an AAA domain at positions 41-57 and 207-452, where the AAA domain is an ATPase involved in various cellular activities. Figure 3 As shown, the results of multiple sequence alignment showed that the ATP-F1β protein of Pleurotus ostreatus CCMSSC00389 was highly homologous to the AAA of Agaricus bicolor, Lentinus edodes, Agaricus bisporus, Coprinus cinereus and Schizophyllum.

[0126] In order to gain a deeper understanding of the function of Pleurotus ostreatus ATP-F1β, the secondary protein structure of Pleurotus ostreatus ATP-F1β was predicted using an online prediction website http: / / npsa-pbil.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html. The results are as follows: Figure 3 and Figure 4 As shown in A: Most of the ATP-F1β protein is α-helix accounting for 41.71%, extended chain accounting for 14.90%, β-turn accounting for 7.64%, and random bend accounting for 35.75%. The 3-D structure of Pleurotus ostreatus ATP-F1β was predicted using the protein tertiary structure online prediction website. The results are shown in Figure 4 In the predicted tertiary protein structure diagram of B, it contains NADH (C) and NAD + (D) Binding site, indicating that the ATP-F1β subunit plays a key role in energy metabolism.

[0127] In order to further analyze the function of the ATP-F1β gene in the color formation of the cap of Pleurotus ostreatus, we constructed OE-ATP-F1β and RNAi-ATP-F1β vectors and obtained the transformed strains of Pleurotus ostreatus by Agrobacterium-mediated genetic transformation (see steps 1.3 to 1.5 for details).

[0128] 1.3. Prokaryotic expression of ATP-F1β

[0129] 1.3.1、Construction of ATP-F1β prokaryotic expression plasmid

[0130] a. Use TY_ATP-F1β_F / R primers to amplify the ATP-F1β cDNA fragment so that its PCR product has homology arms. The TY_ATP-F1β_F / R primer sequence (5′→3′) is as follows:

[0131] TY_ATP-F1β_F:TCGCGGATCCGAATTCATGCTCACCTCTCGCGGT;

[0132] TY_ATP-F1β_R:TGCTCGAGTGCGGCCGCTTAGTTGCCCATCTCCTTCGC.

[0133] b. Activate and extract the prokaryotic expression plasmid pET-28a, find the appropriate restriction site on the plasmid, use EcoRI and NotI to linearize the plasmid, then detect the restriction effect by agarose gel electrophoresis, and then purify and recover the successfully cut fragments.

[0134] c. Connect the ATP-F1β fragment with homology arms obtained in step a. to the linear vector purified and recovered in step b. Prepare the following connection reaction system and place it at 37°C for connection; then transform the connection product into E. coli competent cells and place it in a 37°C incubator for overnight inversion. The next day, pick a single clone, perform colony PCR, and screen positive colonies. The constructed prokaryotic expression plasmid is named YH-ATP-F1β( Figure 5 ).

[0135] Ligation reaction system: linearized pET-28a plasmid 2μL, PCR recovery product 1μL, 5×CE II Buffer 2μL, Exnase II 2μL, ddH2O 3μL.

[0136] 1.3.2. ATP-F1β prokaryotic expression plasmid induced expression

[0137] Spread the transformed bacterial solution on the Amp-resistant LB plate and culture at 37°C overnight. Select a single colony with good growth and inoculate it into the Amp-resistant LB liquid medium, and inoculate it into the new medium at a ratio of 1:100. Culture at 37°C and 180rpm until OD 600 =0.5, and quickly placed in a 15°C shaker for 30 min, and added IPTG with a final concentration of 1 mM. The bacterial solution without IPTG was used as a control (uninduced), and cultured at 15°C and 160 rpm for 24 h. Centrifuged at 4°C and 8000 g for 20 min to collect the cells. Use SDS-PAGE to detect whether the induction was successful.

[0138] This chapter further verifies the molecular weight of ATP-F1β protein through prokaryotic expression. The results show that the molecular weight of ATP-F1β protein is slightly greater than 50kDa and less than 70kDa ( Figure 6 ), which is close to the predicted molecular weight (57.44 kDa).

[0139] 1.4. ATP-F1β overexpression and RNAi plasmid construction

[0140] 1.4.1. OE-ATP-F1β plasmid construction

[0141] a. Place the overexpression plasmid map modified and saved in the laboratory in the early stage into the SnapGene Viewer software to screen for appropriate restriction sites, and design primers containing homology arms according to the restriction sites, see Table 5;

[0142] b. On the one hand, the overexpression plasmid OE was linearized by double restriction enzyme digestion (SpeI and PspOMI), and the full-length cDNA of the target fragment containing the homology arm was amplified. The recombinant plasmid was constructed by homologous recombination and named OE-ATP-F1β. The vector map is shown in Figure 7 , whose nucleotide sequence is shown in Table 8, wherein positions 7503 to 8324 of the OE-ATP-F1β vector sequence are the promoter sequence, positions 8399 to 10012 are the coding sequence of ATP-F1β, and positions 10044 to 10199 are the terminator sequence.

[0143] Table 5 Primers for construction of OE-ATP-F1β plasmid

[0144] Primers Sequence (5′→3′) OE_ATP-F1β_F GGTCAAAGTTACTAGTATGCTCACCTCTCGCGGT OE_ATP-F1β_R CAATTCTAGAGGGCCCTTAGTTGCCCATCTCCTTCGC

[0145] 1.4.2. Construction of RNAi-ATP-F1β plasmid

[0146] a. Input the map of RNAi plasmid stored in the laboratory into the online website https: / / www.takarabio.com / learning-centers / cloning / primer-design-and-other-tools, first use the two restriction sites BglⅡ and SpeⅠ to replace the original sequence on the plasmid with the ATP-F1β-Sence fragment, and design the first pair of primers for connecting RNAi plasmid. Then use SpeⅠ and PspOMⅠ to replace the original sequence on the plasmid with the ATP-F1β-Anti fragment, and design the second pair of primers (Table 6).

[0147] b. Using the cDNA of Pleurotus ostreatus CCMSSC00389 strain as a template and the primers in Table 6 as primer pairs, two fragments of the ATP-F1β gene were obtained by PCR amplification and purified, namely ATP-F1β-Sence and ATP-F1β-Anti fragments.

[0148] Table 6 Primers for RNAi-ATP-F1β plasmid construction

[0149] Primers Primer sequence (5′-3′) RNAi_ATP-F1β_F1 CCATCTCCTCAGATCATGCTCACCTCTCGCGGTGTCG RNAi_ATP-F1β_R1 TAAGCTCTAAACTAGTCCGACACCGGCACCTCC RNAi_ATP-F1β_F2 CGGTGTCGGAACTAGGTCGACAACCTTGATACCGGT RNAi_ATP-F1β_R2 CAATTCTAGAGGGCCATGCTCACCTCTCGCGGT

[0150] c. Extract the original RNAi plasmid and perform the first double enzyme digestion (BglⅡ and SpeⅠ) using the following system:

[0151] Reagents volume Original RNAi plasmid 20μL SpeI 1μL 10×Cutsmart Buffer 5μL <![CDATA[ddH2O]]> 22μL

[0152] 37℃ digestion for 2h

[0153]

[0154]

[0155] The fragment was homologously recombined with the vector after restriction digestion using the C112 kit (Nanjing Novozyme). The recombination system is as follows:

[0156] RNAi linearization vector 9μL ATP-F1β-Sence purified product 1μL 5×CE II Buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> 4μL

[0157] d. Reconstitution procedure; 37°C, 30 min; 4°C, 2 min;

[0158] e. The ligation product was transformed into competent E. coli cells, positive single clones were selected for expansion and culture, RNAi-ATP-F1β-Sence plasmid was extracted, and a second double enzyme digestion was performed. The system is as follows:

[0159] Reagents volume RNAi-ATP-F1β-Sence Plasmid 20μL SpeI 1μL PspOMI 1μL 10×Cutsmart Buffer 5μL <![CDATA[ddH2O]]> 23μL

[0160] f. Digest the enzyme in a metal bath at 37℃ for 3h, purify and recover the linearized vector. Recombine the ATP-F1β-Anti fragment with the RNAi-ATP-F1β-sence linearized vector using C112.

[0161] The recombinant system is as follows:

[0162] RNAi-ATP-F1β-sence linearized vector 9μL ATP-F1β-Anti purified product 1μL 5×CE II Buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> 4μL

[0163] g. The ligation product was transformed into competent E. coli cells, primers were designed on both sides of the BglⅡ and PspOMI restriction sites of the RNAi plasmid, and the ligated plasmid was sequenced. The sequencing results were compared to verify whether the ligation was successful. The verified recombinant vector was named RNAi-ATP-F1β vector. The vector map is shown in Figure 8 , whose nucleotide sequence is shown in Table 8, wherein the RNAi-ATP-F1β vector sequence is a promoter sequence from 7503 to 8324, an ATP-F1β-Sence fragment from 8319 to 8918, a spacer fragment from 8919 to 8975, an ATP-F1β-Anti fragment from 8976 to 9575, and a terminator sequence from 9607 to 9762. The coding strand of the ATP-F1β-Sence fragment is reversely complementary to the coding strand of the ATP-F1β-Anti fragment.

[0164] 1.5. Plasmid transformation of Pleurotus ostreatus mycelium

[0165] Prepare Agrobacterium GV3101 competent cells. Take 0.5 μL of OE-ATP-F1β or RNAi-ATP-F1β plasmid and transform it into Agrobacterium GV3101 competent cells and store them for later use.

[0166] 1.5.1. Preparation of mycelium

[0167] a. Inoculate the activated Pleurotus ostreatus strain into a PDA plate and culture at 28°C for 5-6 days;

[0168] b. Use a cork punch to cut the plate into small bacterial blocks, place the bacterial blocks in 100 mL of CYM liquid culture medium, and culture them at 28°C for 2 days.

[0169] 1.5.2. Cultivation and induction of Agrobacterium GV3101 (containing target plasmid)

[0170] a. The GV3101 Agrobacterium carrying OE-ATP-F1β or RNAi-ATP-F1β was streaked on a solid medium containing two resistance strains LB (Kan+Rif) and cultured at 28°C for 2 days;

[0171] b. Pick a single colony into 10 mL of resistant (Kan+Rif) LB liquid medium and culture at 28°C, 180 rpm for 2 days;

[0172] c. Expand cultivation;

[0173] d. Collect the cells using a 50 mL sterile centrifuge tube, centrifuge at 4500 rpm, 4°C, for 15 min, and discard the supernatant;

[0174] e. Wash the collected bacteria once with a small amount of IM liquid medium to remove the remaining LB medium;

[0175] f. Pour off the IM medium used for washing, add IM liquid medium to the centrifuge tube again, and shake gently;

[0176] g. Combine the bacterial suspensions from two 50 mL centrifuge tubes into a 250 mL Erlenmeyer flask and induce at 28°C and 90 rpm in the dark for 5 h.

[0177] 1.5.3 Co-cultivation of Agrobacterium and mycelium

[0178] a. Pour the bacterial mass cultured in CYM medium for 2 days into a 50 mL centrifuge tube to collect the bacterial mass;

[0179] b. Add sterile water to the centrifuge tube, shake it gently, and then pour out the liquid in the centrifuge tube to clean the CYM on the surface of the mycelium block;

[0180] c. Add the Agrobacterium cultured in the previous step to the centrifuge tube containing the bacterial mass, shake gently, then transfer the bacterial solution and bacterial mass in the centrifuge tube to a triangular flask, and culture at 28℃ in the dark for 5 hours;

[0181] d. Prepare IM solid culture medium, spread cellophane on the IM solid plate (cellophane must be sterilized in advance); prepare several sterilized filter papers, place the co-cultured bacterial blocks on the filter papers, remove the bacterial liquid remaining on the bacterial blocks, and then inoculate the bacterial blocks on the cellophane in the IM solid plate and culture at 28°C for 3-5 days;

[0182] e. Remove the cellophane and place on CYM solid medium (Cef+Hyg), and culture at 28℃ for about 30 days;

[0183] f. Inoculate the grown mycelium into a new CYM-containing plate (Cef+Hyg) for secondary screening;

[0184] g. The transformed strain grown from the secondary screening was inoculated onto a PDA plate, the mycelium was collected, the total DNA was extracted and the fragment was amplified using the hyg primer; the nucleotide sequence of the hyg primer is as follows (5' to 3'):

[0185] hyg-F:TATTCCTTTGCCCTCGGACG;

[0186] hyg-R:ATGAAAAAGCCTGAACTCACC.

[0187] h. Extract RNA from the successfully amplified transformed strain, reverse transcribe it into cDNA, detect the transcription level of the target gene by qPCR, and screen out the strain with the highest transformation efficiency.

[0188] 1.5.4. Detection of ATP-F1β gene expression level in transformed strains

[0189] The expression level of ATP-F1β gene in ATP-F1β overexpression strain and RNAi strain was detected. The primers used were referenced to Table 7.

[0190] Table 7 qPCR primers

[0191] Primers Sequence (5′→3′) qPCR_ATP-F1β-F TCGTGGTATTGCTGAACTCG qPCR_ATP-F1β-R GGAGGGACTTGTAATCTTGGAG qPCR_tubulin-F AGGCTTTCTTGCATTGGTACACGC qPCR_tubulin-R TATTCGCCTTCTTCCTCATCGGCA

[0192] Results Fig. 9 In Figure A, the results showed that in the OE-ATP-F1β strain, the expression level of the target gene ATP-F1β was significantly higher than that in the WT strain; in the RNAi-ATP-F1β strain, the expression level of the ATP-F1β gene was significantly decreased compared with that of the WT. Fig. 9 Figure B shows that the hyg fragment can be amplified in all transformed strains, further demonstrating the reliability of the transformed strains. Finally, overexpression (OE-ATP-F1β4, OE-ATP-F1β10) and RNAi strains (Ri-ATP-F1β7, Ri-ATP-F1β-8) were screened for further functional exploration.

[0193] 1.6. ATP-F1β plays an important role in the formation of cap color

[0194] The specific method of fruiting was as follows: the wild-type strain (Pleurotus ostreatus CCMSSC00389), overexpression strains (OE-ATP-F1β4, OE-ATP-F1β10) and RNAi strains (Ri-ATP-F1β7, Ri-ATP-F1β8) were inoculated on PDA medium and cultured for 7 days, and then the cells were punched with a punch. Punch holes evenly on the mycelium on the plate to obtain the mushroom block. Inoculate the mushroom block into the cottonseed hull medium (the cottonseed hull medium is: 94 parts of cottonseed hulls, 5 parts of wheat bran, and 1 part of quicklime are mixed evenly according to the mass ratio, and water is added to mix until the water content is 65%, and the wet weight is 180g / bottle. It is divided into cultivation bottles and sterilized at 121℃ for 120min), and cultured in the dark at 25℃ until the mycelium fills the cultivation bottle (cultured for about 25 days) and ripens for 5 days. Then transfer to the edible fungus intelligent mushroom box for mushroom management. The mushroom management conditions are: the temperature is set to 18℃ (daytime, 12h at 500Lux) and 10℃ (night, 12h in the dark), and the humidity is maintained at 95%. Observe the growth of different strains, take pictures, and record data. Set 30 bottles / strain. Repeat the experiment twice.

[0195] Take photos during the young mushroom stage and measure the color difference brightness of the cap of the fruiting body during the young mushroom stage (hereinafter referred to as the young mushroom cap). Fig.10 As shown in the two experiments, there was no significant difference in the color of the mushroom caps between the overexpression strain and the wild-type strain when observed with the naked eye; compared with the RNAi strain, the mushroom caps of the overexpression strain and the wild-type strain were significantly darker and blacker, and the mushroom caps of the RNAi-ATP-F1β strain were slightly blue ( Fig.10 (A).

[0196] The color value of the young mushroom cap was detected by a colorimeter. The color value of a single young mushroom cap in the culture bottle was randomly selected and tested by a colorimeter. At least 5 bottles were selected for each strain, and the results of the same strain were averaged. The results showed that the color value of the young mushroom cap of the overexpression strain was significantly lower than that of the wild type, while the color value of the young mushroom cap of the RNAi strain was significantly higher than that of the overexpression strain and the wild type strain ( Fig.10 (B). The results also show that the color of the young mushroom cap of the overexpression strain is significantly darker than that of the wild-type and RNAi strains. The color of the young mushroom cap of the RNAi strain is significantly lighter than that of the overexpression strain and the wild-type strain.

[0197] The above results show that increasing the expression of ATP-F1β in Pleurotus eryngii will darken the color of its cap, while decreasing the expression of ATP-F1β in Pleurotus eryngii will lighten the color of its cap.

[0198] 1.7. Detection of ATP content and complex V activity in ATP-F1β transformed strains

[0199] In order to further explore the function of ATP-F1β in the formation of Pleurotus ostreatus cap, this experiment measured the ATP content and complex V activity in the Pleurotus ostreatus ATP-F1β transformed strain. The ATP content in the transformed strain was measured according to the instructions of the Bio-Time ATP Detection Kit; the activity of complex V was measured using the instructions of the Solebao Mitochondrial Respiratory Chain Complex V / ATP Synthase Activity Detection Kit.

[0200] The results show that ( Fig.11 ) The ATP content and complex V activity of the ATP-F1β overexpression strain OE-ATP-F1β4 of Pleurotus ostreatus were significantly higher than those of other strains, while the ATP content of the OE-ATP-F1β10 strain was significantly higher than that of the WT strain, but its complex V activity was slightly different from that of the WT strain; both the ATP content and complex V activity of the Pleurotus ostreatus RNAi-ATP-F1β were significantly lower than those of the overexpression strain and the WT strain.

[0201] 1.8. The ATP-F1β transformed strain of Pleurotus ostreatus affects primordium formation

[0202] When conducting a fruiting experiment on transformants, it was unexpectedly discovered that the transformed strain of Pleurotus ostreatus ATP-F1β had an effect on primordium formation and primordium density. Fig.12 As shown in the figure, the OE-ATP-F1β strain of Pleurotus ostreatus appears 1-2 days earlier than the WT strain and RNAi-ATP-F1β strain when forming primordia, and the amount of primordia is more, which is an explosive primordia formation. The RNAi-ATP-F1β strain appears 3-5 days later than the wild type and overexpression strains, and the amount of primordia is less.

[0203] The same phenomenon occurred in both fruiting experiments. It is speculated that ATP-F1β of Pleurotus ostreatus is involved in regulating the germination and formation of primordium, and may be involved in the growth and development of Pleurotus ostreatus.

[0204] Discussion: ATP synthase is a macromolecular machine that combines soluble bulk bioenergy based on the huge energy pyrophosphate bond of the water-soluble ATP molecule with membrane bioenergy formed based on the transmembrane electrochemical ion potential. ATP-F1β plays a very important role in ATP synthesis. This study predicted the gene structure of ATP-F1β in Pleurotus ostreatus and constructed a phylogenetic tree. It is most closely related to Pleurotus ostreatus and belongs to the same basidiomycete category as Flammulina velutipes and Schizophyllum. In the 3-D structure prediction, NADH and NAD + Two ligands, ATP-F1β subunit, are speculated to play a key role in energy synthesis.

[0205] In order to explore the effect of ATP-F1β on the color formation of the cap of Pleurotus ostreatus fruiting bodies, we constructed OE-ATP-F1β and RNAi-ATP-F1β strains. In this study, the cap color of the OE-ATP-F1β strain was significantly darker than that of the RNAi-ATP-F1β strain during the fruiting stage. The colorimeter test results showed that the color of the OE-ATP-F1β strain was darker than that of the wild-type group, and the RNAi-ATP-F1β strain was the lightest. This indicates that ATP-F1β is involved in regulating the formation of the cap color of Pleurotus ostreatus. In addition, this study also found that the ATP-F1β transformed strain of Pleurotus ostreatus affects the formation of primordia. In the fruiting experiment of the transformant, the ATP-F1β overexpressing strain will form primordia first and the density is larger, followed by the wild-type group, and the RNAi group has the slowest primordia formation and low density. In order to further study its effect on growth and development, the expression of ATP-F1β in different developmental stages of Pleurotus ostreatus was detected and found to be the highest in the spore stage, followed by the primordium stage, and the lowest in the hyphae growth stage. In the growth process of fungi, the formation of primordium and the spore stage are two periods of transition from vegetative growth to reproductive growth, and in the fruiting body stage, the Pleurotus ostreatus pileus, especially the pileus, accumulates in large quantities. Therefore, it is speculated that ATP-F1β is not only involved in regulating the formation of the color of the Pleurotus ostreatus pileus, but also plays a vital role in the growth and development of fungi.

[0206] Table 8 Sequences in this application

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of ATP-F1β protein or a substance for regulating the expression of a gene encoding the ATP-F1β protein or a substance for regulating the content of the ATP-F1β protein in any of the following: A1) Application in regulating the color of Pleurotus eryngii cap; A2) Application in the preparation of products for regulating the color of Pleurotus eryngii caps; A3) Application in regulating the number of primordium formation of Pleurotus eryngii; A4), application in the preparation of products for regulating the amount of primordium formation of Pleurotus eryngii; A5) Use in regulating ATP content and / or complex V activity of Pleurotus erythrocytes; A6) Use in the preparation of products for regulating ATP content and / or complex V activity of Pleurotus eryngii; A7) Application in Pleurotus eryngii breeding or Pleurotus eryngii assisted breeding; A8) Use in the preparation of products for Pleurotus eryngii breeding or Pleurotus eryngii assisted breeding; The ATP-F1β protein is any of the following proteins: a1), the amino acid sequence contains the protein shown in SEQ ID NO.3; a2), a protein having more than 80% identity with the amino acid sequence shown in a1) and related to the color of the Pleurotus ostreatus cap obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in a1); a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The use according to claim 1, characterized in that: The substance that regulates the expression of the gene encoding the ATP-F1β protein or the substance that regulates the content of the ATP-F1Β protein is a biological material, and the biological material is any one of the following: B1), a nucleic acid molecule encoding the ATP-F1β protein according to claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ATP-F1β protein of claim 1; B6), an expression cassette containing the nucleic acid molecule described in B5); B7), a recombinant vector containing the nucleic acid molecule described in B5) or a recombinant vector containing the expression cassette described in B6); B8), a recombinant microorganism containing the nucleic acid molecule described in B5), a recombinant microorganism containing the expression cassette described in B6), or a recombinant microorganism containing the recombinant vector described in B7).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO.2; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID NO.1; g3), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the color of the Pleurotus eryngii cap; B5) The nucleic acid molecule is an RNA targeting the gene encoding the ATP-F1β protein or a DNA encoding the RNA.

4. A method for regulating the color of Pleurotus eryngii caps, characterized in that: The method comprises regulating the expression amount of the gene encoding the ATP-F1β protein of claim 1 in the recipient Pleurotus eryngii and / or regulating the content of the ATP-F1β protein in the recipient Pleurotus eryngii to regulate the cap color of the recipient Pleurotus eryngii.

5. The method according to claim 4, characterized in that The method comprises M1) and / or M2), M1), increasing the expression of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or increasing the content of the ATP-F1β protein in the recipient Pleurotus eryngii to improve the cap color of the recipient Pleurotus eryngii; M2), reducing the expression of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or reducing the content of the ATP-F1β protein in the recipient Pleurotus eryngii to reduce the cap color of the recipient Pleurotus eryngii, wherein the recipient Pleurotus eryngii contains the gene encoding the ATP-F1β protein.

6. The method according to claim 5, characterized in that M1) by introducing the coding gene of the ATP-F1β protein into the recipient Pleurotus eryngii to increase the expression amount of the coding gene of the ATP-F1β protein in the recipient Pleurotus eryngii and / or increase the content of the ATP-F1β protein in the recipient Pleurotus eryngii; M2) In the step of introducing the coding gene of RNA targeting the coding gene of the ATP-F1β protein into the recipient Pleurotus eryngii, the expression level of the coding gene of the ATP-F1β protein in the recipient Pleurotus eryngii and / or the content of the ATP-F1β protein in the recipient Pleurotus eryngii are reduced.

7. A method for obtaining a target Pleurotus eryngii with a changed cap color, characterized in that: The method comprises N1) and / or N2), N1), obtaining a target Pleurotus eryngii having a darker cap color than that of the recipient Pleurotus eryngii by increasing the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or increasing the content of the ATP-F1β protein in the recipient Pleurotus eryngii; N2), by reducing the expression level of the gene encoding the ATP-F1β protein in the recipient Pleurotus and / or reducing the content of the ATP-F1β protein in the recipient Pleurotus, obtaining a target Pleurotus with a cap color lighter than that of the recipient Pleurotus, wherein the recipient Pleurotus contains the gene encoding the ATP-F1β protein.

8. The method according to claim 7, characterized in that N1) In the step of introducing the gene encoding the ATP-F1β protein into the recipient Pleurotus eryngii, thereby increasing the expression amount of the gene encoding the ATP-F1β protein in the recipient Pleurotus eryngii and / or increasing the content of the ATP-F1β protein in the recipient Pleurotus eryngii; N2) by introducing the coding gene of RNA targeting the coding gene of the ATP-F1β protein into the recipient Pleurotus eryngii to reduce the expression level of the coding gene of the ATP-F1β protein in the recipient Pleurotus eryngii and / or reduce the content of the ATP-F1β protein in the recipient Pleurotus eryngii.

9. The biomaterial as claimed in claim 2 or 3.

10. The biomaterial according to claim 9, characterized in that The recombinant microorganism is the recombinant microorganism described in claim 2 or 3 and / or the target Pleurotus eryngii prepared by the method described in claim 7 or 8.

Images