Method for eliminating Crab effect of saccharomyces cerevisiae through sucrose phospholysis

Abstract

The invention provides a method for eliminating the Crab effect of saccharomyces cerevisiae through sucrose phospholysis, which comprises the following steps: gradually performing targeted knockout on SUC2, MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes in the saccharomyces cerevisiae by adopting a CRISPR / Cas9 system, and introducing exogenous genes PvSUF and LmSP to enable the saccharomyces cerevisiae to transfer sucrose into cells and perform phospholysis to obtain sugar and 1-phosphoric acid-glucose. On the basis of phospholysis of sucrose, the energy loss in the sucrose utilization process is reduced, the Crab effect is eliminated through flux shunt of central carbon metabolism, the constructed Crab negative strain does not pass evolution and has a good genetic background, and meanwhile, a synthesis path of acetyl CoA in cytoplasm is not removed, so that the cell growth pressure is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of metabolic engineering and synthetic biology, and in particular relates to a method for eliminating the Crabtree effect of brewer's yeast by sucrose phosphorolysis. Background Art

[0002] During the fermentation process, the choice of carbon source has an important influence on the yield and quality of the product. Saccharomyces cerevisiae can utilize different raw materials from a variety of sources. The first generation of raw materials comes directly from agricultural production (mainly sugar and starch); the second generation of raw materials are by-products of agricultural raw material processing, such as lignocellulosic sugars extracted from straw or corn stover, or glycerol extracted from biodiesel production. Sucrose, a disaccharide widely found in nature, is composed of a glucose and a fructose molecule connected by a glycosidic bond. It is a natural sweetener extracted from sugarcane or beets. It is not only an important ingredient in the human diet, but also an extremely important carbon source in the fermentation industry. Due to its wide availability, relatively low cost and high fermentation efficiency, sucrose has become a very popular carbon source in the fermentation process of Saccharomyces cerevisiae.

[0003] Saccharomyces cerevisiae can utilize sucrose in two ways: hydrolyzing sucrose extracellularly and then absorbing fructose and glucose by facilitated diffusion; or taking up sucrose through a proton co-osmosis mechanism and then hydrolyzing it intracellularly. However, no matter how Saccharomyces cerevisiae utilizes sucrose, it cannot store the free energy generated by sucrose hydrolysis (ΔG0'=-29kJ / mol). In some microorganisms, sucrose is phosphorylated into fructose and 1-phosphate-glucose. This process bypasses the ATP required for hydrolysis and can save more free energy. At the same time, sucrose phosphorylation can effectively solve the phenomenon that glucose inhibits fructose utilization. Sucrose is phosphorylated into fructose and 1-phosphate-glucose. Without the inhibitory effect of glucose, fructose and 1-phosphate-glucose can smoothly enter the central carbon metabolism.

[0004] Under high glucose concentration conditions, Saccharomyces cerevisiae prefers the pathway of fermentation to produce ethanol rather than respiration to produce energy. This ethanol overflow metabolism is called the Crabtree effect. In Saccharomyces cerevisiae, 1 molecule of glucose can produce 32 molecules of ATP through the respiratory pathway, while the fermentation pathway can only produce 2 molecules of ATP. The low energy efficiency of the fermentation pathway not only limits the production of biomass, but also limits the synthesis of non-ethanol chemicals, especially when the product synthesis pathway requires higher energy consumption or redox power than fermentation. At the same time, when glycolysis operates at a higher flux, the expression of related genes in respiration will be inhibited, and pyruvate will be quickly converted into ethanol instead of entering the mitochondria. This regulatory mechanism further clarifies the energy loss problem caused by the Crabtree effect.

[0005] To transform Saccharomyces cerevisiae into a Crabtree-negative strain, a typical strategy is to delete the pyruvate decarboxylase encoded by PDC, thereby eliminating ethanol accumulation. However, this operation will result in insufficient supply of acetyl CoA and NAD + Insufficient regeneration, Pdc - The strain was unable to grow in a medium with excess glucose, and finally the slow growth was solved by laboratory evolution (ALE). This method was to destroy the ethanol synthesis pathway, making it impossible for the strain to synthesize ethanol normally. In this case, the NADH produced by the glycolysis pathway cannot be converted into NAD in the cytoplasm. + , destroying NADH / NAD + Therefore, without destroying the ethanol synthesis pathway, regulating the central carbon metabolism pathway to eliminate the Crabtree effect has a more stable effect. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a method for eliminating the Crabtree effect of Saccharomyces cerevisiae and a strain for eliminating the Crabtree effect. The present invention is based on the phosphorylation of sucrose, reduces the energy loss in the sucrose utilization process, and eliminates the Crabtree effect by flux diversion of central carbon metabolism.

[0007] Sucrose is hydrolyzed into glucose and fructose in wild yeast. However, due to the existence of glucose inhibition effect, yeast preferentially utilizes glucose, and fructose is consumed only when glucose is consumed or most of it is consumed. The existence of this phenomenon will affect the efficiency of sucrose entering central carbon metabolism and energy metabolism. In order to solve the above technical problems, the present invention provides a method for eliminating the Crabtree effect of Saccharomyces cerevisiae by sucrose phosphorylation. First, it is necessary to knock out the sucrose hydrolase gene and sucrose transporter in Saccharomyces cerevisiae, so that the yeast strain cannot normally utilize sucrose. There are a variety of sucrose hydrolases and sucrose transporters in Saccharomyces cerevisiae. The CRISPR / Cas9 system is used to gradually target and knock out the genes SUC2, MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5. On the basis of the platform strain that cannot utilize sucrose, the sucrose phosphorylation pathway is introduced to restore the ability of Saccharomyces cerevisiae to utilize sucrose. By introducing the exogenous genes PvSUF and LmSP, Saccharomyces cerevisiae can transport sucrose into the cell and phosphorylate it into fructose and 1-phosphate-glucose. Similarly, the fragment X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B was integrated into the X-3 site of the genome using the CRISPR / Cas9 system.

[0008] The method comprises the following steps:

[0009] S1. Use CRISPR / Cas9 system to gradually target and knock out SUC2, MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes in Saccharomyces cerevisiae;

[0010] S2. The introduction of exogenous genes PvSUF and LmSP enables Saccharomyces cerevisiae to transport sucrose into the cell and phosphorylate it into fructose and 1-phosphate-glucose.

[0011] In the above method, further, S1 comprises:

[0012] S1-1, using the Saccharomyces cerevisiae genome as a template, amplify the upstream and downstream sequences of the SUC2 gene on the genome by PCR, 500 bp each, and connect the two sequences to form SUC2 donor DNA by fusion PCR;

[0013] S1-2. Design SUC2-sgRNA according to the SUC2 gene, and construct a Cas9 plasmid containing the SUC2-sgRNA;

[0014] S1-3, transferring the SUC2 donor DNA and the Cas9 plasmid into Saccharomyces cerevisiae by lithium acetate transformation method to obtain Saccharomyces cerevisiae with SUC2 gene knocked out;

[0015] S1-4, cycle the operations from S1-1 to S1-3 to knock out the MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes respectively.

[0016] The method for constructing donor DNA is to use the Saccharomyces cerevisiae genome as a template, and to amplify 500bp of the upstream and downstream sequences of the gene to be knocked out on the genome through PCR, and then to connect the two sequences to each other through fusion PCR. The connected fragment is the donor DNA.

[0017] For the construction of Cas9 plasmid containing sgRNA, the designed 20bp targeting sequence needs to be synthesized in the form of primers, and then the original Cas9 plasmid is linearized by PCR. The linearized fragment is recircularized into a plasmid with a one-step cloning enzyme and then transferred into E. coli JM109 for amplification to obtain the designed Cas9 plasmid.

[0018] The constructed donor DNA and Cas9 plasmids were transferred into Saccharomyces cerevisiae by lithium acetate transformation method, and then the defective type was used to determine whether the plasmid was successfully transferred into the cell and functioned. The correct transformant was further verified by colony PCR. After knocking out a gene, repeat the above steps to knock out the next gene. By comparing the knockout strains of different degrees and observing the growth of the strains in sucrose medium, it was determined whether the strains can normally utilize sucrose. The ability of the strain to utilize sucrose was determined by the following methods: the strain could not grow normally on the liquid medium of sucrose or the recombinant strain could not grow colonies on the medium containing sucrose through the spot experiment.

[0019] In the above method, further, the gene sequence of the SUC2 donor DNA is shown in SEQ ID NO.1; the gene sequence of the MAL12 donor DNA is shown in SEQ ID NO.2; the gene sequence of the MAL32 donor DNA is shown in SEQ ID NO.3; the gene sequence of the MPH2 donor DNA is shown in SEQ ID NO.4; the gene sequence of the MPH3 donor DNA is shown in SEQ ID NO.5; the gene sequence of the IMA1 donor DNA is shown in SEQ ID NO.6; the gene sequence of the IMA2 donor DNA is shown in SEQ ID NO.7; the gene sequence of the IMA3 donor DNA is shown in SEQ ID NO.8; the gene sequence of the IMA4 donor DNA is shown in SEQ ID NO.9; and the gene sequence of the IMA5 donor DNA is shown in SEQ ID NO.10.

[0020] In the above method, further, the SUC2-sgRNA gene sequence is shown in SEQ ID NO.11. The MAL12-sgRNA gene sequence is shown in SEQ ID NO.12. The MAL32-sgRNA gene sequence is shown in SEQ ID NO.13. The MPH2-sgRNA gene sequence is shown in SEQ ID NO.14. The MPH3-sgRNA gene sequence is shown in SEQ ID NO.15. The IMA1-sgRNA gene sequence is shown in SEQ ID NO.16. The IMA2-sgRNA gene sequence is shown in SEQ ID NO.17. The IMA3-sgRNA gene sequence is shown in SEQ ID NO.18. The IMA4-sgRNA gene sequence is shown in SEQ ID NO.19. The IMA5-sgRNA gene sequence is shown in SEQ ID NO.20.

[0021] In the above method, further, S2 comprises:

[0022] S2-1, using the Saccharomyces cerevisiae genome as a template, amplifying the X3A fragment, TDH1p fragment, ADH1t fragment, PGK1p fragment, GAA1t fragment, X3B fragment, PvSUF fragment and LmSP fragment respectively; connecting into donor DNA in the order of X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B;

[0023] S2-2, using plasmid pRS426-Cas9 as a template, PCR amplification was performed to obtain the SCAS1 fragment, SCAS2 fragment, SCAS3 (X-3) fragment, and SCAS4 (X-4) fragment; the fragments were connected into a circle by Gibson ligation, and then transferred into Escherichia coli for amplification to obtain the Cas9-sgRNA plasmid of the X-3 site;

[0024] S2-3, the donor DNA and the Cas9-sgRNA plasmid of the X-3 site are transformed into Saccharomyces cerevisiae by lithium acetate transformation method.

[0025] The fragment X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B was integrated into the X-3 site of the genome using the CRISPR / Cas9 system. To perform this operation, donor DNA and Cas9 protein must work simultaneously. Among them, donorDNA is the entire fragment of X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B. In order to construct this fragment, X3A, TDH1p, ADH1t, PGK1p, GAA1t, and X3B were amplified by PCR using the Saccharomyces cerevisiae genome as a template. Among them, X3A and X3B are the upstream and downstream sequences of the X3 site, respectively, TDH1p and PGK1p are endogenous promoters of Saccharomyces cerevisiae, and ADH1t and GAA1t are endogenous terminators of Saccharomyces cerevisiae. Genes PvSUF and LmSP were synthesized by a sequence synthesis company. Then, the obtained small fragments were sequentially connected by fusion PCR to obtain donor DNA. For the construction of Cas9 plasmid containing sgRNA of X-3 site, the 20 bp targeting sequence in the plasmid was replaced in the same way.

[0026] In the above method, further, the gene sequence of the PvSUF fragment is shown as SEQ ID NO.30, and the gene sequence of the LmSP fragment is shown as SEQ ID NO.31.

[0027] The above method further includes:

[0028] S3. Knock out the PGI1 gene to cut off the crosstalk between the pentose phosphate pathway and the glycolysis pathway, thereby reducing the flux of the glycolysis pathway.

[0029] In the above method, further, S3 includes:

[0030] S3-1, using the Saccharomyces cerevisiae genome as a template, amplify the upstream and downstream sequences of the PGI1 gene on the genome by PCR, 500 bp each, and connect the two sequences to form PGI1 donor DNA by fusion PCR;

[0031] S3-2. Design PGI1-sgRNA according to the PGI1 gene, and construct a Cas9 plasmid containing the PGI1-sgRNA;

[0032] S3-3, transferring the PGI1 donor DNA and the Cas9 plasmid into Saccharomyces cerevisiae by lithium acetate transformation method to obtain Saccharomyces cerevisiae with PGI1 gene knocked out;

[0033] In the above method, further, the gene sequence of PGI1 donor DNA is shown as SEQ ID NO.21; the gene sequence of PGI1-sgRNA is shown as SEQ ID NO.22 to SEQ ID NO.29.

[0034] The Crabtree effect is triggered by overflow metabolism of the pyruvate node and glucose-driven inhibition of respiratory enzymes. Although this effect was advantageous during the evolution of Saccharomyces cerevisiae, it is useless for industrial yeast strains that produce chemicals. Ethanol produced by the carbon source through the Crabtree effect reduces the flux of the desired chemical product. To eliminate the Crabtree effect, there are two main problems: First, there needs to be a new pathway that can replace the ethanol pathway to oxidize excess NADH in the cytoplasm to NAD + ; Another problem is the need to solve the supply of acetyl-CoA in the cytoplasm. By knocking out the gene PGI1, the crosstalk between the pentose phosphate pathway and the glycolysis pathway can be cut off, thereby reducing the flux of the glycolysis pathway. Due to the reduction in EMP flux, the production of NADH in the cytoplasm is far less than that synthesized by the glucose metabolism model, and NADH can be oxidized through the respiratory chain under the action of NADH dehydrogenase. At the same time, since the gene PDC is not knocked out, there is no acetyl-CoA synthesis pathway in the cytoplasm. Therefore, this method can solve the above two problems at the same time.

[0035] Compared with the prior art, the advantages of the present invention are:

[0036] The present invention provides a method for eliminating the Crabtree effect of Saccharomyces cerevisiae. The Saccharomyces cerevisiae strain is used as a host strain. By knocking out the endogenous sucrose hydrolase-related genes, the Saccharomyces cerevisiae cannot utilize sucrose by hydrolysis. Furthermore, the sucrose phosphorylation pathway genes PvSUF and LmSP are introduced to enable Saccharomyces cerevisiae to phosphorylate sucrose into fructose and 1-phosphate-glucose, thereby solving the glucose inhibition effect caused by sucrose hydrolysis. Finally, the gene PGI1 is knocked out to achieve the diversion of the glycolysis pathway and the pentose phosphate pathway, reducing the flux of the glycolysis pathway without affecting the normal synthesis of acetyl CoA and NAD + The regeneration of Pdc was completed to complete the construction of Crabtree negative strain. - The construction of the Crabtree negative strain completed by the adaptive evolution of the strain, the Crabtree negative strain constructed by the present invention has not evolved and has a good genetic background. At the same time, the Crabtree negative bacteria constructed by the present invention do not remove the synthesis pathway of acetyl CoA in the cytoplasm, thereby reducing the cell growth pressure. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0038] Figure 1 Schematic diagram of the sucrose phosphorolysis pathway replacing the endogenous sucrose hydrolysis pathway in Example 1 of the present invention.

[0039] Figure 2 This is the effect of knocking out the sucrose hydrolysis pathway and introducing the sucrose phosphorolysis pathway on the growth of the strain in Experiment 1 of the present invention.

[0040] Figure 3 The ethanol accumulation and NADH / NAD ratio of the strain after the sucrose phosphorylation pathway was introduced in Experiment 2 of the present invention. + ratio.

[0041] Figure 4 Schematic diagram of the PGI1 gene knockout pathway in Example 2 of the present invention.

[0042] Figure 5 This is the accumulation of ethanol and glycerol in the PGI1 gene knockout strain in Experiment 3 of the present invention. DETAILED DESCRIPTION

[0043] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0044] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0045] the term

[0046] The term "expression" in the present invention refers to the expression of genes in a metabolic pathway, for example: using the promoter TDH1p to express the gene PvSUF means that the endogenous promoter TDH1p of Saccharomyces cerevisiae is connected to the front of the gene PvSUF for the initiation of gene transcription.

[0047] The term "overexpression" as used in the present invention refers to using a strong promoter in front of a gene or using a promoter stronger than its native expression for the expression of a gene.

[0048] The term "knockout" described in the present invention refers to a method of deleting a gene from the genome by means of CRISPR / Cas9. For example, knocking out the gene PGI means completely deleting the gene PGI1 from the genome, so as to achieve the purpose that PGI1 cannot function. The term "X-3 site" described in the present invention refers to a specific sequence present in the genome of Saccharomyces cerevisiae, which is commonly used for sites for gene integration on the genome. The symbol "Δ" used in the present invention represents gene knockout, such as PGIΔ represents the knockout of gene PGI1. The symbol "::" used in the present invention represents gene insertion, such as A::B represents the insertion of gene B into the A locus. YPD medium includes 10g / L yeast extract, 20g / L peptone, 20g / L glucose or 40g / L sucrose. YNB medium includes 1.7g / L YNB (without ammonium sulfate and amino acids), 5g / L ammonium sulfate, 20g / L glucose or 40g / L sucrose. If necessary, add the corresponding amino acids for screening (tryptophan, histidine, leucine and uracil).

[0049] Example 1

[0050] A Crabtree effect-eliminated strain of the present invention is a strain obtained by knocking out genes related to sucrose hydrolase and sucrose transporter in the genome of Saccharomyces cerevisiae.

[0051] Figure 1 It is a schematic diagram of the sucrose phosphorylation pathway replacing the endogenous sucrose hydrolysis pathway of the present invention. It can be seen from the figure that in wild-type yeast, sucrose is mainly hydrolyzed into fructose and glucose, and then glucose can enter the central carbon metabolism through glycolysis. Due to glucose inhibition, fructose can enter the carbon metabolism only after the glucose utilization is completed. The knockout of sucrose hydrolase and the introduction of the sucrose phosphorylation pathway can make sucrose phosphorylated into fructose and 1-phosphate-glucose, and both fructose and 1-phosphate-glucose can enter the central carbon metabolism.

[0052] The specific steps include:

[0053] (1) PvSUF and LmSP were integrated into the Saccharomyces cerevisiae genome to construct the donor DNA of X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B. The gene sequence of PvSUF is shown in SEQ ID NO.30, and the gene sequence of LmSP is shown in SEQ ID NO.31.

[0054] 1.1. Using the Saccharomyces cerevisiae genome as a template, PCR amplification was performed using primers X3A-F / X3A-R, TDH1p-F / TDH1p-R, ADH1t-F / ADH1t-R, PGK1p-F / PGK1p-R, GAA1t-F / GAA1t-R and X3B-F / X3B-R to obtain fragments X3, TDH1p, ADH1t, PGK1p, GAA1t and X3B. PCR was used to amplify 500 bp of the upstream and downstream sequences of the genes to be knocked out on the genome.

[0055] X3A-F: aaaggaactttcaccctacagcacc;

[0056] X3A-R: agtgttggctggtgggacatcgtttctaaggccacttttcaatgaaacg;

[0057] TDH1p-F:atgtcccaccagccaacact;

[0058] TDH1p-R: gttggagatggagcttccattttgttttgtgtgtaaatttagtgaagtactgttttt;

[0059] ADH1t-F: tatggttgctggtggtttccactaaaattcttcgccagaggtttggtc;

[0060] ADH1t-R: gctattacgccagctgaattggagc;

[0061] PGK1p-F:gctccaattcagctggcgtaatagcgggccagaaaaaggaagtgtttcc;

[0062] PGK1p-R: gccttattttggatttccattgttttatatttgttgtaaaaagtagataattacttcct;

[0063] GAA1t-F: aatgtcaaaagcctcaaggtgcc; GAA1t-R: ataggttggcttccatgttggctat;

[0064] X3B-F: atagccaacatggaagccaacctatcgaaagatttctcttgcgatttcttcg;

[0065] X3B-R:acagttatatagttatatacacatagacatacatatgttcgc.

[0066] 1.2. Using pUC57-PvSUF as template and PvSUF-F / PvSUF-R as primers, PCR amplification was performed to obtain the fragment PvSUF. Using pUC57-LmSP as template and LmSP-F / LmSP-R as primers, PCR amplification was performed to obtain the fragment LmSP.

[0067] PvSUF-F:atggaagctccatctccaactaagc; PvSUF-R:ttagtggaaaccaccagcaacc;

[0068] LmSP-F:atggaaatccaaaataaggctatgttgattacttac;

[0069] LmSP-R:gcccggggggatccactagttctagattagttttgagtcaagttatcagaggacataacg.

[0070] 1.3. The above sequences were connected in the order of X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B by fusion PCR. The connected fragment is donor DNA.

[0071] (2) Construct the Cas9-sgRNA plasmid of X-3 site.

[0072] 2.1. Using plasmid pRS426-Cas9 as template and SCAS1-F / SCAS1-R; SCAS2-F / SCAS2-R; SCAS3-F / SCAS3(X-3)-R; SCAS4(X-3)-F / SCAS4-R as primers, PCR amplification was performed to obtain fragments SCAS1, SCAS2, SCAS3(X-3), and SCAS4(X-3). The primer sequences used for amplification are:

[0073] SCAS1-F:ggtgagtactcaaccaagtcattctgag; SCAS1-R:gagtagaaacattttgaagctatgcctgatg;

[0074] SCAS2-F:caggcatagcttcaaaatgtttctactcc; SCAS2-R:caatcatctccctatcttcaaacaacgtaagg;

[0075] SCAS3-F:attgtcctcacccttacgttgtttgaag;

[0076] SCAS3(X-3)-R:acatacgagactaatgtgtcgatcatttatctttcactgcggagaag;

[0077] SCAS4(X-3)-F:gacacattagtctcgtatgtgttttagagctagaaatagcaagttaaaataaggc;

[0078] SCAS4-R: cactattctcagaatgacttggttgagtac.

[0079] 2.2. The amplified fragments were connected into circles by Gibson ligation.

[0080] Gibson's reaction system is: vector addition amount (ng) = vector bp number × 0.02, fragment addition amount (ng) = fragment bp number × 0.02, add 2μL buffer, 1μL cloning enzyme, and make up the rest of the system to 10μL with water. Place the reaction system at 37℃ for 30 min. After the reaction is completed, store it at 4℃.

[0081] 2.3. Take 10 μL and transfer it into E. coli JM109 for amplification. Select the correct transformant to extract the plasmid.

[0082] (3) The constructed donor DNA and Cas9 plasmid were transformed into Saccharomyces cerevisiae by lithium acetate transformation method. The gene sequence of DonorSUC2 is shown in SEQ ID NO.1; the gene sequence of Donor MAL12 is shown in SEQ ID NO.2; the gene sequence of DonorMAL32 is shown in SEQ ID NO.3; the gene sequence of Donor IMA1 is shown in SEQ ID NO.4; the gene sequence of DonorIMA2 is shown in SEQ ID NO.5; the gene sequence of Donor IMA3 is shown in SEQ ID NO.6; the gene sequence of DonorIMA4 is shown in SEQ ID NO.7; the gene sequence of Donor IMA5 is shown in SEQ ID NO.8; the gene sequence of DonorMPH2 is shown in SEQ ID NO.9; the gene sequence of Donor MPH3 is shown in SEQ ID NO.10.

[0083] The specific steps are:

[0084] 3.1. Pick a ring of yeast strain from the glycerol tube and streak it onto a YPD solid plate. Incubate it in a 30℃ incubator for 3 days until a single colony grows.

[0085] 3.2. Pick a single yeast colony into 5 mL YPD liquid culture medium, and culture it in a 50 mL shake flask at 30°C and 220 rpm for 17 h to obtain yeast seed liquid.

[0086] 3.3. Take 1 mL of seed solution and place it on ice for 5 minutes, centrifuge at 3500 rpm and 4°C for 5 minutes, and remove the supernatant. Wash the cells twice with pre-cooled sterile water and centrifuge to remove the supernatant.

[0087] 3.4. Wash the cells with 500 μL of pre-cooled 0.1M LiAc and resuspend with 50 μL of 0.1M LiAc for later use. Add 240 μL of 50% PEG 3350 (m / V), 36 μL of 1M LiAc, 25 μL of ssDNA (concentration is 2 mg / mL) and 50 μL of DNA fragments (2 μg of Donor DNA, 1 μg of sgRNA-Cas9 plasmid, add in order, and consider adding PEG first to protect the cells from the adverse effects of high concentration of lithium acetate).

[0088] 3.5. Shake vigorously until completely mixed, incubate at 30℃ for 30min, incubate at 42℃ for 25min, centrifuge at 8000rpm for 2min, and remove the supernatant (if the bacteria do not grow well, add 1mL of YPD and incubate for 1h). Resuspend the bacteria with 500μL of sterile water (use gentle operation to obtain high conversion rate).

[0089] (4) Take 30 μL to 60 μL of the bacteria and spread them on a YNB plate lacking uracil, and culture at 30°C for 3 to 5 days until a single colony grows. The correct single colony is verified by colony PCR and cultured in YPD medium. After 24 hours of culture, the bacterial liquid is streaked on a YPD plate containing 5-fluorolactic acid, and the single colony that grows is the strain that has discarded the Cas9 plasmid. This strain can be used to knock out the next gene. According to the above steps, knock out the MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes in turn.

[0090] Wherein the gene sequence of SUC2-SgRNA is shown as SEQ ID NO.11. The gene sequence of MAL12-SgRNA is shown as SEQ ID NO.12. The gene sequence of MAL32-SgRNA is shown as SEQ ID NO.13. The gene sequence of IMA1-SgRNA is shown as SEQ ID NO.14. The gene sequence of IMA2-SgRNA is shown as SEQ ID NO.15. The gene sequence of IMA3-SgRNA is shown as SEQ ID NO.16. The gene sequence of IMA4-SgRNA is shown as SEQ ID NO.17. The gene sequence of IMA5-SgRNA is shown as SEQ ID NO.18. The gene sequence of MPH2-SgRNA is shown as SEQ ID NO.19. The gene sequence of MPH3-SgRNA is shown as SEQ ID NO.20.

[0091] Experiment 1: Investigate the effects of knocking out the sucrose hydrolysis pathway and introducing the sucrose phosphorolysis pathway on strain growth.

[0092] The strain was transferred to a 250 ml conical flask containing 25 ml of the fermentation liquid and fermented at 30°C and 220 rpm for 3 days. The ethanol and glycerol contents in the fermentation liquid were measured by HPLC.

[0093] High performance liquid chromatography HPLC (Shimadzu LC-20A) was used to detect the concentrations of ethanol and glycerol using a HPX-87H (Bio-Rad) column and a RID-10A detector. 1 mL of the fermentation broth was taken and filtered into a liquid phase vial using a 0.22 μm pore size water filter membrane as the test sample. The mobile phase was 0.5 mM H2SO4, the flow rate was 0.6 mL / min, and the column temperature was set at 45°C.

[0094] Figure 2The results of Experiment 1 are shown in Figure A, which shows the growth curves of strains with different degrees of knockout of sucrose hydrolase genes, where ZQS01 is a strain with only SUC2 knocked out, ZQS02 is a strain with SUC2 and IMA1-5 knocked out, and ZQS03 is a strain with complete knockout of sucrose hydrolase genes in cells. Figure B shows the growth curve of strains introduced with the sucrose phosphorylation pathway, where C800 is the control strain, ZQS16 is a strain introduced with the sucrose phosphorylation pathway, and MAL11 is an endogenous sucrose transporter. It can be seen from the figure that with the introduction of PvSUF and LmSP into strain ZQS03, the strain that was originally unable to utilize sucrose has restored its growth ability.

[0095] Experiment 2: Detection of NADH / NAD in strains + ratio.

[0096] Cells were cultured to OD 600 = 1. The cells were then centrifuged and washed twice with distilled water. Next, 200 μL of lysis buffer and 0.5 mm glass beads were added, mixed and vortexed for 5 minutes to lyse the cells.

[0097] The sample to be tested was centrifuged at 12000 rpm at 4°C for 5 min, and the supernatant was collected as the test sample. + To determine the total amount of NADH, take 20 μL of the test sample into a 96-well shallow plate and add 90 μL of alcohol dehydrogenase working solution. Incubate the plate at 37°C in the dark for 10 min. Then, add 10 μL of colorimetric reagent to each well, mix thoroughly, and incubate again at 37°C in the dark for 10 min. The absorbance is measured at 450 nm.

[0098] To detect NADH, the samples were heated in a 60 °C water bath for 30 min to decompose NAD + Then take 20 μL of sample and follow the same procedure (all samples were tested three times). NADH standard solution was used to prepare standard curve at concentrations of 0.25, 0.5, 1, 2, 4 and 8 μM. + NAD + concentration.

[0099] Figure 3 The results of Experiment 2 show that the ethanol yield of ZQS16 (sucrose phosphorolysis strain) is lower than that of the control strain C800, and the NADH / NAD + This indicates that the Crabtree effect of ZQS16 is alleviated compared with C800.

[0100] Example 2

[0101] Based on the elimination of the Crabtree effect strain in Example 1, the crosstalk between the pentose phosphate pathway and the glycolysis pathway can be cut off by knocking out the gene PGI1, thereby reducing the flux of the glycolysis pathway.

[0102] For detailed principles, see Figure 4 : Knockout of the gene PGI1 disconnects the glycolysis pathway and the pentose phosphate pathway at the beginning, thereby reducing the flux of the glycolysis pathway and eliminating the Crabtree effect.

[0103] By knocking out the gene PGI1, the crosstalk between the pentose phosphate pathway and the glycolysis pathway can be cut off, thereby reducing the flux of the glycolysis pathway. Due to the reduction in EMP flux, the production of NADH in the cytoplasm is far less than that synthesized by the glucose metabolism model, and NADH can be oxidized through the respiratory chain under the action of NADH dehydrogenase. At the same time, since the genes PDC1 / 5 / 6 are not knocked out, there is no acetyl CoA synthesis pathway in the cytoplasm. Therefore, this method can solve the above two problems at the same time.

[0104] The specific method includes the following steps:

[0105] (1) Construction of donor DNA for PGI1A-PGI1B. The gene sequence of PGI1 donor DNA is shown in SEQ ID NO.21.

[0106] 1.1. Using the Saccharomyces cerevisiae genome as a template and primers PGI1A-F / PGI1A-R and PGI1B-F / PGI1B-R as primers, PCR amplification was performed to obtain fragments PGI1A and PGI1B.

[0107] PGI1A-F: gttgaactatgttgtgccagcgtaac; PGI1A-R: ttttaggctggtatcttgattctaaatcgattttg;

[0108] PGI1B-F: atcaagataccagcctaaaaacaaatcgctcttaaatatatacctaaagaacattaaag;

[0109] PGI1B-R: gcacgttaaggacggccact.

[0110] 1.2. The above sequences are connected in the order of PGI1A-PGI1B by fusion PCR, and the connected fragment is the donor DNA.

[0111] (2) Construct the Cas9-sgRNA plasmid of PGI1 site.

[0112] 1.1. Using plasmid pRS426-Cas9 as template, and using SCAS1-F / SCAS1-R; SCAS2-F / SCAS2-R; SCAS3-F / SCAS3(PGI1)-R; SCAS4(PGI1)-F / SCAS4-R as primers, PCR amplification was performed to obtain fragments SCAS1, SCAS2, SCAS3(PGI1), and SCAS4(PGI1). The primer sequences used for amplification are:

[0113] SCAS1-F:ggtgagtactcaaccaagtcattctgag (SEQ ID NO. 22);

[0114] SCAS1-R: gagtagaaacattttgaagctatgcctgatg (SEQ ID NO. 23);

[0115] SCAS2-F: caggcatagcttcaaaatgtttctactcc (SEQ ID NO. 24);

[0116] SCAS2-R:caatcatctccctatcttcaaacaacgtaagg (SEQ ID NO. 25);

[0117] SCAS3-F: attgtcctcacccttacgttgtttgaag (SEQ ID NO. 26);

[0118] SCAS3(PGI1)-R:acacaaggtcttctcaggtagatcatttatctttcactgcggagaag(SEQ IDNO.27);

[0119] SCAS4(PGI1)-F:tacctgagaagaccttgtgtgttttagagctagaaatagcaagttaaaataaggc (SEQ ID NO. 28);

[0120] SCAS4-R: cactattctcagaatgacttggttgagtac (SEQ ID NO. 29).

[0121] 1.2. The amplified fragments were connected into circles by Gibson ligation.

[0122] 1.3. Transfer the gene into E. coli JM109 for amplification and select the correct transformants to extract the plasmid.

[0123] (3) The constructed donor DNA and Cas9-sgRNA plasmids were transferred into Saccharomyces cerevisiae through the lithium acetate transformation method.

[0124] (4) Spread on a YNB plate lacking uracil and culture at 30°C for 3 to 5 days until a single colony grows. Verify the correct single colony by colony PCR and culture it in YPD medium. After 24 hours of culture, streak the bacterial liquid on a YPD plate containing 5-fluorolactic acid. The single colony that grows is the strain that has discarded the Cas9 plasmid.

[0125] The main manifestation of the Crabtree effect is the accumulation of ethanol. The more severe the Crabtree effect of the strain, the more ethanol is accumulated. In addition, other manifestations of the Crabtree effect are the accumulation of glycerol and NADH / NAD + ratio.

[0126] Experiment 3: Detect the accumulation of ethanol and glycerol by the strain.

[0127] Strains with genotypes of suc2Δ, ima1Δ, ima2Δ, ima3Δ, ima4Δ, ima5Δ, mph2Δ, mph3Δ, mal12Δ, mal32Δ, X-3::(TDH1p-PvSUF-ADH1t)+(PGK1p-LmSP-Ter22), and pgi1Δ were activated on YPD plates, and single clones were inoculated into YPD liquid medium and cultured at 30°C, 220 rpm for 24 h until the logarithmic growth phase. Three clones of each strain were selected as parallel samples for the experiment. The seed solution in the logarithmic growth phase was inoculated according to the initial OD 600 The mixture was transferred to 25 mL of YPD medium at 0.02 for fermentation. 1 mL of samples were taken at 12, 24, 36, 48, 60, 72, 84, and 96 h of fermentation, and filtered into a liquid phase vial with a 0.22 μm pore water filter as the test sample. The mobile phase was 0.5 mM H2SO4, the flow rate was 0.6 mL / min, and the column temperature was set to 45 °C. The content of ethanol and glycerol was detected in a differential detector.

[0128] Figure 5 The results of Experiment 3 are shown in Figure A, which shows the ethanol accumulation of the PGI1 knockout strain and the non-PGI1 knockout strain, and Figure B shows the glycerol accumulation of the PGI1 knockout strain and the non-PGI1 knockout strain. It can be seen from the figure that the constructed Crabtree-negative bacteria have no ethanol accumulation and a small amount of glycerol accumulation. Among them, ZQS16 and ZQS17 are control strains, sucrose phosphorolysis strains without PGI1 knockout, and ZQS18 and ZQS19 are strains with PGI1 knockout.

[0129] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A method for eliminating the Crabtree effect of Saccharomyces cerevisiae by sucrose phosphorolysis, characterized in that: The method comprises the following steps: S1. Use CRISPR / Cas9 system to gradually target and knock out SUC2, MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes in Saccharomyces cerevisiae; S2. The introduction of exogenous genes PvSUF and LmSP enables Saccharomyces cerevisiae to transport sucrose into the cell and phosphorylate it into fructose and 1-phosphate-glucose.

2. The method according to claim 1, characterized in that The S1 includes: S1-1, using the Saccharomyces cerevisiae genome as a template, amplify the upstream and downstream sequences of the SUC2 gene on the genome by PCR, 500 bp each, and connect the two sequences to form SUC2 donor DNA by fusion PCR; S1-2. Design SUC2-sgRNA according to the SUC2 gene, and construct a Cas9 plasmid containing the SUC2-sgRNA; S1-3, transferring the SUC2 donor DNA and the Cas9 plasmid into Saccharomyces cerevisiae by lithium acetate transformation method to obtain Saccharomyces cerevisiae with SUC2 gene knocked out; S1-4, cycle the operations from S1-1 to S1-3 to knock out the MAL12, MAL32, MPH2, MPH3, IMA1, IMA2, IMA3, IMA4 and IMA5 genes respectively.

3. The method according to claim 2, characterized in that The gene sequence of the SUC2 donor DNA is shown in SEQ ID NO.1; The gene sequence of MAL12 donor DNA is shown in SEQ ID NO.2; The gene sequence of MAL32 donor DNA is shown in SEQ ID NO. 3; The gene sequence of MPH2 donor DNA is shown in SEQ ID NO.4; The gene sequence of MPH3 donor DNA is shown in SEQ ID NO.5; The gene sequence of IMA1 donor DNA is shown in SEQ ID NO.6; The gene sequence of IMA2 donor DNA is shown in SEQ ID NO.7; The gene sequence of IMA3 donor DNA is shown in SEQ ID NO.8; The gene sequence of IMA4 donor DNA is shown in SEQ ID NO.9; The gene sequence of IMA5 donor DNA is shown in SEQ ID NO.

10.

4. The method according to claim 2, characterized in that: The SUC2-sgRNA gene sequence is shown in SEQ ID NO.11; The MAL12-sgRNA gene sequence is shown in SEQ ID NO.12; The MAL32-sgRNA gene sequence is shown in SEQ ID NO.13; The MPH2-sgRNA gene sequence is shown in SEQ ID NO.14; The MPH3-sgRNA gene sequence is shown in SEQ ID NO.15; The IMA1-sgRNA gene sequence is shown in SEQ ID NO.16; The IMA2-sgRNA gene sequence is shown in SEQ ID NO. 17; The IMA3-sgRNA gene sequence is shown in SEQ ID NO.18; The IMA4-sgRNA gene sequence is shown in SEQ ID NO. 19; The IMA5-sgRNA gene sequence is shown in SEQ ID NO.

20.

5. The method according to claim 1, characterized in that The S2 includes: S2-1, using the Saccharomyces cerevisiae genome as a template, amplifying the X3A fragment, TDH1p fragment, ADH1t fragment, PGK1p fragment, GAA1t fragment, X3B fragment, PvSUF fragment and LmSP fragment respectively; connecting into donor DNA in the order of X3A-TDH1p-PvSUF-ADH1t-PGK1p-LmSP-GAA1t-X3B; S2-2, using plasmid pRS426-Cas9 as a template, PCR amplification was performed to obtain the SCAS1 fragment, SCAS2 fragment, SCAS3 (X-3) fragment, and SCAS4 (X-4) fragment; the fragments were connected into a circle by Gibson ligation, and then transferred into Escherichia coli for amplification to obtain the Cas9-sgRNA plasmid of the X-3 site; S2-3, the donor DNA and the Cas9-sgRNA plasmid of the X-3 site are transformed into Saccharomyces cerevisiae by lithium acetate transformation method.

6. The method according to claim 5, characterized in that The gene sequence of PvSUF is shown in SEQ ID NO.30, and the gene sequence of LmSP is shown in SEQ ID NO.

31.

7. The method according to any one of claims 1 to 6, characterized in that The method further comprises: S3. Knock out the PGI1 gene to cut off the crosstalk between the pentose phosphate pathway and the glycolysis pathway, thereby reducing the flux of the glycolysis pathway.

8. The method according to claim 6, characterized in that The S3 includes: S3-1, using the Saccharomyces cerevisiae genome as a template, amplify the upstream and downstream sequences of the PGI1 gene on the genome by PCR, 500 bp each, and connect the two sequences to form PGI1 donor DNA by fusion PCR; S3-2. Design PGI1-sgRNA according to the PGI1 gene, and construct a Cas9 plasmid containing the PGI1-sgRNA; S3-3. The PGI1 donor DNA and the Cas9 plasmid are transformed into Saccharomyces cerevisiae by the lithium acetate transformation method to obtain Saccharomyces cerevisiae in which the PGI1 gene is knocked out.

9. The method according to claim 7, characterized in that: The gene sequence of PGI1 donor DNA is shown as SEQ ID NO.21; the gene sequence of PGI1-sgRNA is shown as SEQ ID NO.22 to SEQ ID NO.29.

Images