Application of Msa-miR398a-3p in regulation and control of plant drought resistance

Abstract

The invention discloses application of Msa-miR398a-3p in regulation and control of drought resistance of plants, and is characterized in that a precursor sequence of the Msa-miR398a-3p is as shown in SEQ ID No. 1, and a mature sequence of the Msa-miR398a-3p is as shown in SEQ ID No. 2; the gene or an expression substance for regulating and controlling the gene or a substance for regulating and controlling the activity or content of protein can be applied to the aspect of regulating and controlling the drought resistance of plants, the drought resistance of the plants can be improved by silently expressing Msa-miR398a-3p, and the gene has a positive effect on accelerating and improving the variety of medicago sativa.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of Msa-miR398a-3p in regulating plant drought resistance. Background Art

[0002] Alfalfa (Medicago sativa L.) is the most widely planted leguminous forage crop in the world. It has the advantages of high biological yield, good palatability, and strong adaptability, and is widely used in animal feed. In recent years, with the continuous expansion of my country's demand for livestock products, the demand for forage has also increased significantly. In 2021, my country's imports of alfalfa hay have reached 1.78 million tons, which will cost hundreds of millions of dollars. Therefore, improving the yield and quality of alfalfa is a key issue to ensure the healthy development of my country's animal husbandry. my country has a history of more than 2,000 years of cultivating alfalfa, and its cultivation areas are mainly distributed in arid and semi-arid areas. Drought is the main threat to alfalfa production, which not only seriously affects the yield and quality of alfalfa, but also causes huge economic losses, and also limits the scale and industrialization of animal husbandry. Therefore, it is particularly important to deeply explore the excellent germplasm resources of alfalfa and cultivate new drought-resistant alfalfa varieties through transgenic methods.

[0003] miRNAs were first discovered in nematodes in 1993, when they were considered small transient RNAs (stRNAs). In 2001, miRNAs were formally named and considered a class of RNAs with regulatory functions. Plant miRNAs were discovered 10 years after animal miRNAs were discovered. As of 2014, 7385 mature miRNAs and 6150 precursor miRNAs have been identified in 72 plant species. miRNAs are single-stranded noncoding RNAs, usually 20-24 nucleotides in size, that act as regulatory factors in a wide range of organisms. They affect many biological processes, including the development of roots, stems, leaves, and floral organs. Increasing evidence suggests that miRNAs play an important role in plant responses to biotic and abiotic stresses. Recent studies have also reported a key role for miRNAs in plant adaptation to drought stress, making miRNAs the most promising candidate for molecular breeding with the goal of enhancing crop drought resistance. Using global expression profiling, many drought-responsive miRNAs have been identified in Arabidopsis, common bean, cowpea, rice, tobacco, and soybean.

[0004] miR398 is a highly conserved miRNA in plants. It was first discovered in the sequence analysis of Arabidopsis stress-treated SmallRNA libraries. As one of the earliest miRNAs cloned from Arabidopsis and rice, the research on its transcriptional regulation mechanism, biological function and environmental stress response has been widely carried out. miR398 is highly conserved in Arabidopsis and rice, suggesting that it may play a role in a variety of stress responses. Studies have found that miR398 shows different responses to drought stress in different species. For example, miR398 is downregulated by drought stress in tomato and cotton, upregulated in wild emmer wheat, but unchanged in switchgrass. However, there is no report on how alfalfa miR398 plays a role in the process of drought stress. In view of the role of miR398 in abiotic stress in plants, systematic identification and cloning of alfalfa miR398 family members are of great significance for the study of plant stress resistance mechanism and production application. Summary of the invention

[0005] In order to solve the above technical problems, the present invention designs the application of Msa-miR398a-3p in regulating plant drought resistance.

[0006] In order to achieve the above technical effects, the present invention is implemented by the following technical solutions: application of Msa-miR398a-3p in regulating plant drought resistance, the precursor sequence of the Msa-miR398a-3p is shown in SEQ ID No.1, and the mature sequence of the Msa-miR398a-3p is shown in SEQ ID No.2;

[0007] SEQ ID No.1:TCTCAGAGGAGTGACACTGAGAACACAAGATTGATTAATCATATAATGTATTTGGTTGTTACTAGTTGATTTTGTGTTCTCAGGTCACCCCTTTGAGT;

[0008] SEQ ID No. 2: TGTGTTCTCAGGTCACCCCTT.

[0009] Furthermore, when Msa-miR398a-3p is amplified, STTM-miR398a-3p-PF and STTM-miR398a-3p-PR are included; wherein the nucleotide sequence of STTM-miR398a-3p-PF is shown in SEQ ID No.3; and the nucleotide sequence of STTM-miR398a-3p-PR is shown in SEQ ID No.4.

[0010] SEQ ID No.3:

[0011] cagtGGTCTCacaacaaggggtgacctactgagaacacagttgttgttgttatggt;

[0012] SEQ ID No.4:

[0013] cagtGGTCTCatacatgtgttctcagtaggtcaccccttattcttcttctttaga.

[0014] Furthermore, the above-mentioned Msa-miR398a-3p is used in regulating plant drought resistance, silencing the expression of Msa-miR398a-3p and improving plant drought resistance.

[0015] Furthermore, the above-mentioned Msa-miR398a-3p is used in regulating plant drought resistance. The STTM technology is used to construct a recombinant vector for silencing the expression of Msa-miR398a-3p, and the recombinant vector is transferred into plants to improve the drought resistance of the plants.

[0016] Furthermore, the STTM technology is used to construct a recombinant vector for silently expressing Msa-miR398a-3p, specifically including digesting the target fragment STTM-miR398a-3p and the expression vector pBWA(V)HS with BasI and Eco31I at 37°C and then connecting the digestion products to form a recombinant vector for silently expressing Msa-miR398a-3p.

[0017] Furthermore, the above-mentioned Msa-miR398a-3p is used in regulating plant drought resistance, and the expression vector is pBWA(V)HS.

[0018] Furthermore, the above-mentioned Msa-miR398a-3p is used to regulate plant drought resistance, and Msa-miR398a-3p is introduced into alfalfa to obtain transgenic plants.

[0019] Furthermore, the above-mentioned Msa-miR398a-3p is used in regulating plant drought resistance, and the Msa-miR398a-3p improves plant drought resistance by increasing the activity of related antioxidant enzymes.

[0020] Furthermore, in the application of the above-mentioned Msa-miR398a-3p in regulating plant drought resistance, the plant selected is alfalfa.

[0021] The beneficial effects of the present invention are:

[0022] The present invention discloses the application of Msa-miR398a-3p in regulating plant drought resistance. The drought resistance of plants can be improved by silencing the expression of Msa-miR398a-3p, which has a positive effect on accelerating the improvement of alfalfa varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0024] Figure 1 The diagrams are the conservation analysis, secondary structure and phylogenetic analysis of the alfalfa miR398 family of the present invention;

[0025] Figure 2 This is the structure diagram of alfalfa STTM398a-3p of the present invention;

[0026] Figure 3 Amplification gel image of the fragment STTM398a-3p of the present invention;

[0027] Figure 4 This is the restriction enzyme verification and bacterial liquid PCR detection diagram of the pBWA(V)HS-STTM-398a-3p plasmid of the present invention;

[0028] Figure 5 This is a gel image of the amplification of the amiR398a-3p precursor fragment of the present invention;

[0029] Figure 6 The PCR detection, double restriction enzyme digestion and Agrobacterium liquid PCR detection diagram of the target fragment in the expression vector pCPBI121-amiR398a-3p of the present invention;

[0030] Figure 7 This is a diagram showing the acquisition of the Msa-miR398a-3p transgenic plant of the present invention;

[0031] Figure 8 This is an identification diagram of positive plants of the Msa-miR398a-3p overexpressing transgenic plants of the present invention;

[0032] Fig. 9 This is a diagram showing the identification results of positive plants of the Msa-miR398a-3p silenced transgenic plants of the present invention;

[0033] Fig.10 This is a diagram showing the hardening and transplanting of the transgenic alfalfa plants of the present invention;

[0034] Fig.11This is an analysis diagram of the expression level of the Msa-miR398a-3p transgenic plant of the present invention;

[0035] Fig.12 The phenotypes of WT, Msa-miR398a-3p silenced expression and overexpressed plants after 7 days of drought stress treatment simulated by 15% PEG6000 of the present invention are shown in the figure;

[0036] Fig.13 This is an analysis chart of SOD, POD and CAT activities, MDA and H2O2 content in WT, Msa-miR398a-3p silenced expression and overexpression plants under drought stress in the present invention. DETAILED DESCRIPTION

[0037] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1

[0039] (1) The technical problem to be solved in this embodiment is how Msa-miR398a-3p improves the drought resistance of alfalfa, and the following steps are adopted:

[0040] 1) Identify and clone Msa-miR398a-3p in alfalfa and perform bioinformatics analysis on it;

[0041] 2) Silencing the expression of miR398a-3p in alfalfa using STTM technology and conducting drought resistance analysis;

[0042] 3) Overexpress miR398a-3p in alfalfa using artificial miRNA technology and analyze drought resistance;

[0043] 1. Cloning and bioinformatics analysis of Msa-miR398a-3p in alfalfa

[0044] 1. Methods:

[0045] The secondary structures of miR398 family members in alfalfa were predicted by the online tool RNAfold Web Server (http: / / ma.tbi.univie.ac.at / / cgi-bin / RNAWebsuite / RNAfold.cgi). The current limit for the calculation of the distribution function was 7500 nt, and the limit for the minimum free energy prediction was 10000 nt. The parameters were set to default. The phylogenetic tree was constructed using MEGA7.0 software, using the neighbor-joining (NJ) method, and the bootstrap method was used for 1000 replicates. The sequence of Ms-miR398s was multiple aligned using DNAMAN8.0 software. The miR398 sequence was visualized using the online software WebLogo (https: / / weblogo.berkeley.edu / logo.cgi).

[0046] 2. Construction and genetic transformation of Msa-miR398a-3p expression vector

[0047] 1. Methods:

[0048] 1.1 Construction of miR398a-3p STTM silencing expression vector

[0049] 1.1.1 Primer design and target fragment amplification

[0050] First, the mature sequence of miR398a-3p was found in miRBase as "uguguucucaggucaccccuu", and then the "u" in the sequence was changed to "t" to "tgtgttctcaggtcacccctt" to design primers. Referring to the stem-loop structure of STTM-miR398a-3p, the forward primer is the part containing the 24 bases of the spacer at the 3' end, and the reverse primer is the sequence that contains the reverse complement of the remaining part of the spacer at the 5' end. The protective base "cagt" and the restriction sites of BasI and Eco31I were added before the forward and reverse primers. The primer sequences are shown in Table 1:

[0051] Table 1

[0052]

[0053] Using the 48nt spacer sequence synthesized by Wuhan Boyuan Biological Company as a template, specific primers were used to amplify the target fragment containing two restriction sites, and the amplified fragment was recovered by gel. The system required for amplifying the target fragment is shown in Table 2, and the amplification reaction conditions are: 94℃5min; 94℃30s, 50℃45s, 72℃10s, 30 cycles; 72℃10min, 16℃30min.

[0054] Table 2

[0055]

[0056] 1.1.2 Construction of STTM-miR398a-3p expression vector

[0057] 1.1.2.1 Enzyme digestion reaction

[0058] The target fragment STTM-miR398a-3p and the expression vector pBWA(V)HS were digested with BasI and Eco31I at 37°C for 1 h. The digestion system is shown in Table 3:

[0059] Table 3

[0060]

[0061] 1.1.2.2 Ligation of enzyme digestion products

[0062] The vector digestion product and the recovery fragment digestion product were directly placed in a system for ligation reaction using T4 DNA ligase at 37°C for 1 hour. The reaction system is shown in Table 4.

[0063] Table 4

[0064]

[0065] 1.1.2.3 Transformation of ligation products into DH5α competent cells

[0066] The recombinant vector was transformed into competent E. coli. The mixed bacterial solution was spotted on LB solid medium containing 50 μg / mL Kan with a pipette and a single colony was picked for bacterial solution PCR. The primers were designed as Target-F: ttcatttggagagaacacgggggac; Target-R: caagaccggcaacaggattcaatc, and the target band was expected to be about 244 bp. The amplification system is shown in Table 5. The reaction conditions were 94℃5min; 94℃30s, 50℃45s, 72℃10s, 30 cycles; 72℃10min, 16℃30min.

[0067] Table 5

[0068]

[0069] 1.1.2.4 Bacterial liquid sequencing analysis and enzyme digestion verification

[0070] The bacterial solution that was positive in the PCR test was sent to Boyuan Biological Co., Ltd. for sequencing and identification. The extracted plasmid was digested with Eco32I for verification. The enzyme digestion system is shown in Table 6.

[0071] Table 6

[0072]

[0073] 1.1.3 Transformation of Agrobacterium with recombinant plasmid pBWA(V)HS-STTM-398a-3p

[0074] Take a tube of Agrobacterium GV3101 competent cells prepared in advance and add 6.5μL of recombinant plasmid to mix. Then treat in an ice bath for 30min and immediately heat shock at 37℃ for 5min, then add a small amount of liquid LB and shake at 28℃ 200r / min for 4h and collect the bacteria by centrifugation. Add 200μL of liquid LB and mix well, draw the bacterial solution and spot it on a solid LB plate (containing 50μg / mL of Kan and Rif), culture at 28℃ in the dark, pick a single colony and perform bacterial solution PCR.

[0075] 1.2 Construction of miR398a-3p overexpression vector

[0076] 1.2.1 Primer design for miR398a-3p

[0077] The mature sequence of alfalfa miR398a-3p was searched and downloaded from the miRNA database miRBase; the required primers were designed on the WMD3 website, and the primer sequences are shown in Table 7.

[0078] Table 7

[0079]

[0080] 1.2.2 Amplification of miR398a-3p precursor fragment

[0081] Using the pRS300 plasmid as a template, different combinations of primers I, II, III, IV, A and B in Table 7 (see Table 8) were used to amplify the a fragment of the 5' arm, the b fragment of the central loop and the c fragment of the 3' arm, respectively. The amplification reaction conditions were: 95℃2min, 95℃30s, 52℃30s, 72℃40s, 35 cycles; 72℃ extension for 10min. Then, the mixture of a, b and c fragments was used as a template, and universal primers A and B were used to amplify the d fragment. The reaction conditions were 95℃2min; 95℃30s, 64℃30s, 72℃1.5min, 35 cycles; 72℃ extension for 7min.

[0082] Table 8

[0083]

[0084] 1.2.3 Construction of cloning vector

[0085] The d fragment was connected to the cloning vector pMD19-T to construct a recombinant plasmid, and then the recombinant vector was transformed into Escherichia coli competent cells using the heat shock method.

[0086] (1) The ligation reaction system of fragment d and pMD19-T is shown in Table 9:

[0087] Table 9

[0088]

[0089] (2) In the above system, n(vector DNA):n(d fragment)=1:2-10; react at 16°C for 30 min;

[0090] (3) Take 1 tube of 100 μL EPI300 competent cells from the -80°C freezer, quickly insert it into ice, and leave it for 5 min to thaw;

[0091] (4) The full amount of the recombinant vector (10 μL) was added to the EPI300 competent cells and mixed well. The cells were placed on ice for 30 min, then in a 42°C water bath for 45 s, and then placed on ice for 1 min.

[0092] (5) Add 890 μL LB liquid medium and incubate at 37°C with shaking at 260 rpm for 1 h;

[0093] (6) Centrifuge at 6000 rpm for 5 min, remove the excess supernatant, and take 100 μL of the supernatant and the bacterial mass and gently pipette to mix. Then, apply an appropriate amount onto LB solid medium containing Amp (150 mg / mL), X-Gal (20 mg / mL), and IPTG (50 mg / mL), and culture at 37°C in the dark overnight.

[0094] (7) Screening for blue-white spots: Pick a single white colony with smooth and neat edges and inoculate it into 5 mL of LB liquid culture medium (Amp 150 mg mL-1), and culture it at 37°C and 260 rpm for 6 to 8 h.

[0095] (8) Take 1.5 μL of the above bacterial solution as a PCR amplification template, and the amplification conditions and reaction system are the same as those for amplifying fragment d;

[0096] The screened positive clone bacterial solution was sent to a biological company for sequencing, and the recombinant plasmid identical to fragment d was named pMD19T-amiR398a-3p.

[0097] 1.2.4 Construction of expression vector

[0098] 1.2.4.1 Plasmid double restriction digestion

[0099] The stored pCPBI121 bacterial solution and the correctly sequenced bacterial solution were used for plasmid extraction, and the plasmid was double-digested with KpnⅠ and SacⅠ. The enzyme digestion system is shown in Table 10:

[0100] Table 10

[0101]

[0102] 1.2.4.2 Ligation of enzyme digestion products

[0103] The restriction digestion and ligation products were transferred into competent E. coli cells and the positive colonies were picked and sent to a sequencing company for sequencing. The plasmid with the correct sequencing was named pCPBI121-amiR398a-3p. The ligation system of the restriction digestion products is shown in Table 11.

[0104] Table 11

[0105]

[0106] 1.2.4.3 Transformation of Agrobacterium with recombinant plasmid pCPBI121-amiR398a-3p

[0107] (1) Take 100 μL of Agrobacterium competent cells and add 2 μL of pCPBI121-amiR398a-3p recombinant expression vector;

[0108] (2) Quickly freeze in liquid nitrogen for 5 min and then thaw in a 37°C water bath for 5 min;

[0109] (3) Add 1.5 mL of LB liquid medium and culture at 28°C, 200 rpm, for 4 h;

[0110] (4) Centrifuge the bacterial solution at 5000 r / min for 1 min and remove the excess supernatant;

[0111] (5) 200 μL of liquid suspended cells were spread on LB solid plate and cultured at 28°C for 2 days;

[0112] (6) Single colonies were selected for PCR verification and double enzyme digestion verification. After screening the positive colonies, they were sent to the company for sequencing. After the target gene sequence was accurately determined, it was named GV3101-amiR398a-3p and stored at -80°C for future use.

[0113] 1.3 Genetic transformation of alfalfa

[0114] The genetic transformation of alfalfa was carried out using the Agrobacterium-mediated method. The specific operation process refers to the method of Zhao Yaodong.

[0115] 1.4 Identification of transgenic plants

[0116] According to the unique neomycin phosphotransferase NPTⅡ gene on the pCPBI121 vector, the transgenic plants of alfalfa overexpressing mi398a-3p were detected, and the expected amplified fragment was 676bp. The transgenic plants of alfalfa silencing expression vector STTM-miR398a-3p were detected using specific primers designed for the vector, and the expected amplified fragment was 244bp. The specific primer design is shown in Table 12.

[0117] Table 12

[0118]

[0119] The genomic DNA of alfalfa overexpression plants, silent expression plants and non-transgenic plants were extracted by CATB method, and the plasmid was used as a positive control and used as a template for PCR detection. The PCR reaction system is shown in Table 2-15. The reaction conditions are 94℃5min; 94℃30s, 50℃45s, 72℃20s, 30 cycles; 72℃10min, 16℃30min storage. After the reaction, it was detected by 1% agarose gel electrophoresis and photographed with a gel imager.

[0120] Table 13

[0121]

[0122] 1.5 Hardening and transplanting of transgenic plants

[0123] The transgenic alfalfa tissue culture seedlings were placed in an incubator for seedling hardening. First, loosen the bottle cap and add an appropriate amount of sterile water to the tissue culture seedlings. After 3 days, completely open the bottle cap; after about 5 days, take out the plants from the culture bottle and rinse them with clean water. First, move them to the nutrient solution for 20 days and then move them to a small flower pot with a ratio of nutrient soil to vermiculite of 3:1 for cultivation.

[0124] 1.6 Determination of relative expression of miR398a-3p in alfalfa

[0125] After the transgenic alfalfa plants grew to 60 days, the leaves of the transgenic and wild-type alfalfa plants were collected and quickly frozen in liquid nitrogen. The total RNA of the plants was extracted using the UNIQ-10 column Trizol total RNA extraction kit from Shanghai Shenggong Biotechnology Co., Ltd. The cDNA used for the expression analysis of miR398a-3p was synthesized by reverse transcription using the Servucebio miRNA first-strand cDNA synthesis kit (tailing method), and U6 was used as an internal reference.

[0126] 1.7 Plant treatment and determination of related indicators

[0127] After hardening and transplanting, transgenic and non-transgenic alfalfa plants were cultured in an incubator with a light intensity of 6000lx, a temperature of 25±1℃, and 12h light and 12h dark. Water was added every 2d by weighing method, and the plants were treated after 60d of culture. There were two treatments in this experiment, namely distilled water (CK) and 15% PEG, and three replicates were set for each treatment. The drought treatment group was irrigated with 100mL 15% PEG-6000 to simulate stress treatment, and the normal watering treatment group was added with an equal amount of distilled water. The treatment was continued for 7 days. On the 8th day, the leaves of alfalfa in the control and treatment groups were collected and rinsed with distilled water, then dried with filter paper and quickly frozen with liquid nitrogen, and stored in a refrigerator at -80℃ for the determination of relevant indicators.

[0128] Referring to the method of Lapidot et al., plant height, root length, stem thickness and biomass were measured before sampling, where the length was measured with a tape measure and the diameter was measured with a vernier caliper. The above-ground part is the part above the cotyledon, and the below-ground part is the part below the cotyledon. The above-ground part was sterilized at 105°C for 30 minutes, dried at 80°C to constant weight, and then weighed as dry weight. The fresh weight was directly measured. Enzyme solution preparation: 0.5g of pre-weighed alfalfa leaves were placed in a mortar, and 5mL of PBS (pH=7.8) was added to the pre-cooled mortar using a pipette, ground in an ice bath, and the homogenate was transferred to a new centrifuge tube. Centrifuged at low temperature for 20 minutes (10000×g), and the supernatant was the extracted enzyme solution, which was stored at 0-4°C for testing. The determination of SOD was based on the NBT photochemical reduction method of Chahid et al.; the determination of CAT and POD activities was based on the method of Yang et al., with slight modifications; the determination of MDA (malondialdehyde) content was based on the method of Heath et al., with slight modifications; the H2O2 content was determined by the KI method, with reference to the method of Willekens et al. All physiological indexes were measured three times.

[0129] 1.8 Statistical methods

[0130] The data obtained from the experiment were analyzed using SPSS20.0 statistical software (IBM Corporation, Armonk, NY, USA). The significance analysis was performed using one-way analysis of variance (ANOVA). The differences were considered significant when P < 0.05 in the Duncan's test. The results were expressed as mean ± standard deviation (Mean ± SD).

[0131] 3. Results:

[0132] 1. Conservative analysis, secondary structure and phylogenetic analysis of the alfalfa miR398 family, as follows Figure 1 As shown:

[0133] Figure 1In the figure, A is the conservation analysis, a is the conservation analysis of the precursor sequence of miR398 in alfalfa, and b is the conservation analysis of the mature sequence of miR398 in alfalfa; Figure B is the secondary structure analysis; Figure C is the systematic evolution analysis of the mature miR398; Figure D is the systematic evolution analysis of the precursor miR398. Further analysis is as follows:

[0134] like Figure 1 As shown in A, the three members of the alfalfa miR398 family contain 20-22 bases, of which miR398a-3p and miR398b have a sequence similarity of up to 90%, with only 2 bases not conserved; while miR398a-5p has only 50% sequence similarity with miR398a-3p and miR398b, and its miR398a-5p is less conserved, indicating that alfalfa miR398a-5p may have significant functional differences. We identified the precursor sequences of two alfalfa miR398 members, miR398a and miR398b, with lengths of 97n and 86nt, respectively.

[0135] The secondary structure prediction results are as follows Figure 1 As shown in B, both members can form a typical hairpin structure, and the minimum folding free energy is -48.30 kcal / mol and -33.10 kcal / mol, respectively, both less than -18.00 kcal / mol, which is consistent with the characteristics of miRNA. We searched the miRbase database for 52 mature sequences of miR398 family members from 11 species for cluster analysis. The results showed that -3p and -5p of miR398 differentiated into two branches. When there was only one mature sequence, most of them were located in the -3p branch ( Figure 1 (as shown in C).

[0136] Both Ms-miR398a-3p and Ms-miR398b are located in the -3p branch; in addition, the phylogenetic tree showed that Ms-miR398a-3p was most closely related to Vvi-miR398a, and Ms-miR398a-5p was most closely related to Mtr-miR398a-5p, followed by ath-miR398b-5p and ath-miR398c-5p. Precursor phylogenetic analysis showed that Ms-miR398a and Ms-miR398b were most closely related to Mtr-miR398a and Mtr-miR398b, respectively (e.g. Figure 1 (shown in D).

[0137] 2. Analysis of the construction results of Msa-miR398a-3p expression vector;

[0138] 2.1 Analysis of the construction results of Msa-miR398a-3p silencing expression vector;

[0139] 2.1.1 Amplification of target fragment STTM398a-3p;

[0140] The structure of STTM-Msa-miR398a-3p is shown in Figure 2 Using the 48nt fixed sequence as a template, PCR amplification was performed using the forward and reverse primers of STTM-miR398a-3p, and the results of 1% agarose gel electrophoresis were shown in Figure 3 As shown, the size of the STTM398a-3p fragment was 96 bp, which was in line with expectations. Figure 3 In the figure, M represents DNA Marker DL6000; No. 1 is the target band.

[0141] 2.1.2 Bacterial liquid PCR verification and enzyme digestion verification

[0142] The target fragment and expression vector were digested with BasI and Eco31I restriction endonucleases respectively, and the two digested fragments were connected and the ligated products were verified by bacterial liquid PCR. The bacterial liquid detection results were as follows: Figure 4 As shown in B, the target band is a fragment of 244 bp in size, which is consistent with the expected target. The plasmid was first extracted from the bacterial solution with correct sequencing and then verified by Eco32I single enzyme digestion. The results after agarose gel electrophoresis are shown in Figure 4 As shown in A, after Eco32I single enzyme digestion, four electrophoresis bands with sizes of 697, 1134, 2691 and 5324 bp appeared in the plasmid, which met the expected target. The vector was named pBWA(V)HS-STTM-miR398a-3p. Figure 4 In the figure, A represents plasmid restriction enzyme verification, M represents DNA Marker DL6000, B represents bacterial solution PCR detection, and 1 and 2 represent restriction enzyme digestion results.

[0143] 2.2 Analysis of the results of Msa-miR398a-3p overexpression vector construction

[0144] 2.2.1 Amplification of amiR398a-3p precursor fragment

[0145] pRS300 was used as a template and the nested PCR technique was used to obtain the a, b, and c fragments of the alfalfa miR398a-3p precursor structure ( Figure 5 A). Using a+b+c as template, amplify the target fragment d ( Figure 5 B). Figure 5 In the figure, A and B are the electrophoresis diagrams of fragments a, b, c and d, respectively; M represents DNA marker DL2000; a, b, c, d are fragments a, b, c and d, respectively.

[0146] 2.2.2 Construction of amiR398a-3p cloning vector

[0147] The fragment d was connected to the pMD19-T vector, and a single white colony was selected by blue-white screening and shaken. The PCR test results showed that except for samples 3 and 7, no 701 bp fragment was amplified, and the rest of the bacterial liquids had a band at 701 bp (such as Figure 6 The bacterial solution with a 701bp band was sent to the company for sequencing. The results showed that these bacterial solutions all contained the target gene sequence and no base mutation occurred, indicating that the miRNA / miRNA* sequence of the Arabidopsis miR319a precursor fragment had been successfully replaced with the target fragment. The recombinant plasmid was named pMD19T-amiR398a-3p.

[0148] 2.2.3 Construction of expression vector

[0149] The bacterial solution with the correct sequence was double-digested with the expression vector pCPBI121, and the small fragment of the target gene and the large fragment of the expression vector were recovered and connected with T4 ligase (such as Figure 6 (shown in B).

[0150] 2.2.4 Transformation of Agrobacterium with recombinant vector

[0151] The recombinant expression vector pCPBI121-amiR398a-3p was transformed into Agrobacterium GV3101, and the bacterial solution was tested by PCR to amplify the target band of 508 bp (such as Figure 6 (as shown in C), demonstrating that the recombinant expression vector pCPB121-amiR398a-3p was successfully transformed into Agrobacterium.

[0152] The above mentioned Figure 6 A is the PCR detection of fragment d, M represents DNA marker DL 2000; 1-8 represents the sample number of bacterial solution; B is the double enzyme digestion electrophoresis diagram, 1-5 represents the digestion products; C is the bacterial solution PCR of Agrobacterium transformation product, 1-3 represents the transformation product.

[0153] 2.2 Genetic transformation of alfalfa

[0154] The main process of alfalfa genetic transformation is as follows: first, the alfalfa seeds are soaked in 75% ethanol for 45 seconds, washed several times with sterile water, and then soaked in 0.1% HgCl2 for 5 minutes for disinfection. The disinfected alfalfa seeds are inoculated on 1 / 2MS medium and cultured for 7 days. Figure 7A is a 7-day-old wild-type alfalfa plant. Then cut the hypocotyl of about 1 cm long from the sterile wild-type alfalfa seedling, infect it with Agrobacterium liquid with an OD600 of about 0.6 for 10 minutes, place it in a modified SH medium and co-culture it for 3 days, then transfer it to a callus induction medium for culture, subculture it every 10 days of growth, subculture it twice during the callus induction stage, and then transfer it to MSO differentiation medium to select resistant buds, subculture it every 20 days. After 7-8 weeks, a small green bud (such as Figure 7 When the buds grow to 2-3 cm (as shown in B), Figure 7 C in the middle) and placed in 1 / 2MS medium for rooting culture (as shown in Figure 7 Then, the rooted transformed seedlings were selected for further hardening and transplanting (as shown in D). Figure 7 As shown in E and F). Figure 7 In the figure, A is alfalfa sterile seedling; Figure 7 B and C are resistant buds; Figure 7 D is the growth of resistant seedlings; Figure 7 E and F are complete transgenic plants.

[0155] 2.3 Identification of positive plants, hardening and transplanting, and expression level determination;

[0156] 2.3.1 PCR detection of transgenic plants overexpressing miR398a-3p in alfalfa

[0157] The genomic DNA of alfalfa overexpression plants and wild-type plants were extracted, and the NPTⅡ gene was detected and analyzed by PCR and agarose gel electrophoresis. The wild-type plants were used as negative controls, and the GV3101-amiR398a-3p bacterial solution was used as a positive control. Figure 8 As shown, a 676 bp NPTⅡ gene fragment can be amplified, and it can be preliminarily identified as a transgenic plant of alfalfa overexpressing pCPB121-miR398a-3p. Figure 8 In the figure, M represents DL 2000 marker; WT represents wild-type plants; 1 represents positive control; 2-8 represent transgenic plants.

[0158] 2.3.2 PCR detection of transgenic plants expressing silencing miR398a-3p in alfalfa

[0159] The genomic DNA of transformed plants and wild-type plants were extracted respectively, and the specific primers of STTM-miR398a-p were designed. The transformation analysis was detected by PCR and agarose gel electrophoresis. The wild-type plants were used as negative controls, and the plasmid DNA of the positive colonies successfully transformed with pBWA(V)HS-STTM-miR398a-3p was used as positive controls. The gel electrophoresis results showed that the 244 bp target fragment (such as Fig. 9 The results were consistent with the expected results, and the preliminary identification was that the pBWA(V)HS-STTM-miR398a-3p silenced expression alfalfa transgenic plants. Fig. 9 In the figure, M represents DL 2000 marker; WT represents wild-type plants; 1 represents positive control; 2-7 represent transgenic plants.

[0160] 2.3.3 Hardening and transplanting

[0161] When the transgenic and wild-type tissue culture seedlings grow to the bottle mouth ( Fig.10 A), unscrew the bottle cap and add appropriate amount of sterile water, completely open the bottle cap after 2-3 days, pull it out of the culture medium with the roots after 7 days, wash the roots and transfer it to the nutrient solution for culture ( Fig.10 B). After culturing in the nutrient solution for 20 days, transplant to a small flower pot with a nutrient soil: vermiculite ratio of 3:1 for cultivation ( Fig.10 C), the alfalfa plants grow well and the transplant survival rate can reach 100%. Fig.10 Among them, A is for seedling hardening; B is for hydroponics; C is for soil culture.

[0162] 2.3.4 Analysis of expression levels in transgenic alfalfa miR398a-3p plants

[0163] The relative expression level of miR398a-3p in alfalfa was analyzed by qRT-PCR. Fig.11 The results showed that the expression level of alfalfa miR398a-3p in silent expression plants was significantly lower than that in the control (p<0.05), and the expression levels of silent expression plants S1, S2 and S3 were 0.37, 0.46 and 0.34 times that of the control, respectively; the relative expression level of alfalfa miR398a-3p in overexpression strains was significantly higher than that of the wild type (WT) (p<0.05), and the expression levels of OE1, OE2 and OE3 were 3.61, 4.14 and 3.86 times that of the control, respectively. Compared with the control, the relative expression levels of S3 and OE2 were the most significant. Fig.11 In the figure, WT represents non-transgenic plants; S1-S3 represent STTM silenced expression plants; OE1-OE3 represent overexpression plants; different lowercase letters indicate significant differences (p<0.05).

[0164] 2.4 Statistics and phenotypic analysis of transgenic plant growth under drought stress

[0165] As shown in Table 14, there were no significant differences in stem diameter, dry weight and fresh weight among wild-type plants, silent expression plants and overexpression plants grown under normal conditions, but the plant height and root length of silent expression plants were higher than those of wild-type plants and overexpression plants; under drought stress, the average values ​​of plant height, root length, dry weight and fresh weight of alfalfa silent expression plants were higher than those of wild-type plants, which were 1.11, 1.11, 1.35 and 1.26 times higher than those of wild-type plants, respectively, while the average values ​​of plant height, root length, dry weight and fresh weight of overexpression plants were significantly lower than those of silent expression plants (p<0.05), which were 0.85, 0.86, 0.63 and 0.71 times lower than those of silent expression plants, respectively.

[0166] Table 14

[0167]

[0168] Note: Different lowercase letters after the data indicate significant differences (P<0.05)

[0169] After the transgenic alfalfa plants and wild-type plants were subjected to drought stress, their phenotypic changes were compared and analyzed. Fig.12 A. The silent expression plants grown under normal conditions grew better than the wild-type plants and the overexpression plants, while the overexpression plants grew significantly weaker than the wild-type plants; Fig.12 As shown in B, the leaves of the silent expression plants were greener and less wilted and curled than those of the overexpression plants and wild-type plants, while the wilting degree of the leaves of the overexpression plants was significantly greater than that of the wild-type plants, and their drought resistance was significantly lower than that of the wild-type plants. Fig.12 In the figure, A is the phenotype of plants under drought stress; B is the phenotype of plant apex under drought treatment.

[0170] 2.5 Analysis of physiological characteristics of transgenic plants under drought stress

[0171] like Fig.13As shown in the figure, under normal growth conditions, the SOD activity of WT, silent expression plants and overexpression plants did not change significantly; under drought stress, the SOD activity of silent expression plants was 1.07 times and 1.65 times higher than that of wild type and overexpression plants, respectively, while the SOD activity of overexpression plants was lower than that of wild type and silent expression plants, respectively; under drought stress, the POD activity of silent expression plants did not increase significantly compared with that of wild type plants, but was significantly higher than that of overexpression plants (p<0.05); the POD activity in overexpression plants was significantly lower than that in wild type plants. strains and silenced expression plants (p<0.05), which were 15.5% and 31.8% lower than those of wild-type plants and silenced expression plants, respectively; under normal growth conditions, the CAT activity in silenced expression plants did not change significantly compared with that of wild-type plants, but was significantly higher than that of overexpression plants (p<0.05); under drought stress, the CAT activity in alfalfa miR398a-3p silenced expression plants was significantly higher than that of wild-type plants and overexpression plants (p<0.05), and the CAT activity in overexpression plants did not change significantly compared with that of wild-type plants. Malondialdehyde (MDA) can reflect the degree of cell membrane damage. When plants are subjected to drought stress, the membrane system is destroyed and the end product of membrane lipid peroxidation, MDA, is produced. Fig.13 As shown in the figure, under normal growth conditions, the MDA content of wild-type plants, silent expression plants and overexpression plants did not change significantly; under 15% PEG-6000 simulated drought stress, the MDA content in the leaves of silent expression plants was significantly lower than that of wild-type plants and overexpression plants (p<0.05), while the opposite was true for overexpression plants. Hydrogen peroxide is one of the important reactive oxygen species, and stress stimulation can induce the production and accumulation of hydrogen peroxide in cells. Fig.13 As shown in the figure, there was no significant difference in the hydrogen peroxide content between the wild-type plants and the transgenic plants of alfalfa without stress treatment; under drought stress, the H2O2 content of the wild-type plants and the transgenic plants increased further, among which the H2O2 content in the overexpression plants was the highest.

[0172] In summary, STTM technology and artificial miRNA technology were used to silence and overexpress alfalfa miR398a-3p, respectively, and it was found that Msa-miR398a-3p negatively regulated the drought resistance of alfalfa.

Claims

1. Application of Msa-miR398a-3p in regulating plant drought resistance, characterized in that: The precursor sequence of the Msa-miR398a-3p is shown in SEQ ID No.1, and the mature sequence of the Msa-miR398a-3p is shown in SEQ ID No.

2.

2. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 1, characterized in that: When amplifying Msa-miR398a-3p, STTM-miR398a-3p-PF and STTM-miR398a-3p-PR are included; the nucleotide sequence of STTM-miR398a-3p-PF is shown in SEQ ID No.3; the nucleotide sequence of STTM-miR398a-3p-PR is shown in SEQ ID No.

4.

3. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 1, characterized in that: Silencing the expression of Msa-miR398a-3p improves plant drought resistance.

4. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 1, characterized in that: The STTM technology was used to construct a recombinant vector for silencing the expression of Msa-miR398a-3p, and the recombinant vector was transferred into plants to improve the drought resistance of the plants.

5. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 4, characterized in that: The STTM technology is used to construct a recombinant vector for silently expressing Msa-miR398a-3p, which specifically includes digesting the target fragment STTM-miR398a-3p and the expression vector with BasI and Eco31I at 37°C and then connecting the digestion products to form a recombinant vector for silently expressing Msa-miR398a-3p.

6. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 5, characterized in that: The silencing expression vector is pBWA(V)HS.

7. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 1, characterized in that: The Msa-miR398a-3p improves plant drought resistance by regulating the activity of plant-related antioxidant enzymes.

8. The use of Msa-miR398a-3p in regulating plant drought resistance according to claim 1, characterized in that: The application is specifically: introducing Msa-miR398a-3p into the plant whose drought resistance is to be improved to obtain a transgenic plant.

9. The use of Msa-miR398a-3p in regulating plant drought resistance according to any one of claims 1 to 8, characterized in that: The plant of choice is alfalfa.

Images