Broad-spectrum neutralizing monoclonal antibody from pigs against foot-and-mouth disease virus type O and its application

Abstract

The invention belongs to the field of biology, and discloses a broad-spectrum neutralizing porcine monoclonal antibody for foot-and-mouth disease virus type O and its application. The amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2. The key amino acid residue of the antigen recognized by the monoclonal antibody is position 77 of the VP2 protein. The site is located in the VP2B-C loop of the structural protein and is a conformational epitope. The site does not react with type A antigen, is a broad-spectrum neutralizing antibody within the type, and exhibits a strong neutralizing efficacy (IC 50 <5μg·mL ‑1 ). At the same time, the present invention also provides the application of the monoclonal antibody.

Description

Technical Field

[0001] The invention relates to the biological field, and in particular to a broad-spectrum neutralizing porcine monoclonal antibody within the O-type of foot-and-mouth disease virus and an application thereof. Background Art

[0002] Foot-and-mouth disease (FMD) is a highly contagious animal disease caused by foot-and-mouth disease virus (FMDV). It has high variability and a wide host spectrum. It can infect a variety of even-toed ungulates including cattle, pigs, sheep, etc., causing huge economic losses to the livestock industry. FMDV belongs to the Picornaviridae family and has seven serotypes (A, O, C, Asia1, SAT1, SAT2, SAT3). Among them, the O serotype is the most prevalent and widely distributed type in the world. The frequent mutation of its strains and the complexity of its antigenic sites make the prevention and control of FMD a major challenge in the field of global animal health. Since the 20th century, O-type FMDV has become the most common and widely distributed serotype in the world. From Europe, Asia to Africa, O-type FMDV has almost spread to all countries and regions affected by FMD. Its high infectivity, rapid transmission speed and adaptability to multiple hosts have made it the focus of attention in the field of global animal health. In recent years, intercontinental transmission of O-type FMDV has occurred frequently, such as the overlapping epidemics of African swine fever virus (ASFV) and O-type FMDV in Asia in 2018, which further exacerbated the complexity of the epidemic and posed a serious threat to global animal health and economic security.

[0003] The genetic variation of O-type FMDV is an important driving factor for its epidemic. FMDV is a positive-strand RNA virus. Due to the lack of proofreading enzymes, errors are prone to occur during RNA replication, resulting in frequent mutations of the viral genome. The variation of O-type FMDV is not only reflected within the serotype, but also manifests as cross-type variation between serotypes. In recent years, new variants of O-type FMDV have continued to emerge, such as the O / ME-SA / Ind-2001 strain first reported in the Middle East in 2010, and the subsequent O / Ind / 2010-like and O / Mya-98-like variants that appeared in many countries in Asia and Africa. The emergence of these new variants has brought new challenges to the diagnosis and prevention of FMD.

[0004] The antigenicity of FMDV is the key to its infection and immune response. The antigenic sites of O-type FMDV are mainly located on its viral capsid proteins VP1, VP2 and VP3, especially the GH loop region of VP1, which is considered to be the main neutralizing antigenic site. In recent years, scientists have conducted in-depth analysis of the antigenic site structure of O-type FMDV through X-ray crystallography, cryo-electron microscopy and other technologies, revealing the three-dimensional structural characteristics of the antigenic site and its interaction mechanism with antibodies, providing an important molecular basis for the design of efficient vaccines and the development of diagnostic reagents. In addition, the variation of antigenic sites is closely related to the immune escape mechanism of the virus. In-depth understanding of the variation characteristics of antigenic sites is of great significance for predicting the evolution trend of the virus and evaluating the immune effect of vaccines. Using bioinformatics technology and molecular biology methods, researchers have conducted in-depth analysis of the antigenic sites of FMDV O-type strains. Through sequence alignment, structure prediction and antigen epitope prediction, multiple key neutralizing antigenic sites in the VP1 protein were revealed. These sites are not only key areas for the interaction between the virus and the host immune system, but also important targets for vaccine design and optimization. For example, the VP1 protein of the O / PanAsia strain has two major linear epitopes at the GH loop and C terminus, which have good immunogenicity and can induce the body to produce highly effective neutralizing antibodies. By further screening and optimizing these epitopes, peptide vaccines or genetically engineered vaccines with stronger immune protection can be developed. In addition to antigenic site 2, other epitopes on the VP2 capsid protein of FMDV serotype O were defined based on sequence analysis of escape mutant FMDV selected using monoclonal antibodies. The identified VP2 neutralizing epitopes include residues 68 and 74 of the βB-βC loop, residue 79 near the βB-βC loop, residues 133 and 134 of the βE-βF loop, and residues 188 and 191 of the βH-βI loop. In addition, non-neutralizing conserved epitopes (residues 1-5) at the N-terminus of VP2 were also identified and used to develop universal diagnostic tests for FMDV.

[0005] Monoclonal antibodies (mAbs) are important tools in modern immunology. They are characterized by high specificity and high affinity, and play an irreplaceable role in the research and prevention and control of FMD. Monoclonal antibodies against type O FMDV can not only be used for rapid detection and identification of the virus, but are also important tools for studying viral antigenicity and immune escape mechanisms. In addition, monoclonal antibodies have also shown great potential in the development of FMD vaccines. By screening mAbs with high affinity to viral antigenic sites, the design of vaccine antigens can be guided and the immune effect of vaccines can be improved. In recent years, the development of mAb-based FMD diagnostic kits and therapeutic antibodies has made significant progress, providing new means for the precise prevention and control of FMD.

[0006] The global prevalence of O-type FMDV, the frequent mutation of strains, and the complexity of antigenic sites make the prevention and control of FMD a long and arduous task. As a powerful tool in modern immunology, monoclonal antibodies have shown broad application prospects in the research and prevention and control of FMD. Faced with the global prevalence and complex mutation of O-type FMDV, in-depth analysis of its genetic variation characteristics, antigenic site structure and function, and the development of efficient and specific monoclonal antibodies are important directions for prevention and control strategies. New generation antibody engineering technologies such as bispecific antibodies and antibody-drug conjugates (ADCs) will expand their applications, combined with artificial intelligence and big data analysis, to promote the intelligent design of antibodies and safeguard global animal health and economic security.

[0007] After viral infection, the body is induced to produce antibodies, which include neutralizing antibodies and non-neutralizing antibodies. The difference between neutralizing antibodies and non-neutralizing antibodies is that they are induced by different antigens. Neutralizing antibodies are induced by viral surface antigens. Non-neutralizing antibodies are induced by viral internal antigens or surface non-neutralizing antigens. Since neutralizing antibodies destroy viruses before they enter cells, existing vaccines such as measles vaccine, polio vaccine, hepatitis B vaccine, and hepatitis A vaccine all make the vaccine recipient produce neutralizing antibodies to resist viruses. Antibodies are widely used in medical practice. For example, they have certain effects in the prevention, diagnosis and treatment of diseases. Of course, "non-neutralizing antibodies" are not useless, they can also mediate the entry of viruses into macrophages. However, the role of "non-neutralizing antibodies" is very complicated, and they may also cause other adverse immune responses in the human body, such as lung immune damage, such as some problems caused by antigen-antibody complex precipitation, etc.

[0008] In terms of the difficulty of developing both, it is much more difficult to successfully screen out neutralizing antibodies with strong specificity and high neutralizing potency than to screen out non-neutralizing antibodies.

[0009] The research on monoclonal antibodies against foot-and-mouth disease virus in this field is mainly concentrated in the applicant, Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, which is a joint research and development unit of the applicant. In the early stage of research, the research was mainly focused on non-neutralizing antibodies, and the research on effective neutralizing antibodies has not been successfully developed. For details, see the following documents:

[0010] CN118580346A A broad-spectrum non-neutralizing antibody against foot-and-mouth disease virus and its use in the preparation of a reagent for enhancing the induction of neutralizing antibodies;

[0011] Screening and identification of cross-reactive monoclonal antibodies against foot-and-mouth disease virus type O and type A, Chinese Journal of Veterinary Science, Zhou Shasha et al.

[0012] Expression and activity identification of monoclonal engineered antibodies specific for VP2 protein of foot-and-mouth disease virus, Chinese Journal of Veterinary Science, by Wang Sheng et al.

[0013] The above three schemes have all developed monoclonal antibodies that can bind to specific O-type and / or A-type serotype foot-and-mouth disease virus, which are monoclonal antibodies of porcine and bovine origin, respectively. However, these antibodies generally have no neutralizing ability.

[0014] In previous studies, we immunized pigs and cows and obtained more than 70 monoclonal antibodies in total, but none of them had obvious neutralizing ability.

[0015] The technical problem solved in this case is: how to develop a monoclonal antibody with high specificity and neutralizing ability against serotype O foot-and-mouth disease virus. Summary of the invention

[0016] The purpose of the present invention is to provide a broad-spectrum neutralizing porcine monoclonal antibody against foot-and-mouth disease virus type O. The key amino acid residue of the antigen recognized by the monoclonal antibody is position 77 of the VP2 protein. The site is located in the BC loop of the structural protein VP2 and is a conformational epitope. It does not react with type A antigen. It is a broad-spectrum neutralizing antibody within the type and exhibits a strong neutralizing efficacy (IC 50 <5μg·mL -1 ).

[0017] At the same time, the invention also provides the application of the monoclonal antibody.

[0018] The specific scheme of the present invention is:

[0019] A broad-spectrum neutralizing porcine monoclonal antibody against foot-and-mouth disease virus type O, wherein the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0020] At the same time, the present invention also discloses the use of the monoclonal antibody as described above for preparing a vaccine.

[0021] In the above-mentioned use, the vaccine is a vaccine for preventing and treating O-serotype foot-and-mouth disease virus infection.

[0022] In addition, the present invention also discloses the use of the monoclonal antibody as described above to prepare a kit for detecting O-serotype foot-and-mouth disease virus.

[0023] Finally, the present invention also discloses a vaccine containing the monoclonal antibody as described above.

[0024] And, a kit comprising the monoclonal antibody described above.

[0025] The beneficial effects of this application are:

[0026] The present invention purifies the virus particles of the currently prevalent strain HNNY / 2022 of the O-type FMDV Mya98 lineage and prepares bait antigens by biotin labeling, successfully sorts the antigen-specific B cells of pigs immunized with FMDV O-type antigen, and obtains a specific antibody library with a library capacity of 3189 pairs of BCR sequences by sequencing, of which 2020 are IgG, accounting for 63% of the paired BCRs.

[0027] The present invention screened and successfully expressed a monoclonal antibody pONY-10 after analyzing the antibody characteristics. The results of IFA, indirect ELISA and virus microneutralization experiments all pointed to the specific reaction of the antibody to the O-type strain. pONY-10 showed specific neutralization effect on representative strains of each lineage of the FMDVO serotype, and showed strong neutralization efficacy, but did not react to the A-type antigen and had no neutralization effect.

[0028] The key amino acid residue of the antigen recognized by pONY-10 is position 77 of the VP2 protein, which is located in the BC loop of the structural protein VP2. It is a conformational epitope and belongs to antigenic site 2. The reactivity and neutralization characteristics of pONY-10 are based on the strains within the O serotype. It does not react with the A-type antigen and is a broad-spectrum neutralizing antibody within the strain. The research and application of neutralizing monoclonal antibodies is an important branch of modern medicine and biotechnology. They play a key role in improving the efficiency of disease treatment, preventing infection and promoting the development of new drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Flow chart for the construction of FMDV-specific porcine B cell receptor library and antibody expression;

[0030] Figure 2 This is a photo of flow cytometry sorted antigen-specific B cells;

[0031] Figure 3A This is a chart of the classification of heavy chains in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0032] Figure 3B This is a chart of the classification of light chains in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0033] Figure 3C This is a distribution chart of IgG, IgD, IgA, and IgE in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0034] Figure 4A It is the logo of HCDR1, HCDR2 and HCDR3 in the amino acid sequence of the heavy chain variable region of pONY-10;

[0035] Figure 4BIt is the logo of LCDR1, LCDR2 and LCDR3 in the amino acid sequence of the light chain variable region of pONY-10;

[0036] Figure 4C The schematic diagram of the amino acid sequence structure of the V region and CDR region of pONY-10;

[0037] Figure 5 This is the electrophoresis result diagram of SDS-PAGE detection of pONY-10 antibody expression;

[0038] Figure 6 This is a graph showing the results of IFA detection of the reactivity of pONY-10 binding to FMDV;

[0039] Figure 7 This is the result of indirect ELISA testing the binding affinity of pONY-10;

[0040] Figure 8 This is a chart showing the results of the pONY-10 antibody strain cross-neutralization test;

[0041] Fig. 9 This is a comparison of VP2 sequences of representative strains of different serotypes of FMDV;

[0042] Fig.10 This is a graph showing the results of competition ELISA to detect the binding sites of pONY-10. DETAILED DESCRIPTION

[0043] The present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. In the description of the present invention, it should be noted that, if no specific conditions are specified in the embodiments, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0044] Materials and Reagents

[0045] 1.1 Cells and FMDV strains

[0046] BHK-21 cells, FMDV type O (O / PanAsia / Tibet / 99, O / Mya98 / HNNY / 2022, O / Cathay / 18074, O / ZK / 93, O / GSLX / 2010) strains, and FMDV type A (A / WH / 09, A / HNXX, A / F / 72) strains are all preserved by the National Foot-and-Mouth Disease Reference Laboratory.

[0047] 1.2 Main Reagents

[0048] FMDV O-type inactivated antigen (O / PanAsia / Tibet / 99) was kindly donated by Sino-Agri Biotech Co., Ltd. The biotin labeling kit EZ-LinkTM Sulfo-NHS-LC-Biotin was purchased from Thermo; the lymphocyte separation medium Histopaque(R)-1.077sterile-filtered, density: 1.077g / mL was purchased from Sigma; the APC fluorescently labeled anti-biotin antibody (Anti-biotin-APC) was purchased from Miltenyi Biotec; the endotoxin-free plasmid extraction kit was purchased from TIGEN; the FITC-labeled goat anti-swine IgG antibody was purchased from Sigma; and the horseradish peroxidase (HRP)-labeled goat anti-swine antibody was purchased from Bioss.

[0049] Example 1 Preparation of porcine monoclonal antibodies

[0050] 2.1 Methods

[0051] 2.1.1 Purification of FMDV 146S and animal immunization

[0052] The O / Mya98 / HNNY / 2022 virus was inoculated into BHK-21 cells that were well grown in a monolayer and in good condition, and then placed in a 37°C, 5% CO2 incubator for constant temperature culture. The cell CPE was observed. When all cells became pathological and dead, they were frozen and thawed three times and centrifuged to remove cell fragments, and the cytotoxins were harvested. The complete FMDV virus particles 146S were purified and concentrated by sucrose density gradient centrifugation, and the Montanide ISA 201 adjuvant was mixed with the antigen 146S for emulsification and preparation of inactivated vaccines. Healthy pigs that were negative for FMDV antigen and antibody were immunized. Two-month-old healthy three-way pigs were selected for intramuscular injection of FMDV O-type HNNY / 2022 strain inactivated vaccine, and a total of 3 immunizations were performed with an immunization interval of 28 days.

[0053] 2.1.2 Flow cytometry sorting of antigen-specific B cells

[0054] On the 4th day after the last immunization, EDTA anticoagulated blood was collected from the anterior vena cava of the pigs, and peripheral blood mononuclear cells (PBMCs) were isolated using HISTOPAQUE 1.077 according to the manufacturer's instructions. To prepare the bait antigen, the antigen FMDV 146S was labeled with biotin.

[0055] According to the manufacturer's instructions, highly purified FMDV 146S antigen was biotinylated using EZ-Link NHSLC-Biotin reagent, and the resulting Biotin-FMDV 146S was used as a bait antigen to screen for binding antigen-specific B cells.

[0056] Take about 10 7 PBMCs were resuspended in 200 μL cell sorting solution, Biotin-FMDV 146S was added, and the cells were centrifuged at 500 x g for 5 min after reacting at 4°C for 30 min. Then 1 μL mouse anti-biotin APC was aspirated and incubated at 4°C for 30 min, and the cells were washed again. 500 μL cell sorting solution was taken to resuspend the cells, and they were placed on ice away from light and waited for loading. In addition, a group of sample tubes without bait antigens were taken from the same cells as fluorescence minus one (FMO) controls. In the FMO control samples, appropriate gates were set for FACS to sort O-type antigen-specific B cells.

[0057] 2.1.3 Establishment of FMDV-specific BCR library

[0058] The sorted FMDV O / Mya98 / HNNY / 2022 antigen-specific B cells were sent to the company for single-cell transcriptome and immune group sequencing using the 10X Genomics Chromium system. First, a gel bead emulsion (GEM) was used to quickly encapsulate single cells in droplets, and specific DNA fragments, including Barcode, UMI, and PolyT, were seeded on the gel beads. Barcode is used to distinguish different gel beads, UMI is used to distinguish original cDNA molecules, and PolyT is used to capture mRNA. After each cell is mixed with the gel beads one by one to form small oil-in-water droplets, after the cell membrane is ruptured, the mRNA is freed and contacts the reverse transcriptase, nucleic acid primers and dNTP substrates on the gel beads, a reverse transcription reaction occurs, and cDNA is generated. Then the labeled cDNA molecules are extracted, the adapters are added, and after PCR amplification, they are prepared into sequencing libraries suitable for the Illumina sequencing platform for high-throughput sequencing. The raw data obtained by sequencing were processed using the Cell Ranger software provided by 10X Genomics to obtain gene expression profiles and differential analysis at the single cell level.

[0059] 2.1.4 Amino acid sequence of the variable region of monoclonal antibody pONY-10

[0060] The variable region (V region) of an antibody is the segment of the antibody molecule that is responsible for recognizing and binding to antigens. Antibodies are composed of two heavy chains and two light chains, and each chain has a V region at the N-terminus, which is the key to recognizing foreign substances. Each V region contains three highly variable regions, called Complementarity Determining Regions (CDRs), of which CDR3 has the highest degree of variation and plays a decisive role in the specificity of the antibody. In addition to these three highly variable regions, the V region also contains relatively conservative framework regions (FRs), which vary less between different antibodies and provide structural support for the highly variable regions. Different combinations of CDRs and FRs in the V region produce rich and diverse antibodies, and this diversity is the basis for the immune system to recognize and resist a wide range of pathogens. By uploading the FMDV-specific IgG antibody sequences obtained by sequencing to the International Immunogenomics Database IMGT website (https: / / www.imgt.org / HighV-QUEST / ), the sequencing data were annotated in detail to obtain information including antibody V region gene rearrangement and mutation.

[0061] 2.2 Results

[0062] 2.2.1 Purification of FMDV 146S and animal immunization

[0063] The purified O / Mya98 / HNNY / 2022 antigen was mixed with 201 adjuvant in a ratio of 1:1 to prepare an inactivated vaccine, which was used to immunize 2-month-old piglets. On the 4th day after the third immunization, EDTA anticoagulated blood was collected to separate PBMCs, and B cells in peripheral blood were labeled by flow cytometry. Biotin-labeled bait antigen was added to sort out antigen-specific B cells. After cell counting, single cell capture and antibody library construction were immediately performed using Chromium Next GEM Single Cell 5'Kit v2 (10×Genomics) ( Figure 1 ).

[0064] Figure 1 Flow chart for the construction of FMDV-specific porcine B cell receptor library and antibody expression.

[0065] 2.1.2 Flow cytometry sorting of antigen-specific B cells

[0066] In order to obtain FMDV antigen-specific antibody-secreting B cells, EDTA anticoagulated blood was collected from the anterior vena cava of pigs on the fourth day after the third immunization to separate PBMCs. Then, biotin-labeled antigen 146S was used as bait for flow cytometry sorting. FACS statistical results showed that 340,000 lymphocytes were identified in 1 million PBMCs, of which 320,000 lymphocytes were gated as single line cells ( Figure 2The number of FMDV antigen-specific B cells in pig peripheral blood was small, accounting for about 1.16% of the total number of pig peripheral blood mononuclear cells. A total of 2×10 4 FMDV-specific antibody-secreting B cells were subjected to 10X Genomics single-cell BCR sequencing.

[0067] Figure 2 This is a photograph of flow cytometry sorting of antigen-specific B cells.

[0068] 2.1.3 Sequence matching and typing of specific antibody library

[0069] The FMDV-specific antibody-secreting B cells collected by FACS were sent to 10X Genomics for single-cell 5'BCR immune repertoire sequencing. The obtained full-length cDNA was fragmented, end-repaired, A-linked, and connected to Reads sequencing primers for classification and pairing of antibody BCR sequences. The results are shown in Table 1. After pigs were immunized with the inactivated vaccine of the O / Mya98 / HNNY / 2022 strain, a total of 6227 antibody sequences were detected in specific B cells. Figure 3A The heavy chain is mainly composed of IgG subtype (1955 / 3076), while the BCR sequence of IgE subtype, which is mainly secreted by plasma cells under the respiratory and digestive tract mucosa, was not determined. There are 3151 light chain sequences ( Figure 3B ), of which Kappa subtype accounted for 55% (1732 / 3151) and Lambda subtype accounted for 45% (1419 / 3151). Kappa subtype was slightly more dominant than Lambda subtype ( Figure 3B ).

[0070] Figure 3A This is a chart of the classification of heavy chains in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0071] Figure 3B This is a chart of the classification of light chains in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0072] Figure 3C This is a distribution chart of IgG, IgD, IgA, and IgE in the O / Mya98 / HNNY / 2022 specific antibody library sequence subtypes;

[0073] Table 1 Classification of O / Mya98 / HNNY / 2022 specific antibody library sequences

[0074] Antibody Type IgA IgD IgG IgE IKK IgL total HNNY / 2022 364 757 1955 0 1732 1419 6227

[0075] The classified BCR sequences are uploaded to IMGT one by one

[0076] (https: / / www.imgt.org / HighV-QUEST / home.action) website, to analyze immune receptor gene rearrangement, including identification and comparison of immune receptor genes, VDJ rearrangement analysis, mutation hotspot analysis and functional annotation. The heavy chain and light chain sequences of BCR were further paired (Table 2), and a specific antibody library of FMDV O type HNNY / 2022 strain with a total capacity of 3189 was obtained. Figure 3C As shown in the figure, IgG, which plays a core role in the body's immune response and immune defense, accounts for 63% of paired BCRs. IgD and IgA have 785 and 384 pairs, respectively, accounting for 25% and 12% of the entire library.

[0077] Table 2 O / Mya98 / HNNY / 2022 specific BCR library capacity

[0078] Antibody Type IgA IgD IgG IgE total HNNY / 2022 384 785 2020 0 3189

[0079] 2.1.4 Sequence of the V region of porcine monoclonal antibody pONY-10

[0080] Among the five types of Ig, IgG is the most important of the five immunoglobulins due to its high concentration, wide distribution, long half-life, diverse functions and key role in immune memory. Therefore, the obtained IgG antibody sequence was selected for expression and verification of biological activity. The V region is the part of the antibody molecule responsible for recognizing and binding to antigens. It consists of the heavy chain variable region (VH) and the light chain variable region (VL). It is connected by disulfide bonds to form a unique three-dimensional structure, forming an antigen binding site and providing broad immune protection. The porcine monoclonal antibody screened for expression verification was named pONY-10. Table 3 lists the amino acid sequence of the variable region (V region) of the pONY-10 antibody.

[0081] Table 3 Amino acid sequence of porcine monoclonal antibody pONY-10

[0082]

[0083]

[0084] The three complementary determining regions (CDR1, CDR2, and CDR3) in the V region are highly variable regions, especially CDR3, which is directly involved in the interaction with the antigen, ensuring the highly specific binding between the antibody and the antigen. The framework region (FR) of the V region is relatively conservative and participates in stabilizing the binding between the antibody and the antigen. The variable region of the V region is not only the site where the antibody recognizes the antigen, but also the key to the diversity and specificity of the antibody ( FIG. 4A to FIG. 4C ).

[0085] refer to Figure 4AIn antibody pONY-10, the sequence of the hypervariable region HCDR1 of the heavy chain (VH) is GFTISSYE, and the sequence of HCDR21 is ISTSGSST. Among them, the HCDR3, which plays the most important role in antigen binding, is 19 amino acids long and has the sequence EKICYSAYWYRRCELDRDL;

[0086] refer to Figure 4B The amino acid sequence of the hypervariable region LCDR1 of the light chain (VL) is QSLVFSGKSW, the amino acid sequence of LCDR2 is QAT, and the amino acid sequence of LCDR3 is QQFKEFPPNG.

[0087] Figure 4A It is the logo of HCDR1, HCDR2 and HCDR3 in the amino acid sequence of the heavy chain variable region of pONY-10;

[0088] Figure 4B It is the logo of LCDR1, LCDR2 and LCDR3 in the amino acid sequence of the light chain variable region of pONY-10;

[0089] Figure 4C The schematic diagram of the amino acid sequence structure of the V region and CDR region of pONY-10;

[0090] 2.3 Summary

[0091] By purifying the virus particles of the current epidemic strain HNNY / 2022 of the O-type FMDV Mya98 lineage and preparing bait antigens by biotin labeling, antigen-specific B cells of pigs immunized with FMDV O-type antigen were successfully sorted, and a specific antibody library with a library capacity of 3189 pairs of BCR sequences was obtained by sequencing, of which 2020 IgGs accounted for 63% of the paired BCRs. Monoclonal antibodies are widely used as favorable biomolecules for various applications, providing a valuable source for further research and application, including infectious disease research, diagnosis and treatment, and vaccine design, to strengthen disease prevention and control measures.

[0092] Example 2 Verification of Antibody Biological Activity

[0093] 3.1 Methods

[0094] 3.1.1 Construction and purification of antibody gene expression vector

[0095] The heavy chain variable region (VH) gene of the antibody was codon-optimized and inserted into the CH-pcDNA3.4 vector containing the porcine IgG heavy chain framework region;

[0096] The antibody light chain variable region (VL) was also inserted into the CL-pcDNA3.4 vector containing the porcine IgG light chain constant region after codon optimization. A 6×His tag was added to the antibody constant region, and the sequence synthesis and vector construction were commissioned to Genewise Biotechnology Co., Ltd.

[0097] The recombinant expression plasmid was transformed into DH5α competent cells to amplify the plasmid, and the plasmid was extracted using an endotoxin-free plasmid extraction kit according to the kit instructions.

[0098] The antibody heavy chain and light chain plasmids were co-transfected into 293f cells in suspension culture for expression. The heavy chain plasmid and the light chain plasmid were diluted in D-PBS at a weight ratio of 2:3 and mixed thoroughly. PEI 40000MW was used as the transfection reagent. The transfection reagent PEI and the total amount of plasmid DNA were mixed at a weight ratio of 3:1 to prepare the PEI-DNA transfection mixture. After the transfection complex was left to stand at room temperature for 10 minutes, it was slowly added dropwise to 2.0×10 6 293f cells. The transfected cells were cultured in a 37°C constant temperature suspension incubator. 293f SUP Feed was added after 48 hours, and the expression samples were collected at 7-8 days of culture. Centrifugation was performed at 4°C, 10000rpm for 30 minutes, and the culture supernatant was filtered through a 0.22μm filter for antibody purification. The pre-packed column was filled with Ni-NTA 6FF filler for purification. After the target protein was eluted with high concentration of imidazole, it was dialyzed in PBS buffer at 4°C overnight. The dialyzate was changed 4-6 times to remove the imidazole in the protein. The dialyzed antibody was embedded in PEG 8000 and concentrated, and then identified by SDS-PAGE electrophoresis.

[0099] 3.1.2 Indirect immunofluorescence (IFA) detection of antibody reactivity

[0100] BHK-21 cells were inoculated into 24-well plates. When the cells grew to 80%-90% confluence, the representative strains of FMDV O and A serotypes were inoculated into the cells, and normal cell controls were set up at the same time. After infection in a 37°C cell culture incubator for 4 hours, the supernatant was collected and inactivated. The cells were washed 3 times with PBS, and 4% paraformaldehyde pre-cooled at -20°C was added to fix the cells. After 20 minutes at room temperature, 0.1% Triton penetrated the cell membrane for 10 minutes, and 1% BSA was blocked for detection. Wash the cells 3 times with PBS, add the above-mentioned purified antibodies at a final concentration of 5μg / mL, and incubate at 37°C for 1h. Wash 3 times with PBS, add FITC-labeled anti-swine IgG antibodies at the working concentration indicated in the instructions, incubate at 37°C for 1h, wash the cells 5 times with PBS, and observe the fluorescence signal under a fluorescence microscope and take pictures and record.

[0101] 3.1.3 Indirect ELISA to detect antibody binding affinity

[0102] Use FMDV inactivated purified antigen as coating antigen to detect the affinity of antibody binding. The specific operation steps are as follows: dilute the concentrated purified antigen to 1μg / ml with carbonate buffer, add 100μL to each well of the ELISA plate, and coat at 4℃ overnight for 16h. Wash the plate 5 times with PBST, add 100μL of blocking solution to each well, incubate at 37℃ for 2h, wash the plate 5 times with PBST, and pat dry the liquid in the well. Dilute the antibody to be tested 2-fold from 20μg / mL, add 100μL to each well of the ELISA plate, and incubate at 37℃ for 1h; set up a PBS negative control group. Wash the plate 5 times with PBST, add 100μL of HRP-labeled anti-swine antibody to each well, and incubate at 37C for 30min. Wash the plate 5 times with PBST, add 100μL of TMB colorimetric solution to each well of the ELISA plate, and color at 37℃ for 15min. Add stop solution to stop color development, and measure the absorbance at 450nm with an ELISA reader. The results were calculated using the S / CO method, where S is the sample OD value, CO is the Cut off value (positive judgment value), and CO = 2.1 × N (N is the negative control OD value).

[0103] 3.1.4 Virus cross-neutralization test

[0104] The virus microneutralization test is an experimental method to evaluate the ability of antibodies to neutralize virus infectivity. Monoclonal antibody samples of known concentration (μg / mL) are serially diluted 2-fold in a 96-well cell culture plate, and two replicate wells are made, with 50 μL of antibody added to each well. 50 μL of 100 TCID 50 (50% tissue culture infection dose) FMDV serum-free medium. Incubate in a 37°C incubator for 1 hour to allow antigen-antibody neutralization to occur. After the incubation, add 100 μL of BHK-21 cell suspension to each well, with approximately 5×10 cells per well. 4 After incubation at 37°C and 5% CO2 for 48 h, the cytopathic effect (CPE) was observed and the cells that could neutralize 100 TCID 50 The average titer of FMDV antibodies. Select representative strains of FMDV type O and type A to conduct cross-neutralization tests with monoclonal antibodies, and observe and record the results.

[0105] 3.2 Results

[0106] 3.2.1 SDS-PAGE identification of purified antibodies

[0107] The obtained IgG variable region sequence was cloned into the pcDNA3.4 vector fused with the antibody framework region, and the VH and VL plasmids were extracted and purified respectively, and co-transfected into 293f suspension cells for eukaryotic expression. The expression supernatant was purified by Ni-NTA pre-packed column and then identified by SDS-PAGE electrophoresis. The results are as follows Figure 5As shown in the figure, the whole porcine IgG antibody molecule pONY-10 was successfully expressed and purified. The size of the antibody VH chain was about 55 kDa, and the VL chain was about 25 kDa. The bands were clear and consistent with the expected size, without any other bands.

[0108] Figure 5 This is the electrophoresis result of SDS-PAGE detection of pONY-10 antibody expression.

[0109] 3.2.2 Indirect immunofluorescence (IFA) detection of antibody reactivity

[0110] After cells were infected with antigens of representative strains of FMDV O type lineages (O / PanAsia / Tibet / 99, O / Cathay / 18074, O / GSLX / 2010 and O / ZK / 93) and representative strains of A type lineages (A / WH / 09, A / HNXX, A / AF / 72), purified antibody pONY-10 (final concentration 5 μg / mL) was used to incubate at 4°C for binding, and then observed after labeling with anti-swine FITC fluorescent secondary antibody ( Figure 6 ). The results showed that after the BHK-21 cells were infected with a total of 7 test strains of O-type and A-type FMDV, the monoclonal antibody pONY-10 was highly reactive to the parent strain O / HNNY / 2022 and the Mya98 lineage O / GSLX / 2010 and PanAsia lineage strains O / Tibet / 99, emitting specific green fluorescence; the reaction intensity to the strains of the O-type Cathay lineage was weakened, and only a weak fluorescence signal was observed. It did not react to the representative strains of each A-type lineage. It showed the characteristics of specific binding to strains within the O-type serotype.

[0111] Figure 6 The figure shows the result of IFA detection of the reactivity of pONY-10 binding to FMDV.

[0112] 3.2.3 Indirect ELISA to detect antibody binding affinity

[0113] The ELISA plates were coated with FMDV O-type PanAsia lineage strain Tibet / 99 and parent strain HNNY / 2022 and type A purified antigen A / WH / 09 to detect the binding affinity of antibodies to different antigens. The judgment values ​​were divided according to the antibody concentration corresponding to the cut-off value, and 5 intervals were set, namely 0-0.05μg / mL, 0.05-0.1μg / mL, 0.1-1μg / mL, 1-5μg / mL, and >5μg / mL. The judgment value reaction intensity in these intervals was marked as ++++, +++, ++, +, and -.

[0114] According to the above standards, the critical antibody concentration of pONY-10 for reacting with the parent strain O / HNNY / 2022 is 0.078μg / mL, with a strength of +++; the critical concentration for reacting with other lineages of type O strains (O / Tibet / 99) is about 0.156μg / mL, with a reaction strength of ++; and the critical value for reacting with type A antigen is higher than 5μg / mL, which is judged as non-reactive ( Figure 7 The results of indirect ELISA further showed that the affinity of pONY-10 for O-type antigen was significantly higher than that for A-type antigen.

[0115] Figure 7 The figure shows the results of indirect ELISA detection of pONY-10 binding affinity.

[0116] 3.2.4 Virus cross-neutralization test

[0117] pONY-10 was tested for virus neutralization with representative strains of pan-Asian topological type O FMDV O / Tibet / 99, old strain of Mya98 O / GSLX / 2010, current epidemic strains O / HNNY / 2022 (parent strain), O / ZK / 93, Cathay strain O / 18074, and representative strains of Southeast Asian lineages (G1 and G2) and A22 of type A FMDV. The results are shown in Table 4. The neutralizing antibody titer is expressed as 50% inhibition concentration (IC 50 ), IC 50 <50μg·mL -1 Indicates neutralizing effect, IC 50 >50μg·mL -1 Indicates no neutralizing activity.

[0118] Table 4 pONY-10 antibody neutralization titer

[0119]

[0120]

[0121] The results showed that pONY-10 only neutralized the strains within the O serotype and exhibited a strong neutralization potency (IC 50 <5μg·mL -1 ). IC of neutralization of parental strain 50 The value is 0.53μg / mL, which is the IC value of the old toxin of the same lineage. 50 The value of neutralization against O / Tibet / 99 and O / ZK / 93 was 0.75μg / mL and 4.36μg / mL respectively; the effect on O-type Cathya lineage strains was weaker than that on other O-type strains, IC 50The value was 24 μg / mL, and it had no neutralizing effect on any other strain of type A virus. The data showed that pONY-10 is a specific porcine neutralizing monoclonal antibody against the O-type intragenic antigen ( Figure 8 ).

[0122] Figure 8 This is a chart showing the results of the cross-neutralization test of pONY-10 antibody strains.

[0123] 3.3 Summary

[0124] After analyzing the characteristics of the antibodies, a monoclonal antibody pONY-10 was screened and successfully expressed. The results of IFA, indirect ELISA and virus microneutralization experiments all pointed to the specific reaction of the antibody to the O-type strain. pONY-10 showed specific neutralizing effect on representative strains of each lineage of FMDV O-type serotype, and showed strong neutralizing efficacy. It did not react to type A antigen and had no neutralizing effect. The research and discovery of specific neutralizing monoclonal antibodies has important application value in the prevention and treatment of infectious diseases, the development of highly specific and sensitive diagnostic kits for the detection and monitoring of pathogens, the study of the structure and function of pathogens, and the design of vaccines.

[0125] Example 3 Identification of antigen binding sites

[0126] 4.1 Methods

[0127] 4.1.1 Screening and sequence analysis of neutralizing antibody escape mutants

[0128] 50 μL of FMDV diluted 10 times in series was mixed with 50 μL of mAbs of different concentrations (20-50 μg mL -1 ) were mixed in a 96-well microplate and then 100 μL of BHK-21 cell suspension (5×10 4 The first-generation virus was obtained from the virus inoculation well with the highest dilution that produced about 80%-100% CPE. Pressure screening was then performed in a 24-well plate. 200 μL of the first-generation virus solution was mixed with 200 μL of mAbs (40-100 μg mL -1 ) and then added 400 μL of BHK-21 cell suspension (5×10 5 cells / well) and incubated at 37°C for 24 h. The obtained virus was selected for several rounds until 200 μg mL -1 The mAbs can completely escape neutralization and obtain escape mutant strains.

[0129] Take 500 μL of the supernatant of the escape mutant strain and extract the total viral RNA according to the RNeasy Mini Kit instructions. The P1 gene of the escape mutant strain was amplified using the One-Step RT-PCR kit, with the upstream primer Pan204+: ACCTCCAACGGGTGGTACGC (SEQ ID NO.4) and the downstream primer NK61: GACATGTCCTCTTGCATCTG (SEQ ID NO.5). Amplification conditions: 50°C reverse transcription for 30 min; 94°C pre-denaturation for 2 min; 94°C denaturation for 45 s, 58°C annealing for 30 s, 72°C extension for 2 min 45 s, 35 cycles; 72°C extension for 10 min. After the amplification, it was sent to Jinweizhi Biotechnology Co., Ltd. for sequence determination. The software snapgene was used to align the sequence of the mutant P1 region with the parental virus to determine the mutated amino acid.

[0130] 4.1.2 Identification of binding sites by competitive ELISA assay

[0131] High-purity pONY-10 was biotinylated using EZ-Link Sulfo-NHS-LC-biotin reagent (Thermo Fisher Scientific, USA), and the resulting biotinylated mAb pONY-10 was named Bio-pONY-10. The ELISA plate was coated with 0.5 μg / mL E32 antibody (broad-spectrum non-neutralizing mAb) at 4°C and incubated for 14 h. It was washed three times with PBST (PBS containing 0.1 wt% Tween), and then captured at room temperature with 1 μg / mL 146S antigen diluted in 100 μL PBS for 2 hours and washed three times with PBST. Subsequently, the ELISA plate was blocked with blocking buffer (5% sucrose and 1% BSA in PBS) at 37°C for 1 h and washed three times with PBST. The serum to be tested was serially diluted in 50 μL PBS (from 1:4 to 1:512) and incubated with an equal volume of a pre-titrated dose (0.5 μg / mL) of Bio-pONY-10 in PBS solution at 37°C for 1 h. After washing 5 times with PBST, 100 μL HRP-coupled streptavidin (33 ng / mL) was added and incubated at 37°C for 30 minutes. After washing 5 times with PBST, 100 μL tetramethylbenzidine (TMB) was added to each well for color development for 15 min, and the color development reaction was terminated with 100 μL 2M H2SO4.

[0132] 4.2 Results

[0133] 4.2.1 Identification of epitopes recognized by strain-specific neutralizing antibodies

[0134] The P1 region of the structural protein of the escape mutant strain was compared with the sequence of the parent virus O / HNNY / 2022. The mutation sites are sorted out as shown in Table 5. The pONY-10 antibody escape mutant strains all have amino acid substitutions at the same site of VP2. The arginine R (Arg) at position 77 of VP2 was mutated to tryptophan W (Trp), thereby escaping the neutralization effect of the antibody. The identified site belongs to antigenic site 2, which is a conformational epitope located in the BC loop of the VP2 protein.

[0135] Table 5 Antigenic epitopes recognized by strain-specific monoclonal antibodies

[0136]

[0137] After comparing the amino acid sequences of the VP2 structural proteins of representative FMDV O-type and A-type strains, it was found that ( Fig. 9 ), the amino acid residue at position 77 of the VP2 protein of different serotypes is not exactly the same.

[0138] The amino acid at position 77 of VP2 of all lineages of O-type strains is arginine R (Arg), while the amino acid at position 77 of VP2 of A-type and Asia1-type strains is histidine H (His). This shows that the amino acid at position 77 of VP2 is conserved within the serotype. This further illustrates that the key amino acid in the epitope where the monoclonal antibody pONY-10 interacts with the antigen is located at position 77 of VP2, and that this neutralization effect is based on the specificity within the O-type serotype.

[0139] Fig. 9 This is a comparison of the VP2 sequences of representative strains of different FMDV serotypes.

[0140] 4.2.2 Competition ELISA assay to identify binding sites

[0141] Based on the existing research results in the laboratory, four monoclonal antibodies that recognize different antigenic epitopes of FMDV were selected. The epitopes recognized by these four antibodies target the FMDV VP1 GH loop, VP1 C terminus, VP2 and VP3 proteins respectively. After these four antibodies were labeled with biotin, the structural proteins recognized by pONY-10 were detected by competitive ELISA method ( Fig.10 ). The results showed that pONY-10 produced an inhibition rate of more than 50% after incubation with an antibody that recognizes the VP2 epitope, which means that the antigenic epitope recognized by pONY-10 is located in the structural protein VP2. This result is consistent with the results of the antibody escape strain screening, proving that the potential site and active residues for pONY-10 to bind to FMDV are located in the structural protein VP2. In future studies, pONY-10 will be selected as a competitive antibody to establish an ELISA method, which is expected to replace the micro-virus neutralization test for the determination of protective antibody levels in field serum samples.

[0142] Fig.10 This is a graph showing the results of competition ELISA to detect the binding sites of pONY-10.

[0143] 4.3 Summary

[0144] The key amino acid residue of the antigen recognized by pONY-10 is position 77 of the VP2 protein, which is located in the BC loop of the structural protein VP2. It is a conformational epitope and belongs to antigenic site 2. The reactivity and neutralization characteristics of pONY-10 are based on the strains within the O serotype. It does not react with the A-type antigen and is a broad-spectrum neutralizing antibody within the strain. The research and application of neutralizing monoclonal antibodies is an important branch of modern medicine and biotechnology. They play a key role in improving the efficiency of disease treatment, preventing infection and promoting the development of new drugs.

Claims

1. A broad-spectrum neutralizing porcine monoclonal antibody against foot-and-mouth disease virus type O, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

2.

2. Use of the monoclonal antibody as claimed in claim 1 to prepare a vaccine, wherein the vaccine is a vaccine for preventing and treating O serotype foot-and-mouth disease virus infection.

3. Use of the monoclonal antibody as claimed in claim 1 in preparing a kit for detecting serotype O foot-and-mouth disease virus.

4. A vaccine, characterized in that The vaccine contains the monoclonal antibody as claimed in claim 1, and is a vaccine for preventing and treating infection by serotype O foot-and-mouth disease virus.

5. A kit, characterized in that: The kit comprises the monoclonal antibody as claimed in claim 1, and the kit is a kit for detecting type O serotype foot-and-mouth disease virus.

Images