Leaf rolling regulation gene and screening method of medium-resistance rice blast high-yield rice

Abstract

The invention discloses a leaf rolling regulation gene and a screening method of medium-resistance rice blast high-yield rice. The related gene provided by the invention is a leaflet regulatory gene RL9, and the leaflet regulatory gene RL9 has at least one of substitution, deletion and addition of one or more nucleotides. According to the rice with the rolled leaf regulation gene RL9, water is not prone to accumulating on rice leaves, infection of rice blast germs can be reduced, and leaf blast resistance and neck blast resistance can be improved. Rice single plants with leaves and spike necks not prone to water accumulation are further screened in combination with field characters, and high-yield rice with medium rice blast resistance is obtained.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to a leaf rolling regulatory gene and a screening method for medium-resistant rice blast and high-yield rice. Background Art

[0002] Temperature and humidity are the most important factors for the outbreak of rice blast. When rice is in the susceptible stage, the temperature is between 20 and 30 degrees Celsius, especially between 24 and 28 degrees Celsius, there are many rainy days, the relative humidity remains above 90%, and there is more saturated humidity for more than one day and night, which can easily cause serious rice blast. On the contrary, if there is continuous sunny weather and the relative humidity is lower than 85%, the disease will be suppressed.

[0003] During the growth and development of rice, rice is most susceptible to the disease from the four-leaf stage to the peak tillering stage and the early heading stage, and the panicle neck is most susceptible to the disease at the beginning of heading stage. During this period, it is necessary to prevent water from accumulating on the leaf surface and the panicle neck, which can relatively reduce the amount of pathogens attached and reduce the chance of infection. Under the same climatic conditions, rice can be quickly dried after rain, dew, and fog to reduce the formation and spread of conidia, which can improve the resistance to rice blast.

[0004] Therefore, in the susceptible stage of rice, finding a breeding method that can slow down the infection rate of rice blast and establishing a breeding system that can slow down the infection rate of rice blast can help rice survive the susceptible stage, effectively reduce the harm caused by rice blast and ensure the smooth progress of agricultural production. This is of great significance to rice blast resistance breeding. Summary of the invention

[0005] Purpose of the invention: To solve the problem that most of the disease-resistant rice varieties currently used in production have a relatively single resistance to rice blast, and the disease resistance they have is only resistant to a few pathogen species, and they do not have general resistance. The present invention provides a method for screening a leaf rolling regulatory gene and a medium-resistant and high-yield rice with rice blast. The screening method of the present application establishes a breeding system capable of slowing down the infection rate of rice blast.

[0006] Technical solution: In a first aspect, the present application provides a leaf curling regulatory gene, which is the leaf curling regulatory gene RL9, and the leaf curling regulatory gene RL9 has at least one of substitution, deletion and addition of one or more nucleotides.

[0007] In some embodiments, the gene is the first exon region of the rolled leaf regulatory gene RL9 and has at least one of substitution, deletion and addition of one or more nucleotides.

[0008] In some embodiments, the sequence of the leaf rolling regulatory gene RL9 is shown in SEQ ID NO:2.

[0009] The second aspect of the present application provides a high-yield rice with resistance to rice blast, wherein the rice contains the above-mentioned gene.

[0010] In some embodiments, the rice has a leaf curling degree of 15-25% from the four-leaf stage to the peak tillering stage, a small leaf angle, narrow and upright leaves, narrow petioles, and smooth leaves.

[0011] In some embodiments, at the early stage of heading, the rice has an upright stem and a compact plant shape, and the ear neck is smooth and barrel-shaped without any bumps.

[0012] The third aspect of the present application provides a method for screening high-yield rice with moderate resistance to rice blast, comprising the following steps:

[0013] (1) Screening mutants by 60Co γ-ray-induced mutation and identifying rice blast induction in the mutants;

[0014] (2) The identification results select mutants that show good resistance to rice blast in the field. The mutants have a leaf curl degree of 15-25% from the four-leaf stage to the peak tillering stage, a small leaf angle, narrow and upright leaves, narrow petioles, smooth leaves, very little water accumulation on the leaves, and a fast air-drying speed; at the early stage of heading, the mutants have upright stems and compact plant shape, small bumps at the ear neck nodes, a smooth barrel-shaped ear neck without bumps, and very little water accumulation on the leaves.

[0015] In some embodiments, the screening and identification criteria for rice blast resistance are: inducing rice blast on the selected strains by evenly spraying clean water or rice blast fungus solution by drone, inspecting the water accumulation on the leaves and ear necks at regular intervals, and visually screening the strains with significantly less water accumulation and faster air-drying; further detecting the water accumulation on the leaf surface and the ear neck in the selected strains, and obtaining medium-resistant and stable rice blast-resistant high-yield rice strains by comparing the rice blast resistance with the original father variety.

[0016] Beneficial effects: The present application provides a method for screening a leaf rolling regulatory gene and a medium-resistant rice with high yield. The gene of the present application is the leaf rolling regulatory gene RL9, and the leaf rolling regulatory gene RL9 has at least one of substitution, deletion and addition of one or more nucleotides. Rice with the leaf rolling regulatory gene RL9 has rice leaves that are not prone to water accumulation, which can reduce the infection of rice blast pathogens and improve leaf blast resistance and ear neck blast resistance. Further combined with field traits, rice plants with leaves and ear necks that are not prone to water accumulation can be screened to obtain medium-resistant rice with high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the gene location and candidate gene analysis diagram of the rolled leaf mutant in this application. DETAILED DESCRIPTION

[0018] Most of the rice blast resistance of disease-resistant rice varieties used in production is relatively single, and the disease resistance they have is only resistant to a few pathogen species, and they do not have general resistance. When the physiological species that infects it becomes the dominant species, the disease resistance of the disease-resistant variety cannot be stably and permanently maintained. In order to solve the problems of the prior art, the present application provides a leaf rolling regulatory gene and a screening method for medium-resistant and high-yield rice with rice blast resistance.

[0019] The leaf rolling gene in the embodiment of the present application is obtained by inducing mutation screening, and the mutant with the leaf rolling gene is named mutant rl-z. The mutant rl-z obtained by screening has a leaf curl of 15-25% from the four-leaf stage to the peak tillering stage, a small leaf angle, narrow and upright leaves, narrow petioles, smooth leaves, very little water accumulation on the leaves, and a fast air-drying speed. At the early stage of heading, the mutant rl-z has an upright plant shape with a small bumpy feeling at the ear neck node, and the ear neck is smooth and barrel-shaped without bumpy feeling, and very little water accumulation during this period. The mutant rl-z of the present application is not easy to accumulate water in the rolling leaves, which can relatively reduce the amount of rice blast pathogens attached and reduce the chance of infection by rice blast pathogens.

[0020] In some embodiments, the induced mutation in the present application can be a physical induced mutation or a chemical induced mutation. In some embodiments, the physical induced mutation (physical mutagenesis) can select one or more of ultraviolet mutagenesis, X-ray mutagenesis, gamma ray mutagenesis, beta ray mutagenesis, alpha ray mutagenesis, and high-energy particle mutagenesis. In some embodiments, the chemically induced mutation (chemical mutagenesis) can select one or more of alkylating agent mutagenesis, azide mutagenesis, base analog mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis, and intercalating dye mutagenesis.

[0021] In some embodiments, the mutation method used in the present application is to use 60Co γ-rays to induce rice L318 to screen mutants.

[0022] In some embodiments, the method of the present application can be used to induce mutations in other rice varieties, and the screening method of the present application can be used to obtain other high-yield rice with moderate resistance to rice blast.

[0023] Example 1: 20,000 seeds of rice L318 were irradiated with 60Coγ-rays at a dose of 180Gy to obtain the M1 generation of rice L318. Rice blast induction was identified among many mutants. 23 plants were selected through field rice blast resistance screening; stable plants were obtained through self-pollination for 5 generations, and the obtained stable plants were screened and identified by the method provided in this application to obtain an optimal target mutant rl-z.

[0024] The mutant rice seeds finally obtained were hybridized with the variety Huaidao No. 5 to obtain 25 F1 seeds, and 1,600 F2 populations were planted the following year. From the four-leaf stage to the peak tillering stage, single plants with a curl between 15% and 25%, small leaf angles, narrow and upright leaves, narrow petioles, and smooth leaves were selected. At the early stage of heading, the plants with upright stems and compact plants were further selected. The spike neck nodes had a small bumpy feeling, and the spike neck was smooth and barrel-shaped, without bumpy feeling.

[0025] Screening and identification of rice blast: The selected lines were evenly sprayed with water or rice blast fungus solution by drone to induce rice blast. The water accumulation on leaves and ear necks was checked at intervals. The lines with less water accumulation and faster air drying were first selected by visual inspection. The water accumulation on the leaf surface and ear necks was further tested in the selected lines (leaf surface water accumulation test: wipe the leaves with napkins, and test the difference between wet napkins and dry napkins, which is the leaf surface water accumulation; ear neck water accumulation test: wipe the ear neck with napkins, and test the difference between wet napkins and dry napkins, which is the ear neck water accumulation). By comparing the resistance to rice blast with the original paternal variety, new rice lines with medium resistance and stable resistance to rice blast and high yield were selected. The leaf surface water accumulation of the selected single plant was only 46-59% of that of the control, and the ear neck water accumulation was only 68-82% of the control; further testing of seedling blast, leaf blast, and ear neck blast showed that the resistance to rice blast was better than that of the control variety Huaidao No. 5 (Table 1).

[0026] Table 1 Rice blast detection results

[0027]

[0028] Note: The judgment standard is the industry standard NY / T 2646-2014.

[0029] Example 2: Gene identification of mutant rl-z

[0030] The mutant rl-z was subjected to gene analysis (sequencing company: Wuhan Jingpeptide Biotechnology Co., Ltd.), and a leaf rolling candidate gene was identified through gene mapping, which was the leaf rolling regulation-related gene RL9 (LOC_Os09g23200). Primers Curl-1 to Curl-5 were designed to sequence the genome of the gene (Table 2). The results showed that there were two mutations in the first exon of the gene (as shown in SEQ ID NO: 2). The first mutation was a 36 bp base deletion (TCGACGCCGGCGGCGGCGCGTCGGCGCCGCCGCCGC) at positions 103086 to 103121 of the gene, and the second was a single base mutation at position 103524, that is, C mutated to T ( Figure 1 Figure C and Figure 1The gene is a new allele of RL9, and the allele mutation of RL9 gene may be the main reason for the formation of rolled leaves in mutant rl-z. On this basis, a co-segregation marker JY11 and JY14 were developed on both sides of the RL9 gene (Table 2).

[0031] Table 2 RL9 gene primer sequences

[0032]

[0033] The identification results showed that the mutant rl-z showed good resistance to rice blast in the field and was named mutant rl-z (rolled-leaf-z). The mutant rl-z showed dark green leaves that rolled inward into a tube shape.

[0034] Example 3: This application further conducted a reciprocal cross test on the mutant rl-z and the wild type L318. With L318 as the female parent and rl-z as the male parent, 36 F1 seeds were obtained by hybridization, and F22019 plants were planted in the second year; with rl-z as the female parent and L318 as the male parent, 62 F1 seeds were obtained by hybridization, and F21924 plants were planted in the second year. The experimental results are shown in Table 3, and the results show that regardless of whether the mutant rl-z is used as the male parent or the female parent, the leaves of the obtained F1 plants all showed normal flat shape, and the F2 population of its self-pollinated offspring showed obvious separation, and the ratio of the number of normal flat and curled leaf plants was consistent with 3:1 (Table 3). This shows that the mutant trait of curled leaves is controlled by a single recessive nuclear gene.

[0035] Table 3 F2 segregation ratios of reciprocal cross combinations of wild type and rl-z mutant

[0036]

[0037] The mutant rl-z obtained by screening in this application is conducive to improving leaf blight resistance, with small leaf angle, narrow and upright leaves, large inclination between leaves and stems, and rainwater easily slides off; petioles are narrow, and water droplets sliding off the leaves are not easy to gather at the petioles; leaves are light, and there is no fluff on the leaf surface, so water droplets are easy to roll off. The leaves are moderately curled, with a curling degree of 15-20%, forming an arch shape, which can reduce water accumulation on the leaf surface and slide off from both sides, and will not affect photosynthesis due to excessive curling. The mutant rl-z obtained by screening in this application is conducive to improving ear neck blight resistance, with an upright rice stem and compact plant type, and it is not easy for the stem, especially the ear neck, to accumulate water; the ear neck node has a small bumpy feeling, and it is not easy to accumulate too much water; the ear neck is smooth and barrel-shaped, without bumpy feeling, and the petiole of the sword leaf is narrow, and it is not easy for water to accumulate at the petiole of the sword leaf to cause infection. The mutant rl-z obtained by screening in this application is conducive to improving light conditions and improving photosynthetic efficiency. The curled leaves are conducive to keeping the leaves upright without drooping, and improving the light conditions at the base of the population. After the leaves are curled, the projection width is reduced, the shading surface is reduced, and the adverse effects on other leaves are reduced. Each leaf can be exposed to light, while the part of the upright and flat leaves parallel to the light receives very little light, and the part of the leaves perpendicular to the light seriously shades other leaves. The curled leaf surface is arc-shaped, which can refract more light, thereby increasing the scattered light within the group, which is beneficial to improving the photosynthesis of the lower leaves in the group. The morphology of the leaves, especially the morphology of the upper three functional leaves, directly affects the leaf area index and light receiving efficiency of the group. Therefore, introducing the curling trait into variety improvement can achieve a breakthrough in yield potential. The screening method of the present application is also conducive to improving the accuracy of screening high-yield rice with medium resistance and stable resistance to rice blast. Since the screening of high-yield rice with medium resistance and stable resistance to rice blast in the present application is carried out by spraying with drones, the spraying amount per unit area is uniform and unified, and the breeding of varieties will not be interfered with by the spraying amount.

Claims

1. A leaf rolling regulatory gene, characterized in that The rolled leaf regulatory gene is the rolled leaf regulatory gene RL9, and the rolled leaf regulatory gene RL9 has at least one of substitution, deletion and addition of one or more nucleotides.

2. The leaf rolling regulatory gene according to claim 1, characterized in that The first exon region of the rolled leaf regulatory gene RL9 has at least one of substitution, deletion and addition of one or more nucleotides.

3. The leaf rolling regulatory gene according to claim 1, characterized in that The sequence of the leaf rolling regulatory gene RL9 is shown in SEQ ID NO:

2.

4. A medium-resistant rice with high yield, characterized in that: The rice contains the gene according to any one of claims 1 to 3.

5. The medium-resistant and high-yield rice according to claim 4, characterized in that: From the four-leaf stage to the peak tillering stage, the rice has a leaf curling degree of 15-25%, a small leaf angle, a narrow and upright leaf, a narrow petiole, and a smooth leaf.

6. The rice blast-resistant high-yield rice according to claim 5, characterized in that: In the early stage of heading, the rice has an upright stem and a compact plant shape, and the ear neck is in a smooth barrel shape without any bumps or depressions.

7. A method for screening high-yield rice with moderate resistance to rice blast, characterized in that: The following steps are involved: (1) Screening mutants by 60Co γ-ray-induced mutation and identifying rice blast induction in the mutants; (2) The identification results select mutants that show good resistance to rice blast in the field. The mutants have a leaf curl degree of 15-25% from the four-leaf stage to the peak tillering stage, a small leaf angle, narrow and upright leaves, narrow petioles, smooth leaves, very little water accumulation on the leaves, and a fast air-drying speed; at the early stage of heading, the mutants have upright stems and compact plant shape, small bumps at the ear neck nodes, a smooth barrel-shaped ear neck without bumps, and very little water accumulation on the leaves.

8. The method for screening high-yield rice with moderate resistance to rice blast according to claim 7, characterized in that: The screening and identification criteria for the rice blast resistance are as follows: inducing rice blast on the selected strains by evenly spraying clean water or rice blast fungus solution by drone, inspecting the water accumulation on leaves and ear necks at certain intervals, and selecting strains with less water accumulation and fast air drying by visual inspection; further testing the water accumulation on the leaf surface and the ear neck in the selected strains, and obtaining a medium-resistant and high-yield rice strain by comparing the rice blast resistance with the original father variety.

Images