Method for evaluating skin properties

Abstract

The present invention addresses the problem of providing a method for evaluating the skin properties of an eye in which the formation of fine wrinkles can be predicted, and the purpose of developing a cosmetic for preventing the formation of fine wrinkles and adjusting the texture on the basis of a mechanism relating to such an evaluation method is also the purpose of developing a cosmetic for preventing the formation of fine wrinkles and adjusting the texture. The problem addressed by the present invention is that ADAMTSL6 is found as an elastic fiber formation cofactor, and the skin properties of the eyes can be evaluated using ADAMTSL6 as an index. Also provided are a method for screening for an agent for improving the skin properties of eyes using ADAMTSL6 as an index, and a novel agent for improving the skin properties.

Description

Technical Field

[0001] The present invention relates to a method for evaluating skin properties using ADAMTSL6, which promotes the formation of elastic fibers, as an indicator, and a method for screening an agent for improving skin properties using ADAMTSL6 as an indicator, and further relates to the use of ingredients selected by such a screening method. Background Art

[0002] Fine lines formed in the eyes are sometimes also called wrinkles, which are wrinkles formed in the shallow layer of the skin. As the cause of fine lines, the reduction of moisture retention function can be cited, and the formation of fine lines is promoted by dryness, ultraviolet rays, and aging. In addition, fine lines are closely related to texture (non-patent document 1), and fine lines are formed by coarsening of texture and deepening of furrows. The mesh-like pattern composed of furrows and furrows on the surface of the skin is called furrows. If the furrows are fine and uniform, it is considered to be an orderly texture. As a stratum corneum with orderly texture, the moisture retention function is high and soft, and the generation of fine lines is suppressed. On the other hand, fine lines are formed by coarsening and enlarging of texture and deepening of furrows. It is shown that the elastic fibers in the dermis are related to the formation of texture (patent document 1: Japanese Patent Publication No. 2012-117827). It can be considered that the elastic fibers that exist in the vertical direction relative to the epidermal surface support the epidermis and are directly related to the formation of texture.

[0003] Prior art literature

[0004] Patent Literature

[0005] Patent Document 1: Japanese Patent Application Publication No. 2012-117827

[0006] Non-patent literature

[0007] Non-patent literature 1: Skin Research and Technology 2015; 21: 184-191

[0008] Non-patent document 2: JBC Vol. 285, No. 7 pp. 4870-4882 Summary of the invention

[0009] Problems to be solved by the invention

[0010] The present inventors provide a method for evaluating skin properties that can predict the formation of fine lines, and further aim to develop cosmetics that prevent the formation of fine lines and regulate skin texture based on the mechanism associated with such an evaluation method.

[0011] Means for solving problems

[0012] When the present inventors attempted to clarify factors related to skin properties in the dermis, they focused on factors whose presence significantly changed with aging and explored factors related to the formation of elastic fibers. As a result, they discovered a factor called ADAMTSL6 that was strongly co-localized with acid-resistant fibers and mid-term elastic fibers. Further studies by the present inventors revealed that ADAMTSL6 was related to the formation of elastic fibers in the skin, and ADAMTSL6 was discovered as a cofactor for the formation of elastic fibers. Therefore, the present invention relates to the following scheme:

[0013] [1] A method for evaluating skin properties, wherein the gene expression level or protein level of ADAMTSL6 is used as an indicator.

[0014] [2] The evaluation method according to item 1, wherein the future formation of fine lines is predicted in the above evaluation.

[0015] [3] A method for screening a skin condition improving agent, wherein the gene expression level or protein level of ADAMTSL6 is used as an indicator.

[0016] [4] The method according to item 3, comprising the following steps:

[0017] A step of culturing fibroblasts using a medium supplemented with a candidate ingredient;

[0018] A step of measuring the gene expression level or protein amount of ADAMTSL6 in a culture medium cultured in a medium supplemented with a candidate component; and

[0019] The measured gene expression level is compared with a control, and when the gene expression level or protein level of ADAMTSL6 is enhanced, the candidate ingredient to be added is determined as a skin condition improving agent.

[0020] [5] The method according to item 4, wherein the control is a threshold value determined by the gene expression level or protein level of ADAMTSL6 in a fibroblast culture cultured in a medium to which the candidate component is not added.

[0021] [6] According to the method described in item 4 or 5, the above-mentioned skin condition improving agent can be used as at least one agent selected from the group consisting of an ADAMTSL6 expression promoter, a fibrillin 1 fiber formation promoter, an acid-resistant fiber formation promoter, a fine line improving agent, a fine line preventing agent and a texture improving agent.

[0022] [7] Use of at least one extract selected from camellia seed extract, soybean extract, longan seed extract, Euonymus japonicus extract and peach kernel extract for producing an agent for promoting expression of the ADAMTSL6 gene.

[0023] [8] Use of camellia seed extract, soybean extract, longan seed extract, Euonymus japonicus extract and peach kernel extract for preparing a microfibril formation promoter.

[0024] [9] The use according to item 8, wherein the microfibril formation promoter acts by promoting the expression of the ADAMTSL6 gene.

[0025]

[10] Use of camellia seed extract, soybean extract, longan seed extract, Euphorbia cerifera extract and peach kernel extract for preparing acid-resistant hydrolysis fiber and medium-term elastic fiber formation promoter.

[0026]

[11] The use according to item 10, wherein the agent for promoting the formation of acid-resistant fibers and mid-term elastic fibers acts via the expression of the ADAMTSL6 gene.

[0027]

[12] Use of camellia seed extract, soybean extract, longan seed extract, Euphorbia cerifera extract and peach kernel extract for manufacturing an agent for improving eye skin conditions.

[0028]

[13] The use according to item 12, wherein the above-mentioned eye skin condition improving agent acts by promoting the expression of the ADAMTSL6 gene.

[0029] Effects of the Invention

[0030] By using ADAMTSL6 as an index, skin properties can be evaluated. In addition, by using ADAMTSL6 as an index, skin property improving agents can be screened. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Fluorescence microscopic photographs showing changes in the amount of ADAMTSL6 protein due to aging. Skin samples were used: the buttocks (A) as a non-exposed area and the eyes (B) as an exposed area.

[0032] Figure 2 Fluorescence microscopic photographs showing the localization of ADAMTSL6 and fibrillin 1, and the localization of ADAMTSL6 and elastin.

[0033] Figure 3 Fluorescence microscopic images showing the localization of ADAMTSL6 and fibrillin 1 in dermal fibroblasts in which ADAMTSL6 was knocked out.

[0034] Figure 4The graph shows the changes in the gene expression level of ATAMTSL6 (THSD4) when camellia seed extract (A), soybean extract (B), longan seed extract (C), Euonymus japonicus extract (D), and peach kernel extract (E) were added to dermal fibroblasts. DETAILED DESCRIPTION

[0035] The present invention relates to a method for evaluating skin properties using ADAMTSL6 as an indicator. In addition, the present invention also relates to a method for screening a skin property improving agent using ADAMTSL6 as an indicator. Furthermore, the present invention also relates to the use of ingredients screened by such a screening method.

[0036] The skin properties evaluated by the present invention are skin properties in the area where fine lines are generated, especially skin properties in the exposed area such as the face. As the area where fine lines are generated, in particular, the eye area such as the lower eyelid and the upper eyelid can be cited, and the skin properties in these areas are evaluated. As skin properties, firmness, texture, or a property in which firmness and texture are integrated can be cited. Firmness refers to a state in which the elasticity and moisture retention function of the skin are maintained, and the formation of fine lines is suppressed in a firm state. In addition, texture is a structure composed of furrows and furrows that appear in the epidermis, which causes light scattering and contributes to transparency, etc. The skin of the eye is thin, and if the firmness of the eye is lost and becomes dry, fine lines are generated. Fine lines are wrinkles mainly generated in the epidermis of the eye, and their formation mechanism is different from deep dermal wrinkles such as the outer corner of the eye. Fine lines can be formed by coarsening the furrows composed of furrows and furrows and deepening the furrows. Skin grooves and skin bumps are formed by the support of elastic fibers running in the dermis in a perpendicular direction relative to the basement membrane. If the elastic fibers running in a perpendicular direction relative to the basement membrane are reduced, the eye loses its firmness, leading to the formation of fine lines. The firmness of the eye can also be measured using a Cutometer (skin elasticity tester), a skin torque meter, etc. In addition, the texture can also be measured using a microscope. Through the present invention, by using ADAMTSL6, a factor that promotes the formation of elastic fibers, as an indicator, it is possible to evaluate skin properties from the perspective of the inside of the skin tissue. As a result, it is possible to predict the formation of fine lines in the future.

[0037] ADAMTSL6 is a gene belonging to the ADAMTS superfamily, and is sometimes referred to as THSD4. ADAMTSL is the abbreviation of "A disintegrin and metalloproteinase with thrombospondin motifs-like" protein, and it has been reported to bind to fibrillin 1 and promote the formation of microfibrils (Non-patent document 2: JBC Vol. 285, No. 7 pp. 4870-4882). ADAMTSL6 is widely distributed in the epidermis and dermis, but is particularly concentrated in elastic fibers running perpendicular to the basement membrane ( Figure 2 ). ADAMTSL6 changes little with age in the skin of non-exposed areas (buttocks), but on the other hand, changes with age in the skin of exposed areas (lower eyelids), and its expression decreases particularly from the 30s to the 40s ( Figure 1 ). The inventors' research revealed that ADAMTSL6 co-localizes with fibrillin 1 and elastin that constitute elastic fibers, but not with all fibrillin 1 and elastin. Instead, it co-localizes with fibrillin 1 and elastin in elastic fibers that run perpendicular to the basement membrane just below the dermis, and not with fibrillin 1 and elastin that exist in the deep layer of the dermis ( Figure 2 ). Thus, ADAMTSL6 is not distributed in the entire elastic fiber, but is particularly distributed in the acid-resistant fibers just below the basement membrane and the mid-term elastic fibers connected to the acid-resistant fibers. On the other hand, it is not distributed in the deeper fibers ( Figure 2 ). It was shown that the formation of fibrillin 1 fibers was inhibited by knockdown experiments using siRNA in cultures of dermal fibroblasts ( Figure 3 ). These results and well-known technical knowledge show that ADAMTSL6 is released from dermal fibroblasts into the extracellular matrix and participates in the formation of microfibrils in the extracellular matrix, and in particular contributes to the formation of acid-resistant fibers and intermediate elastic fibers among elastic fibers.

[0038] The elastic fibers supporting the basement membrane have different properties between those immediately below the basement membrane and those deeper in the body. The elastic fibers immediately below the basement membrane are called acid-resistant fibers, while those deeper in the body are called mid-term elastic fibers. These elastic fibers are composed of elastin and microfibrils. The acid-resistant fibers have a low elastin content and are thin fibers, while the mid-term elastic fibers have a high elastin content and are thick fibers.

[0039] Microfibrils are elastic fibers also called microfibrils. They are mainly composed of fibrillin, and may contain multiple proteins as constituent elements, such as LTBP (latent TGFβ binding protein), MAGP (microfibril binding glycoprotein), MFAP (microfibril binding protein), elastin microfibril interface factor (EMILIN), and fibulin. Microfibrils are usually thin fibers, but they become thicker fibers by combining elastin with microfibrils.

[0040] Elastin is synthesized as a precursor of tropoelastin, and is gathered around and between microfibrils to form elastic fibers through cross-linking. It can be contained in connective tissue, arteries, lungs, and dermis. The acid-resistant fibers that exist just below the basement membrane have a low elastin content and form thin fibers, while the mid-stage elastic fibers that exist in deeper parts have a high elastin content and become thicker.

[0041] Acid-resistant fiber is a fiber component that provides mechanical strength in the connective tissue of an organism and is one of the elastic fibers. Elastic fibers are particularly found in abundance in organs and tissues such as skin, blood vessels, lungs, ligaments, etc. that exert mechanical pressure. Acid-resistant fiber mainly includes microfibrils and elastin, but the elastin content is low and it is mainly composed of thin microfibrils. Acid-resistant fiber exists vertically from just below the basement membrane to support the basement membrane. If the internal structure of the skin in the skin mound of the texture is observed, it can be considered that the basement membrane of the area corresponding to the skin mound is supported by a large amount of acid-resistant fiber, on the other hand, the basement membrane of the area corresponding to the furrow is not supported by acid-resistant fiber, and the structure of the skin mound and furrow that constitutes the texture is formed by the acid-resistant fiber that supports the basement membrane. In addition, by supporting the basement membrane, the skin surface can be tightened. In particular, the epidermis of the eye is thin, and the influence of the supporting structure of the basement membrane is strongly manifested. Acid-resistant fiber is connected to the mid-term elastic fiber at a deeper position. Mid-term elastic fibers are usually thicker than acid-resistant fibers. Although ADAMTSL6 is located in acid-resistant fibers and mid-term elastic fibers, it is particularly located in a large number of acid-resistant fibers. Although it is not intended to be limited to theory, it can be considered that ADAMTSL6 assists fibrillin 1 to the maturation of microfibrils and also contributes to the maintenance of acid-resistant fibers. Therefore, ADAMTSL6 can also be called an elastic fiber cofactor.

[0042] The first embodiment of the present invention relates to an evaluation method for eye firmness using ADAMTSL6 as an indicator. In particular, the gene expression or protein amount of ADAMTSL6 can be used as an indicator. Since ADAMTSL6 contributes to the formation of acid-resistant hydrolysis fibers, the higher the gene expression or protein amount of ADAMTSL6, the better the eye firmness can be determined. By comparing with one or more predetermined benchmark values, the firmness can be evaluated in multiple stages.

[0043] Eye firmness is related to the formation of fine lines and / or wrinkles, particularly formed in the eye. Therefore, the eye firmness evaluation method of the present invention can also evaluate the possibility of fine line formation now or in the future. Therefore, the present invention can relate to a method for evaluating the possibility of fine line formation using ADAMTSL6 as an indicator. For subjects with low ADAMTSL6 gene expression or protein amount, the possibility of fine lines forming in the future becomes higher.

[0044] The gene expression or protein amount of ADAMTSL6 can be measured in the obtained skin sample. As an example, for skin tissue sections, the protein of ADAMTSL6 can be quantified using an anti-ADAMTSL6 antibody. The antibody-based method can use any method known in the art such as Western blotting and immunostaining. In other examples, the gene expression amount is determined by quantifying the mRNA amount of ADAMTSL6 in the skin sample. The gene expression amount can usually be determined based on known methods such as real-time PCR.

[0045] In a further embodiment of the present invention, the present invention also relates to a method for screening an agent for improving skin properties of the eye using ADAMTSL6 as an indicator. The gene expression level or protein level of ADAMTSL6 can be used as an indicator. The screening method of the present invention more specifically comprises the following steps:

[0046] A step of culturing fibroblasts using a medium supplemented with a candidate ingredient;

[0047] A step of measuring the gene expression or protein amount of ADAMTSL6 in a culture medium cultured in a medium supplemented with a candidate component; and

[0048] The measured gene expression level or protein level is compared with a control, and when the gene expression or protein level of ADAMTSL6 is enhanced, the candidate ingredient to be added is determined as an agent for improving eye skin conditions.

[0049] The eye skin condition improver screened out in this way can promote the formation of acid-resistant fibers and / or mid-term elastic fibers just below the basement membrane by promoting the expression of ADAMTSL6, thereby adjusting the texture, inhibiting the formation of fine lines, and improving the firmness of the eye. Therefore, the eye skin condition improver can also be called an ADAMTSL6 expression promoter, a microfibril formation promoter, an acid-resistant fiber formation promoter, a fine line improver, a fine line preventive, a texture improver, and an eye firming improver. By performing such a screening method, camellia seed extract, soybean extract, longan seed extract, Eucystis extract, and peach kernel extract are screened out as eye skin condition improvers ( Figure 4 ).

[0050] The fibroblasts are particularly dermal fibroblasts. The dermal fibroblasts can be primary cultures or strained cells. In addition, the fibroblasts can be cultured alone or in a 3D cultured skin model obtained by culturing with other cells constituting the skin, such as keratinocytes, or in an organ culture. The control can use the gene expression level or protein amount in the cultures that differ only in not adding the candidate component. The gene expression level or protein amount of the control can be measured by performing an experiment in parallel with the experiment in which the candidate component is added, or it can be determined in advance.

[0051] The candidate components used in the screening method of the present invention can use any library of cosmetic raw materials, food raw materials, pharmaceutical raw materials, etc. As such a library, a compound library, an extract library, etc. can be used. The compounds and extracts contained in each library can use commercially available compounds and extracts, or can use synthesized compounds and prepared extracts.

[0052] The extract of the plant recorded in this specification can be obtained by conventional methods, for example, the plant of its origin can be immersed or heated to reflux together with the extraction solvent at room temperature or under heating, filtered, concentrated and obtained. As an extraction solvent, as long as it is a solvent used for conventional extraction, it can be used arbitrarily, for example, an aqueous solvent such as water, saline, phosphate buffer, borate buffer or an organic solvent such as ethanol, propylene glycol, 1,3-butylene glycol, glycerol, alcohols, water-containing alcohols, chloroform, ethylene dichloride, carbon tetrachloride, acetone, ethyl acetate, hexane, etc. can be used separately or in combination. As a solvent, it is preferred to use a mixed solvent of water and alcohol such as 1,3-butylene glycol. The extract obtained by extracting with the above-mentioned solvent or the extract concentrated by freeze drying can be directly used. In addition, the extract after removing impurities by adsorption method such as ion exchange resin can be used as needed, and the extract after adsorption by a column of a porous polymer (such as アンバーライト XAD-2) is further concentrated by dissolving with a desired solvent.

[0053] The camellia seed extract is an extract extracted from the seeds of Camellia japonica, which is native to Japan. It is represented by the name / INCI name: Camellia JAPONICA SEED EXTRACT in the name used in the all-ingredients name of cosmetics specified by the Japan Cosmetics Industry Association and the international name using the INCI name (International Nomenclature of Cosmetic Ingredients). It can be prepared by crushing the seeds of camellia and extracting with water, alcohol or a mixed solution thereof. Camellia seeds may be raw or dried, or fermented. As alcohol, ethanol, propylene glycol, glycerol or butylene glycol is used. It is more preferred that it can be extracted by a mixture of water and alcohol, particularly water and ethanol, water and glycerol, or water and 1,3-butylene glycol in any ratio, for example, a mixture of 10:90 to 90:10, preferably 30:70 to 70:30, and more preferably 50:50. The camellia seed extract is blended at a concentration of 0.0001% to 1%, more preferably 0.01% to 0.3%.

[0054] The so-called soybean extract is an extract extracted from the seeds of soybean (Glycine soja), and in the above-mentioned international designation, it is represented by the designation name / INCI name: GLYCINE SOJA (SOYBEAN) SEED EXTRACT. It can be prepared by crushing soybean seeds and extracting with water, alcohol or a mixed solution thereof. The soybean seeds can be unprocessed or dried, or fermented. As alcohol, ethanol, propylene glycol, glycerol or butylene glycol is used. It is more preferred that it can be extracted by a mixture of water and alcohol, especially water and ethanol, water and glycerol, or water and 1,3-butylene glycol in any ratio, such as a mixture of 10:90 to 90:10, preferably 30:70 to 70:30, and more preferably 50:50. The soybean seed extract is mixed at a concentration of 0.001% to 1%, more preferably 0.01% to 1%.

[0055] The longan seed extract is an extract extracted from the seeds of longan (Dimocarpus longan L.) native to South Asia to Southeast Asia, and is represented by the expression name / INCI name: NEPHELIUM LONGANA SEED EXTRACT in the above international designation. It can be prepared by crushing longan seeds and extracting with water, alcohol or a mixed solution thereof. The seeds may be unprocessed or dried, or fermented. As alcohol, ethanol, glycerol, propylene glycol or butylene glycol is used. It is more preferred that it can be extracted by a mixture of water and alcohol, especially water and ethanol, water and glycerol, or water and 1,3-butylene glycol in any ratio, such as a mixture of 10:90 to 90:10, preferably 30:70 to 70:30, and more preferably 50:50. The longan seed extract is mixed at a concentration of 0.001% to 1%, more preferably 0.01% to 1%.

[0056] The so-called Cystoseira tamariscifolia extract is an extract extracted from rainbow algae (Cystoseira tamariscifolia), which is a kind of brown algae growing in Europe. In the above international designation, it is represented by the designation name / INCI name: Cystoseira Tamariscifolia Extract. It can be prepared by crushing the main body of Cystoseira tamariscifolia and extracting it with water, alcohol or a mixed solution thereof. The main body of Cystoseira tamariscifolia can be unprocessed or dried, or fermented. As alcohol, ethanol, propylene glycol, glycerol or butylene glycol is used. It is more preferred that it can be extracted by a mixed solution of water and alcohol, especially water and ethanol, water and glycerol or water and 1,3-butylene glycol in any ratio, for example, a mixed solution of 10:90 to 90:10, preferably 30:70 to 70:30, and more preferably 50:50. The Eucystis extract is blended at a concentration of 0.001% to 1%, more preferably 0.01% to 1%.

[0057] The so-called peach kernel extract is an extract extracted from the seeds of peach (Prunus persica) native to China. In the above international designation, it is represented by the designation name / INCI name: Prunus Persica (Peach) Kernel Extract. It can be prepared by grinding the peach preparation and extracting it with water, alcohol or a mixed solution thereof. The preparation can be unprocessed or dried, or fermented. As alcohol, ethanol, propylene glycol, glycerol, or butylene glycol is used. It is more preferred that it can be extracted by a mixture of water and alcohol, especially water and ethanol, water and glycerol, or water and 1,3-butylene glycol in any ratio, such as a mixture of 10:90 to 90:10, preferably 30:70 to 70:30, and more preferably 50:50. The peach kernel extract is mixed at a concentration of 0.001% to 1%, more preferably 0.01% to 1%.

[0058] In the present invention, it can be used interchangeably with an eye skin condition improver, an ADAMTSL6 expression promoter, an eye firming improver, a microfibril fiber formation promoter, an acid-resistant fiber formation promoter, a fine line improver, a fine line preventer, or a texture improver. It is not intended to be limited to theory, but the eye skin condition improver selected in the screening method of the present invention promotes the expression of ADAMTSL6 in dermal fibroblasts. ADAMTSL6 associates with fibrillin 1 in the dermis to promote the formation of microfibrils. Microfibrils further introduce elastin to form acid-resistant fibers, which support the basement membrane from the dermis, thereby improving the texture and improving or preventing fine lines.

[0059] In the present invention, the eye skin property improver, ADAMTSL6 expression promoter, eye firming improver, microfibril fiber formation promoter, acid-resistant hydrolysis fiber formation promoter, fine line improver, fine line preventive agent, or texture improver can be mixed with cosmetics, medicines or quasi-drugs, respectively, and can also be mixed with foods such as nutritional supplements such as supplements. These agents can be administered orally or non-orally, such as transdermally. In the case of transdermal administration, the preparation can be a skin topical preparation. As long as the skin topical preparation can be applied to the skin, there is no particular limitation, and any dosage form such as solution, emulsified, solid, semi-solid, powdered, powdered, dispersed, water-oil two-layer separation, water-oil-powder three-layer separation, ointment, gel, aerosol, mousse, stick, etc. can be used. In the case of being prepared as a skin topical preparation, bases and excipients commonly used for skin topicals, such as preservatives, emulsifiers, pH regulators, etc., can be used. When mixed with cosmetics, it can be mixed with facial or body cosmetics such as lotions, emulsions, beauty essences, creams, lotions, masks, essences, gels, foundations, base makeup, concealers, and bath preparations, etc. By using cosmetics, pharmaceuticals, and quasi-drugs containing the components of the present invention, the texture can be maintained or improved by promoting the formation of acid-resistant hydrolyzable fibers, and the firmness of the eye area can be maintained or improved, thereby improving or preventing fine lines.

[0060] The eye skin property improver, ADAMTSL6 expression promoter, eye firming improver, microfibril fiber formation promoter, acid-resistant hydrolysis fiber formation promoter, fine line improver, fine line preventive agent, or texture improver of the present invention can arbitrarily select the concentration from the perspective of exerting the desired effect, such as maintaining or improving the firmness of the eye, or inhibiting or improving fine lines. From the perspective of mixing as a skin external preparation, the extract involved in the present invention can be further mixed with a commercially available extract at 0.0005% to 0.5%. From the perspective of fully exerting the effect, it is preferably mixed at 0.001% or more, and more preferably at 0.005% or more. From the perspective of avoiding strong odor, it is preferably mixed at 0.1% or less, and more preferably at 0.05% or less. Commercially available extracts are usually about 0.1 to 10%, preferably at a concentration of about 0.5 to 5%.

[0061] All documents mentioned in this specification are incorporated herein by reference in their entirety. The embodiments of the present invention described below are for illustrative purposes only and do not limit the technical scope of the present invention. The technical scope of the present invention is limited only by the description of the claims. Changes to the present invention, such as addition, deletion and replacement of the constituent elements of the present invention, may be made without exceeding the purpose of the present invention.

[0062] Example

[0063] Example 1: Changes in the amount of ADAMTSL6 protein due to aging

[0064] Skin samples were obtained by punch biopsy from the buttocks and outer corners of the eyes of subjects in their 20s, 30s, 40s, and 60s. The obtained skin samples were fixed using the AMeX fixation method (reference: Am J Pathol, 1986, 125-3, p431-435), embedded in paraffin, and skin sections with a thickness of 4 μm were obtained. After the usual deparaffinization treatment, the skin sections were incubated with a 200-fold diluted primary antibody (anti-ADAMTSL6 antibody (Proteintech Group Inc., 20619-1-AP) in a blocking solution (PBC containing 12% albumin from bovine serum) at 4°C overnight. Then, the sections were washed with a washing solution PBS, and then incubated with a 200-fold diluted fluorescently labeled donkey anti-rabbit IgG antibody (Lifetechnologies, R37119) as a secondary antibody in the dark at room temperature for 1 hour. The secondary antibody was washed with PBS. Finally, the slide sample was sealed with a cover glass after adding the sealing agent Vectashield (Vector Laboratories) containing DAPI, and then observed under a fluorescence microscope ( Figure 1 ).

[0065] Example 2: Localization of ADAMTSL6

[0066] A skin sample was obtained from the subject's buttocks by punch biopsy, and the obtained skin sample was fixed using the AMeX fixation method, embedded in paraffin, and a skin section with a thickness of 4 μm was obtained. After the usual deparaffinization treatment, the skin sections were incubated with primary antibodies (anti-ADAMTSL6 antibody (Proteintech, 20619-1-AP) and anti-elastin antibody (Abcam, ab77804), (anti-ADAMTSL6 antibody (Proteintech, 20619-1-AP) and antigen fibrillin 1 antibody (Thermo Fisher Scientific)) diluted 200 times in a blocking solution (PBC containing 12% albumin derived from bovine serum) at 4°C overnight. Then, the sections were washed with a washing solution PBS, and then incubated with 200-fold diluted fluorescently labeled donkey anti-rabbit / mouse IgG (Lifetechnologies, R37119) and fluorescently labeled donkey anti-mouse IgG antibody (Lifetechnologies, R37114) as secondary antibodies in the dark at room temperature for 1 hour. The secondary antibodies were washed with PBS. Finally, the mounting agent Vectashield (Vector Biosystems) containing DAPI was added. Laboratories) sealed the slide sample with a cover glass and observed it under a fluorescence microscope ( Figure 2 ).

[0067] Example 3: Knockdown of ADAMTSL6

[0068] In the culture of dermal fibroblasts (Biopredic International), siRNA (ThermoFisher Scientific, Silencer select (registered trademark) siRNA) was used to inhibit the gene expression of ADAMTSL-6. Dermal fibroblasts were cultured at 1×10 5Cells / well were seeded and cultured overnight at 37°C / 5% CO2. 1 mL / well of a culture medium containing a mixture of siRNA and transfection reagent (Lifetechnologies, 13778) was added to the cells to introduce siRNA, and the cells were cultured for 3 days. Quantitative PCR was performed on the cells into which siRNA had been introduced, and it was confirmed that the expression of the target gene was inhibited (data not shown). In the dermal fibroblast culture, anti-ADAMTSL-6 antibody (Proteintech) and antigen fibrillin 1 antibody (Thermo Fisher Scientific) were used as primary antibodies, and fluorescently labeled donkey anti-rabbit / mouse IgG (Lifetechnologies, R37119) and fluorescently labeled donkey anti-mouse IgG antibody (Lifetechnologies, R37114) were used as secondary antibodies to stain the dermal fibroblast culture ( Figure 3 ). When the gene expression of ADAMTSL-6 was suppressed, fibrillin 1 fiber formation was inhibited.

[0069] Example 4: Screening of candidate drugs that increase ADAMTSL-6 expression

[0070] Fibroblasts were cultured at 7 x 10 4 Cells / 1mL were seeded in 12-well plates and cultured at 37°C in a 5% CO2 atmosphere for 48 hours. As candidate drugs, 0.07% camellia seed extract (butylene glycol extraction), 0.3% soybean extract (butylene glycol extraction), 0.1% longan seed extract (butylene glycol extraction), 0.1% Eucystis extract (glycerol extraction), and 0.1% peach kernel extract (ethanol extraction) were added, and the cells were recovered after culturing at 37°C in a 5% CO2 atmosphere for 24 hours. DMSO was used for the dilution of the candidate drug. In the control group, the cultured cells were recovered under the same conditions except that no extract was added. The recovered cells were washed with PBS, RNA was extracted using RNeasy Mini Kit (Qiagen), and reverse transcription reaction was performed using Super ScriptVILO (Thermo Fisher Scientific). The reverse transcribed nucleic acid was subjected to quantitative PCR using the following primer set, Platinum (registered trademark) SYBR (registered trademark) green qRCR SuperMix-UDG with ROX (ThermoFisher Scientific), and StepOne (registered trademark) plus (Applied Biosystems). The results are shown in Figure 4In the case of adding camellia extract, soybean extract, longan seed extract, Eucystis extract and peach kernel extract respectively, the gene expression of ADAMTSL-6 was enhanced, and these ingredients were screened as ADAMTSL-6 expression promoters. In addition, glyceraldehyde 3-phosphate dehydrogenase (G3PDH) was used as the internal standard gene for the gene expression of THSD4 when camellia extract and soybean extract were added. β-actin (ACTB) was used as the internal standard gene for the gene expression of THSD4 when longan seed extract, Eucystis extract and peach kernel extract were added. ADAMTSL-6 expression promoters can be used as eye firming improvers, fibrillin 1 fiber formation promoters, acid-resistant fiber formation promoters, mid-term elastic fiber formation promoters, fine line formation inhibitors, fine line improvers, fine line preventive agents, and texture improvers.

[0071] Table 1

[0072] Primer name sequence THSD4-F CCTGGCAAGTATGGCTATGGT (sequence number 1) THSD4-R CCATGCCTAGCAGAAGATGC (sequence number 2) G3PDH-F GAAGGTGAAGGTCGGAGTC (sequence number 3) G3PDH-R GAAGATGGTGATGGGATTTC (sequence number 4) ACTB-F GCATGGGTCAGAAGGATTCCT (sequence number 5) ACTB-R TCGTCCCAGTTGGTGACGAT (sequence number 6)

Claims

1. A method for evaluating skin properties, wherein: The gene expression level or protein level of ADAMTSL6 was used as an indicator. 2 . The evaluation method according to claim 1 , wherein the future formation of fine lines is predicted in the evaluation.

3. A method for screening a skin property improving agent, wherein: The gene expression level or protein level of ADAMTSL6 was used as an indicator.

4. The method according to claim 3, comprising the following steps: The step of culturing fibroblasts using a medium supplemented with a candidate ingredient; A step of measuring the gene expression level or protein amount of ADAMTSL6 in a culture medium cultured in a medium supplemented with a candidate component; and The measured gene expression level is compared with a control, and when the gene expression level or protein level of ADAMTSL6 is enhanced, a candidate ingredient to be added is determined as an agent for improving eye skin conditions. 5 . The method according to claim 4 , wherein the control is a threshold value determined by the gene expression level or protein level of ADAMTSL6 in a fibroblast culture cultured in a medium to which the candidate component is not added.

6. The method according to claim 4, wherein the eye skin condition improving agent can be used as at least one agent selected from the group consisting of an ADAMTSL6 expression promoter, a fibrillin 1 fiber formation promoter, an acid-resistant fiber formation promoter, a fine line improving agent, a fine line preventing agent, and a texture improving agent.

7. Use of at least one extract selected from the group consisting of camellia seed extract, soybean extract, longan seed extract, Euonymus japonicus extract and peach kernel extract for producing an agent for promoting expression of the ADAMTSL6 gene.

8. Use of camellia seed extract, soybean extract, longan seed extract, Eucystis ulmoides extract and peach kernel extract for preparing a microfibril formation promoter. 9 . The use according to claim 8 , wherein the microfibril formation promoter acts by promoting the expression of the ADAMTSL6 gene.

10. Use of camellia seed extract, soybean extract, longan seed extract, Eucommia ulmoides extract and peach kernel extract for producing acid-hydrolysis-resistant fiber and mid-term elastic fiber formation accelerator.

11. The use according to claim 10, wherein the agent for promoting the formation of acid-resistant fibers and mid-term elastic fibers acts by promoting the expression of the ADAMTSL6 gene.

12. Use of camellia seed extract, soybean extract, longan seed extract, Euonymus japonicus extract and peach kernel extract for preparing an agent for improving eye skin properties. 13 . The use according to claim 12 , wherein the eye skin condition improving agent acts by promoting the expression of the ADAMTSL6 gene.

Images