Primer pair of SNP marker related to mycoplasmal pneumonia resistance trait on pig chromosome 15 and application thereof
By developing SNP markers and primer pairs on pig chromosome 15, and utilizing PCR amplification and sequencing technologies, the problem of assessing pig herd tolerance traits in traditional breeding methods has been solved. This has enabled the rapid screening of pig populations with strong tolerance, thereby improving the tolerance and economic benefits of pig herds.
Patent Information
- Application Number
- CN202411484344.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-23
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-10-23
AI Technical Summary
Traditional methods are insufficient to effectively improve the tolerance of pigs to mycoplasma pneumonia, resulting in slow progress in genetic improvement. Furthermore, existing technologies are not capable of quickly and accurately assessing the tolerance traits in pigs.
We developed SNP markers and primer pairs on pig chromosome 15 that are associated with mycoplasma pneumoniae tolerance in pigs. Through PCR amplification and sequencing, we detected polymorphisms at specific nucleotide sites in the pig genome and screened out pig populations with strong tolerance.
This enabled rapid and accurate assessment of pig tolerance traits, improved the pig herd's tolerance to mycoplasma pneumonia, and enhanced breeding efficiency and economic benefits.
Smart Images

Figure CN119265312B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology, and relates to a SNP marker primer pair related to a pig tolerance mycoplasma pneumonia trait and application thereof. BACKGROUND
[0002] Globally, pig mycoplasma pneumonia has caused huge economic losses to the pig industry, and mycoplasma pneumonia seriously affects the production indexes such as pig feed intake and daily weight gain. The lungs are easily invaded by environmental pathogens, leading to lung diseases, usually accompanied by lung lesions, and even causing the death of pigs. The tolerance mycoplasma pneumonia trait is a complex trait, and has low heritability and many influencing factors. Therefore, it is difficult to directly select the pig population tolerance mycoplasma pneumonia trait by traditional methods. The traditional method is low in efficiency and slow in genetic improvement progress. In recent years, with the development of molecular genetics and genomics, researchers have begun to use the association between single nucleotide polymorphism (SNP) markers and pig traits to solve this problem. The SNP marker is a common genomic genetic marker, which has the advantages of high polymorphism and wide distribution in the genome, and therefore becomes an important tool for studying pig genetic traits.
[0003] Based on this background, the present application provides a SNP marker primer pair related to the tolerance mycoplasma pneumonia trait as a complex trait, which has low heritability and many influencing factors. The trait can be quickly and accurately evaluated by genotyping technology to assess the pig's tolerance to mycoplasma pneumonia. This technology not only reduces the cost of production and improves the tolerance of pigs to mycoplasma pneumonia, but also provides an important molecular genetic basis for pig breeding and improvement. SUMMARY
[0004] The purpose of the present application is to provide a breeding molecular marker related to the SNP marker developed for the pig tolerance mycoplasma pneumonia, in view of the slow effect and small progress of traditional pig tolerance mycoplasma pneumonia breeding.
[0005] Another purpose of the present application is to provide a primer pair and a detection method for detecting the above-mentioned SNP marker. Another purpose of the present application is to provide the use of the above-mentioned SNP marker, molecular marker and primer.
[0006] The purpose of the present application can be achieved by the following technical solutions:
[0007] The molecular marker related to the pig tolerance to mycoplasma pneumonia on pig chromosome 15, wherein the sequence of the molecular marker is shown in SEQ ID NO:1, and the SNP marker site related to the pig tolerance to mycoplasma pneumonia is the international pig genome 11.1 version reference sequence pig-chromosome 15 rs1110963643 nucleotide site, and the SNP marker site is located at the 234th position in SEQ ID NO:1, and the T / C polymorphism exists.
[0008] A primer pair for detecting the SNP marker related to the pig tolerance to mycoplasma pneumonia on pig chromosome 15, wherein the upstream primer is tatgtgcggtaactcagcca (SEQ ID NO:2), and the downstream primer is tctttgcactgggggtaatgg (SEQ ID NO:3).
[0009] The molecular marker and the primer pair can be applied to the detection of the pig tolerance to mycoplasma pneumonia and pig breeding.
[0010] A method for detecting the SNP marker related to the pig tolerance to mycoplasma pneumonia on pig chromosome 15, comprising the following steps: PCR amplifying a sequence of the international pig genome 11.1 version reference sequence pig-chromosome 15 rs1110963643 nucleotide site, and sequencing the amplification product to determine the T / C polymorphism of the site.
[0011] As a preferred embodiment of the present application, the pig is a Pietrain pig.
[0012] As a preferred embodiment of the present application, the primer pair is used for PCR amplification of the genomic DNA of the Pietrain pig.
[0013] As a further preferred embodiment of the present application, the method comprises the following steps:
[0014] (1) extracting DNA from pig ear tissue samples;
[0015] (2) using the extracted pig genomic DNA as a template, and using the primer pair to perform PCR amplification;
[0016] (3) sequencing the amplification product, analyzing the sequencing result, and determining the T / C polymorphism at the 234th position in SEQ ID NO:1.
[0017] The molecular marker can be applied to screening of pig populations or new strains with stronger tolerance to mycoplasma pneumonia.
[0018] The primer pair of the application is used in screening pig population or new strain with stronger ability of tolerating mycoplasma pneumonia.
[0019] A method for screening pig population with stronger ability of tolerating mycoplasma pneumonia, comprising detecting the genotype of the nucleotide site rs1110963643 of pig chromosome 15 in the international pig genome 11.1 version reference sequence, and breeding the individual with TT type of the nucleotide site rs1110963643 as the reserve boar.
[0020] As a preferred embodiment of the application, the pig breed used is Pietrain.
[0021] As a preferred embodiment of the application, the method for detecting the genotype of the nucleotide site rs1110963643 of pig chromosome 15 in the international pig genome 11.1 version reference sequence is selected from PCR or gene sequencing.
[0022] Advantages
[0023] The application develops the SNP marker on pig chromosome 15 associated with the ability of pigs to tolerate mycoplasma pneumonia, and provides a primer pair and a method for detecting the marker. The SNP marker provided by the application can be applied to marker-assisted selection of the trait of pigs tolerating mycoplasma pneumonia, and the pig population or strain with the trait of tolerating mycoplasma pneumonia is screened by identifying the genotype of the SNP marker. The establishment of the population or strain can improve the ability of pigs to tolerate mycoplasma pneumonia, and generate more social and economic benefits. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 The gel map of PCR amplification of the site rs1110963643 of pig chromosome 15 of Pietrain.
[0025] Figure 2 The genotyping diagram of the site rs1110963643 of pig chromosome 15 of Pietrain.
[0026] Note: the genotype of A is TT type, the genotype of B is TC type, and the genotype of C is CC type. DETAILED DESCRIPTION
[0027] The following examples are used to illustrate the application, but not to limit the scope of the application. Modifications or replacements of the method, steps or conditions of the application, without departing from the spirit and essence of the application, all belong to the scope of the application.
[0028] Example 1
[0029] 1 Data source
[0030] The data used is derived from the slaughter data records of Kunshan Meishan Pig Breeding Co., Ltd. After slaughter, the proportion of lung lesion area is calculated, and the seven lung lobes of the pig are scored as phenotypes: the lesion area proportion of each lung lobe is 0%, 1-25%, 26-50%, 51-75%, 76-100%, respectively, and the scores are 0, 1, 2, 3, 4, respectively. The total score of the seven lung lobes is 28.
[0031] 2 Extraction of pig genomic DNA
[0032] Collect 1 ear tissue sample from each of the 56 Meishan pigs for individual DNA extraction;
[0033] According to the instructions of the tissue DNA extraction kit of Tian Gen Biological Technology Co., Ltd., the extraction steps are as follows:
[0034] ① First, add 68 mL and 200 mL of anhydrous ethanol to buffer GD and rinse PW, respectively, and mix thoroughly.
[0035] ② Collect about 100 mg of ear tissue sample in a 2 mL EP tube, cut it into small pieces, add 200 μL of buffer GA, and shake until it is completely suspended.
[0036] ③ Add 20 μL of proteinase K solution, mix well, and place in a 56°C water bath for overnight digestion until the tissue sample is dissolved. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0037] ④ Add 200 μL of buffer GB, mix well by inverting, and place in a 70°C metal bath for 10 min. The solution should be clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0038] ⑤ Add 200 μL of anhydrous ethanol, mix well by shaking for 15 sec. At this time, a flocculent precipitate may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0039] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3. Place the adsorption column in a collection tube, then centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 back into the collection tube.
[0040] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 into the collection tube
[0041] ⑧ Add 600 μL of rinse PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 into the collection tube.
[0042] ⑨ Repeat step ⑧.
[0043] 10. Put the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Put the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.
[0044] Put the adsorption column CB3 into a clean centrifuge tube, and add 100 μL elution buffer TE to the middle of the adsorption membrane by dripping. Place it at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, and add the centrifuged solution to the adsorption column CB3 again. Place it at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube.
[0045] Use the Nanodrop-2000 spectrophotometer to detect the mass and concentration of the DNA. Dilute the DNA concentration to 50 ng / μL, and store it at -20℃ for standby use.
[0046] 3. PCR amplification and sequencing of the target fragment
[0047] Use the pig genome DNA as the template for PCR amplification. The reaction system includes 1 μL of DNA template, 1 μL of each primer shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 22 μL of PCR mix. The amplification program is as follows:
[0048]
[0049] Perform agarose gel electrophoresis on the amplification product. The product fragment size is about 495 bp, and the electrophoresis result is shown in Figure 1 . Sequence the remaining amplification product, use DNAman software to verify the accuracy of the sequence, and use Chromas software to determine the genotype of the rs1110963643 site.
[0050] 4. Statistical analysis
[0051] Use the editor of SAS 9.4 software to run the code for genotype and phenotype association analysis. The code is as follows:
[0052]
[0053] 5. Results
[0054] Table 1 shows the results of the influence of different genotypes of the rs1110963643 site on the ability of Pime pigs to tolerate mycoplasma pneumonia. The results show that the genotype of the rs1110963643 site is significantly associated with the total score of the lung lesion area ratio (P < 0.001). Among them, the total score of the lung lesion area ratio of the TT type individual is significantly lower than that of the CC type individual (P < 0.001), indicating that the tolerance of the TT type individual to mycoplasma pneumonia is significantly greater than that of the CC type individual (P < 0.001); the total score of the lung lesion area ratio is significantly different between the TT type and the TC type and the CC type (P < 0.05), and the tolerance of the TT type and the TC type and the CC type to mycoplasma pneumonia is also significantly different (P < 0.05). Therefore, in Pime pigs, selecting and breeding the TT type of the rs1110963643 site can help to increase the tolerance of the Pime pig population to mycoplasma, and thus improve the economic benefit and disease resistance of Pime pigs.
[0055] Table 1 Association analysis of pig chromosome 15 rs1110963643 site and lung lesion area after slaughter
[0056]
[0057] Note: The same row number with different letters indicates a significant difference (P < 0.001).
Claims
1. A method for detecting SNP markers associated with the trait of porcine mycoplasma-resistant pneumonia, characterized in that, The sequence of the nucleotide site rs1110963643 of the international pig genome 11.1 version reference sequence of pig chromosome 15 is amplified by PCR, the amplification product is sequenced, and the T / C polymorphism of the site is determined; The molecular marker sequence is shown as SEQ ID NO:1, the international pig genome 11.1 version reference sequence of pig chromosome 15 rs1110963643 nucleotide site is located at position 234 in SEQ ID NO:1, and there is a T / C polymorphism, the tolerance of TT type individuals to mycoplasma pneumonia is significantly greater than that of CC type individuals; The pig is a Pietrain pig.
2. The method of claim 1, wherein, The method comprises the following steps: (1) extracting total DNA from a pig tissue sample; (2) using the extracted pig genomic DNA as a template, performing PCR amplification using a primer pair, wherein the upstream primer is SEQ ID NO:2, and the downstream primer is SEQ ID NO:3; (3) sequencing the amplification product, analyzing the sequencing result, and determining the T / C polymorphism at position 234 of SEQ ID NO:
1.
3. Use of a molecular marker, of a pair of primers for detecting said molecular marker, for screening a population of pigs resistant to mycoplasmal pneumonia, characterized in that, TT type individuals of the rs1110963643 nucleotide site are preferentially selected as breeding pigs, the pig is a Pietrain pig, the molecular marker sequence is shown as SEQ ID NO:1, the international pig genome 11.1 version reference sequence of pig chromosome 15 rs1110963643 nucleotide site is located at position 234 in SEQ ID NO:1, and there is a T / C polymorphism, the tolerance of TT type individuals to mycoplasma pneumonia is significantly greater than that of CC type individuals.
4. A method of screening a population of pigs for tolerance to Mycoplasmal pneumonia, characterized in that, The method comprises detecting the genotype of the rs1110963643 nucleotide site of the international pig genome 11.1 version reference sequence of pig chromosome 15, and preferentially selecting TT type individuals of the rs1110963643 nucleotide site as breeding pigs, wherein the pig is a Pietrain pig.
Citation Information
Patent Citations
Method for discriminating virus resistance in pigs and its use
JP2021171055A