A method for using the ERC1 gene as a molecular marker for superovulation in bovine animals

Abstract

This invention discloses a method for using the ERC1 gene as a molecular marker for the superovulation trait in cattle, belonging to the field of animal trait detection genetic engineering technology. The nucleotide sequence length of the ERC1 gene fragment is 520 bp, with a c-t base mutation at position 293 bp. This mutation site is used as a molecular marker, and genotype is determined by sequencing. Genotype can be associated with the superior superovulation trait in cattle, showing significant differences in superovulation performance among individuals with different genotypes. This invention utilizes specific primers to obtain a partial fragment of the ERC1 gene associated with the superior superovulation trait in cattle, and uses specific SNP sites within the fragment as molecular markers, providing a theoretical basis and practical application for marker-assisted selection in cattle.

Description

Technical Field

[0001] This invention provides a method for using the ERC1 gene as a molecular marker for superovulation traits in cattle, specifically involving the cloning of bovine ERC1 gene fragments and their application in marker-assisted selection in cattle, belonging to the field of animal trait detection genetic engineering technology. Background Technology

[0002] Superovulation can yield more high-quality embryos suitable for transplantation, maximizing the utilization of superior breeding stock. Superovulation combined with embryo transfer not only fully leverages the breeding value of superior females but also effectively accelerates the genetic improvement process in livestock. However, the effectiveness of superovulation is influenced by various factors, such as hormone dosage and treatment time, the season of superovulation, and changes in the external environment. Furthermore, the most fundamental influencing factor—the individual's own genetic factors—significantly limits the success of superovulation.

[0003] Numerous studies have demonstrated a close link between individual genetic polymorphisms and animal production and reproductive capacity. Among genetic polymorphisms, single nucleotide polymorphisms (SNPs) are widely used in livestock-related scientific research (Uimari et al., 2011; Yadav et al., 2021). Many studies have found that SNPs play an important regulatory role in the reproductive traits of livestock, including superovulation effects (Yang et al., 2010).

[0004] Previous studies have shown that ERC1 is associated with cognitive impairment (Cong et al., 2020), and other studies have found that ERC1 is associated with animal meat quality and carcass traits (Wimmers et al., 2007). In the field of reproduction, ERC1 SNPs have been found to be closely associated with complete hydatidiform mole (Yu et al., 2017), but it is unclear whether it affects superovulation and subsequent embryo transfer outcomes. Summary of the Invention

[0005] This invention provides a method for using the ERC1 gene as a molecular marker for the superovulation trait in cattle. By identifying its specific mutation sites, it serves as a method for detecting polymorphisms in genes related to superovulation performance in cattle. The aim is to provide a meaningful molecular marker for marker-assisted breeding in cattle.

[0006] The present invention describes a method for using the ERC1 gene as a molecular marker for bovine superovulation traits. The 520bp sequence of the bovine superovulation performance-related gene ERC1 is shown in Table SEQ ID NO: 1.

[0007] The obtained ERC1 gene fragment has a base mutation of ct at position 293 as described in SEQ ID NO: 1, resulting in a single nucleotide polymorphism (SNP).

[0008] The present invention discloses a method for screening molecular markers suitable for bovine superovulation traits, the preparation method comprising:

[0009] By designing the following pair of specific primers:

[0010] Forward primer ERC1-fwd (SEQ ID NO: 2): aatacatcacagtgccgacag;

[0011] Reverse primer ERC1-rev (SEQ ID NO: 3): ttctcagatacctgcgatttcc;

[0012] Genomic DNA was extracted from bovine blood and amplified by PCR. A SNP polymorphism was generated due to a ct base mutation at position 293 of the PCR product DNA sequence, which was used to determine the specific genotype. Association analysis between the different genotypes revealed by the detection results and the bovine superovulation trait showed that individuals with specific genotypes achieved better superovulation.

[0013] The present invention will now be described in detail:

[0014] I. Cloning of the bovine ERC1 gene fragment

[0015] A pair of specific primers was designed using the biological software Oligo 6.0. The PCR reaction conditions were established as follows:

[0016] Forward primer: ERC1-fwd (SEQ ID NO: 2): aatacatcacagtgccgacag;

[0017] Reverse primer: ERC1-rev (SEQ ID NO: 3): ttctcagatacctgcgatttcc;

[0018] This invention uses MonAmp™ ChemoHS qPCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (both at a concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0019] II. PCR Product Sequencing and Genotype Determination

[0020] A specific amplified fragment of 520 bp was obtained by amplifying bovine genomic DNA using primers ERC1-fwd and ERC1-rev. Figure 1 (and SEQ ID NO: 1). Sequencing results revealed that in this 520bp fragment, a mutation in ct at position 293bp led to the generation of different genotypes: CC, CT, and TT. Specifically, CC-type individuals were homozygous for c at position 293; CT-type individuals were c / t heterozygous at position 293; and TT-type individuals were homozygous for t at position 293. Figure 2 ).

[0021] III. Marker-based trait association analysis

[0022] Using the available experimental population as the experimental subjects, trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:

[0023] The statistical analysis model is: Y ij =μ+G i +e j ;

[0024] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.

[0025] The positive effects of this invention are as follows: by conducting an association analysis between the genetic polymorphism of the ERC1 gene and the superovulation trait in cattle, the specific SNPs of ERC1 and their accurate identification methods are identified, and the influence of the genetic polymorphism of this site on superovulation in cattle is determined. This helps to use it as an important molecular marker for auxiliary selection of embryo production and reproductive performance in cattle and apply it to cattle genetic improvement. Attached Figure Description

[0026] Figure 1 The results are from 1.5% agarose gel electrophoresis of the ERC1 gene amplification products; (lane M is the standard molecular weight marker, and lanes 1-7 are 7 randomly detected PCR products, which have a clear and specific band at the 520bp position).

[0027] Figure 2 These are sequencing peak diagrams of PCR products from three different genotypes; (the arrows indicate mutation sites. In CC genotype individuals, this site is a c base; in CT genotype individuals, this site is a c / t base; and in TT genotype individuals, this site is a t base).

[0028] Figure 3 The results are obtained by 1.5% agarose gel electrophoresis of the ERC1 gene amplification products in Example 1; (lane M is the standard molecular weight marker, and lanes 1-6 are 6 randomly detected PCR products, which have a clear and specific band at the 520bp position).

[0029] Figure 4 This is a sequencing peak diagram of the PCR products of the three genotypes in Example 1; (the arrows indicate the mutation sites. For CC genotype individuals, this site is a c base; for CT genotype individuals, this site is a c / tT base; for TT genotype individuals, this site is a t base). Detailed Implementation

[0030] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention. Example 1

[0031] Using extracted bovine genomic DNA as a template, a pair of specific primers were designed to clone a partial DNA sequence of the bovine ERC1 gene. Sequencing and genotyping were performed, and association analysis between different genotypes and superovulation traits was conducted to provide molecular markers for marker-assisted selection in cattle.

[0032] I. Cloning of a partial DNA fragment of the bovine ERC1 gene

[0033] To ensure good primer quality, the primers in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences are shown below:

[0034] Forward primer: ERC1-fwd (SEQ ID NO: 2): aatacatcacagtgccgacag;

[0035] Reverse primer: ERC1-rev (SEQ ID NO: 3): ttctcagatacctgcgatttcc;

[0036] The Taq enzyme, buffer, magnesium ions, dNTPs, etc. required in the PCR reaction can be selected by the user. To obtain good results quickly, this invention uses the 2× chemical dye quantitative PCR premix from MonAmp™ ChemoHS qPCR Mix for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0037] II. PCR Product Sequencing and Genotype Determination

[0038] A 520 bp specific amplified fragment was obtained by amplifying bovine genomic DNA using primers ERC1-fwd (SEQ ID NO: 2) and ERC1-rev (SEQ ID NO: 3). Figure 1 And SEQ ID NO:1). Sequencing results revealed that in this 520bp fragment, a mutation in ct at position 293bp led to the generation of different genotypes: CC, CT, and TT. Specifically, CC-type individuals were homozygous for c at position 293; CT-type individuals were c / t heterozygous at position 293; and TT-type individuals were homozygous for t at position 293. Figure 2 );

[0039] III. Marker-based trait association analysis

[0040] Using the applicant's experimental population as the experimental subjects, a trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:

[0041] The statistical analysis model is: Y ij =μ+G i +e j Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j These are the random residuals corresponding to the observed values;

[0042] IV. Cloning of partial DNA sequences of the bovine ERC1 gene and determination of different genotypes

[0043] The PCR amplification products were detected by 1.5% agarose gel electrophoresis and showed to be specific PCR products, such as... Figure 3 As shown in the image. The PCR product was recovered and sequenced, revealing a product length of 520 bp. Sequencing results showed a ct base mutation at 293 bp in this fragment, with some sequencing peaks as shown in the image. Figure 4 As shown;

[0044] V. Conduct association analysis on marker traits

[0045] The association analysis of the 293rd locus of the amplified fragment of the bovine ERC1 gene with the superovulation trait in this invention showed that there were significant differences in the number of usable embryos per head and the total number of embryos per head among individuals with different genotypes at this locus (P<0.05), indicating that the genetic polymorphism at this locus has an impact on the superovulation effect in cattle.

[0046] Conclusion: This invention provides an important theoretical basis for using this locus as a molecular marker for auxiliary selection of bovine reproductive and production performance and for application in genetic improvement, and has good application prospects. Example 2

[0047] Ninety-two individuals were randomly selected from the superovulation herd of cows at Hebei Tianhe Beef Cattle Breeding Co., Ltd. Blood samples were collected for genomic DNA extraction, and PCR amplification was performed using primers, a PCR reaction system, and conditions designed in this invention. PCR amplification was performed using 2× chemical dye-based quantitative PCR premix from MonAmp Biotechnology Co., Ltd. The specific reaction system consisted of: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of primers ERC1-fwd (SEQ ID NO: 2) and ERC1-rev (SEQ ID NO: 3) (both at a concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions were: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0048] The amplification products were detected by 1.5% agarose gel electrophoresis, and the results showed that they were specific PCR products. Figure 3As shown, lane M is the standard molecular weight marker, and lanes 1-6 are the PCR products being tested. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results showed that among all individuals tested, 53 individuals belonged to the CC type; 21 individuals belonged to the CT type; and 18 individuals belonged to the TT type.

[0049] Based on the superovulation records of these 92 individuals, correlation analysis was performed using SPSS 22.0 software and a One-Way ANOVA procedure. ij =μ+G i +e j Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.

[0050] The association analysis results (mean ± standard error) between the number of usable embryos per head and the total number of embryos per head in different genotypes and superovulation traits for these 92 individuals are shown in Table 1.

[0051] Table 1. Results of analysis on significant differences in superovulation traits among individuals with different genotypes

[0052]

[0053] Note: Different letters on the shoulder labels of different groups indicate significant differences (P<0.05).

[0054] The analysis results show that individuals with different genotypes at this locus have significant differences in superovulation traits, with TT genotype individuals exhibiting better superovulation traits than CT and CC genotypes.

[0055] Association analysis of the amplified sequence of the bovine ERC1 gene at polymorphic site 293 with the superovulation trait showed that among 149 randomly selected individuals, 92 were CC genotype, 42 were CT genotype, and 15 were TT genotype. The results (mean ± standard error) of the analysis of significant differences (mean ± standard error) between individuals with different genotypes in the number of usable embryos per head and the number of total embryos per head are shown in Table 2.

[0056] Table 2. Results of analysis of significant differences in superovulation traits among individuals with different genotypes

[0057]

[0058] Note: Data from different groups are indicated by different letters on the superscript to show significant differences (P<0.05). Average number of usable embryos per head = total number of usable embryos obtained from multiple superovulation treatments / number of superovulation treatments; Average total number of embryos per head = total number of embryos obtained from multiple superovulation treatments / number of superovulation treatments.

[0059] The analysis results show that there are significant differences in superovulation traits among individuals corresponding to different genotypes at this SNP locus. Overall, TT-type individuals have better superovulation outcomes than CT or CC-type individuals. When selecting superovulation donors, TT-type individuals should be given priority, while CC-type individuals should be avoided as much as possible.

Claims

1. The use of primers of a molecular marker related to the superovulation trait of cattle in the preparation of a preparation for detecting the superovulation trait of cattle, characterized in that: the sequence of the molecular marker is shown as SEQ ID NO: 1, and there is a c-t base mutation at position 293, resulting in differences in the superovulation trait.

2. The use according to claim 1, characterized in that: the primer sequence is as follows Forward primer: ERC1-fwd: aatacatcacagtgccgacag Reverse primer: ERC1-rev: ttctcagatacctgcgatttcc. Comprising the following steps: Using the forward primer and reverse primer of claim 2, genomic DNA is extracted from the blood of cattle, and PCR amplification is performed; there is a c-t base mutation at position 293 of the DNA sequence of the PCR product fragment, resulting in SNP polymorphism, and specific genotypes can be determined using sequence determination; the different genotypes shown by the detection results are associated with the superovulation trait of cattle, and the superovulation effect of TT type individuals is better than that of CT type or CC type individuals. ​ ​ 3. Use of the molecular marker of claim 1 in marker-assisted selection of the ovulation rate trait in cattle, characterized in that ​ ​

Images