Methods and compositions for improving yield traits

Abstract

The present invention relates to compositions and methods for modifying the NAC7 gene in plants, optionally for improving yield traits. The invention also relates to plants having improved plant configuration and / or improved yield traits produced using the methods and compositions of the invention.

Description

[0001] Statement Regarding Electronic Submission of Sequence Listings

[0002] A sequence listing in XML format named 1499-97WO_ST26.xml and with a size of 236,289 bytes was generated and submitted on April 10, 2023, and the public content of the sequence listing is hereby incorporated into the specification by reference.

[0003] Priority declaration

[0004] This application claims the benefit of U.S. Provisional Application No. 63 / 333,268, filed on April 21, 2022, under 35 U.S.C. §119(e), the entire contents of which are incorporated herein by reference. Technical Field

[0005] The present invention relates to compositions and methods for modifying the NAC7 gene in plants, optionally for improving yield traits. The present invention also relates to plants with improved plant architecture and / or improved yield traits produced using the methods and compositions of the present invention. Background Art

[0006] Yield, measured in bushels per acre, is a complex of genetic, agronomic, and environmental factors that influence plant health and productivity throughout the plant's life cycle. Plants have a complex set of regulatory responses to balance fertility, growth, and development in response to abiotic and biotic challenges. Together, these two opposing forces maximize seed production while also ensuring plant survival. Plants have homeostatic mechanisms that reduce growth and development when they are stressed (negative factors) and other mechanisms that increase growth and development when conditions are favorable.

[0007] New strategies are needed to maximize plant yield while maintaining stress responses.The present invention addresses these shortcomings in the art by providing new compositions and methods for modifying plants to improve yield traits and other characteristics. Summary of the invention

[0008] One aspect of the present invention provides a plant or plant part thereof comprising at least one mutation in an endogenous NAC7 gene encoding a NAC7 domain-containing transcription factor polypeptide (eg, a NAC7 polypeptide), optionally wherein the mutation may be a non-natural mutation.

[0009] A second aspect of the present invention provides a plant cell comprising an editing system, wherein the editing system comprises: (a) a CRISPR-Cas effector protein; and (b) a guide nucleic acid comprising a spacer sequence complementary to an endogenous target gene encoding a transcription factor polypeptide containing a NAC7 domain in the plant cell.

[0010] A third aspect of the invention provides a plant cell comprising at least one mutation within an endogenous NAC7 gene, wherein the at least one mutation is a base substitution, base insertion or base deletion introduced using an editing system comprising a nucleic acid binding domain that binds to a target site in the endogenous NAC7 gene, optionally wherein the mutation may be a non-natural mutation.

[0011] The fourth aspect of the present invention provides a method for producing / cultivating a transgenic-free genome-edited plant, the method comprising: hybridizing the plant of the present invention with a transgenic-free plant, thereby introducing the at least one mutation into the transgenic-free plant; and selecting offspring plants comprising the at least one mutation and being transgenic-free, thereby producing a transgenic-free genome-edited plant, optionally wherein the mutation may be a non-natural mutation.

[0012] A fifth aspect of the invention provides a method for providing multiple plants having a phenotype of increased flower number, increased floral structure size and / or increased ear length, the method comprising planting two or more plants of the invention in a growing area, thereby providing multiple plants having a phenotype of increased flower number, increased floral structure size and / or increased ear length compared to multiple control plants not comprising at least one mutation.

[0013] A sixth aspect provides a method for generating a mutation in an endogenous NAC7 gene of a plant, the method comprising: (a) targeting a gene editing system to a portion of the NAC1 gene comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; and (b) selecting a plant comprising a modification located in a region of the NAC7 gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-98.

[0014] A seventh aspect provides a method for generating a variation in a NAC7 gene, the method comprising: introducing an editing system into a plant cell, wherein the editing system targets a region of the NAC7 gene encoding a transcription factor polypeptide containing a NAC7 domain; and contacting the region of the NAC7 gene with the editing system, thereby introducing a mutation into the NAC7 gene and generating a variation in the NAC7 gene in the plant cell.

[0015] The eighth aspect provides a method for detecting a mutant NAC7 gene (a mutation in an endogenous NAC7 gene) in a plant, the method comprising detecting a NAC7 gene in the genome of the plant, the NAC7 gene having at least one mutation in a region located from about nucleotide 5165 to about nucleotide 5607, with reference to the nucleotide position numbering of SEQ ID NO:72.

[0016] The ninth aspect provides a method for editing a specific site in the genome of a plant cell, the method comprising: cleaving a target site within an endogenous NAC7 gene in a plant cell in a site-specific manner, the endogenous NAC7 gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region having at least 80% sequence identity to SEQ ID NO:75-98; and / or (c) encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74, thereby generating an edit in the endogenous NAC7 gene of the plant cell, and generating a plant cell comprising the edit in the endogenous NAC7 gene.

[0017] The tenth aspect provides a method for preparing a plant, the method comprising: (a) contacting a population of plant cells comprising an endogenous NAC7 gene with a nuclease linked to a nucleic acid binding domain (e.g., an editing system), the nucleic acid binding domain binding a sequence that (i) has at least 80% sequence identity with the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73, (ii) comprises a region that has at least 80% identity with any one of SEQ ID NO:75-98; and / or (iii) encodes an amino acid sequence that has at least 80% sequence identity with SEQ ID NO:74; (b) selecting a plant cell from a population of plant cells in which the endogenous NAC7 gene has been mutated, thereby producing a plant cell comprising a mutation in the endogenous NAC7 gene; and (c) growing the selected plant cell into a plant comprising a mutation in the endogenous NAC7 gene.

[0018] The eleventh aspect provides a method for increasing the number of flowers, increasing the size of floral structures and / or increasing the ear length of a plant, the method comprising (a) contacting a plant cell comprising an endogenous NAC7 gene with a nuclease targeted to the endogenous NAC7 gene, wherein the nuclease is linked to a nucleic acid binding domain (e.g., an editing system) that binds to a target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (i) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO: 72 or SEQ ID NO: 73; (ii) comprises a region having at least 80% identity to any one of SEQ ID NOs: 75-98; and / or (iii) encodes a region having at least 80% identity to any one of SEQ ID NOs: 75-98; NO:74 has an amino acid sequence with at least 80% sequence identity to produce a plant cell comprising a mutation in an endogenous NAC7 gene; and (b) growing the plant cell comprising the mutation in the endogenous NAC7 gene into a plant comprising the mutation in the endogenous NAC7 gene, thereby producing a plant having a mutated endogenous NAC7 gene and increased flower number, increased floral structure size and / or increased ear length.

[0019] The twelfth aspect provides a method for producing a plant or part thereof comprising at least one cell having a mutation in an endogenous NAC7 gene, the method comprising contacting a target site in an endogenous NAC7 gene in a plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene (a) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% identity to any one of SEQ ID NOs:75-98; and / or (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74, thereby producing a plant or part thereof comprising at least one cell having a mutation in an endogenous NAC7 gene.

[0020] The thirteenth aspect of the present invention provides a method for producing a plant or part thereof comprising a mutated endogenous NAC7 gene and exhibiting increased flower number, increased floral structure size and / or increased ear length, the method comprising contacting a target site in an endogenous NAC7 gene in a plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprises a region having at least 80% identity to any one of SEQ ID NOs: 75-98; and / or (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74, thereby producing a plant or part thereof comprising an endogenous NAC7 gene having a mutation and exhibiting increased flower number, increased floral structure size and / or increased ear length.

[0021] A fourteenth aspect provides a guide nucleic acid that binds to a target site in the NAC7 gene, wherein the target site is located in a region of the NAC7 gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-98.

[0022] In a fifteenth aspect, a system is provided, the system comprising a guide nucleic acid of the present invention and a CRISPR-Cas effector protein associated with the guide nucleic acid.

[0023] The sixteenth aspect provides a gene editing system, which comprises a CRISPR-Cas effector protein associated with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to an endogenous NAC7 gene.

[0024] In the seventeenth aspect, a complex comprises a guide nucleic acid and a CRISPR-Cas effector protein containing a cleavage domain, wherein the guide nucleic acid binds to a target site in an endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprises a region having at least 80% identity to any one of SEQ ID NOs: 75-98; and / or (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74, and the cleavage domain cleaves the target strand in the NAC7 gene.

[0025] In the eighteenth aspect, an expression cassette is provided, comprising (a) a polynucleotide encoding a CRISPR-Cas effector protein containing a cleavage domain and (b) a guide nucleic acid that binds to a target site in an endogenous NAC7 gene, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to: (i) a portion of a nucleic acid having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73; (ii) a portion of a nucleic acid having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; and / or (iii) a portion of a nucleic acid encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74.

[0026] In another aspect, a plant is provided comprising in its genome one or more mutated NAC7 genes produced by the methods of the present invention, optionally wherein the one or more mutated NAC7 genes comprise a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encodes a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

[0027] Another aspect of the present invention provides a corn plant or plant part thereof, comprising a mutation in at least one endogenous NAC7 gene having a gene identification number (gene ID) of GRMZM2G114850, optionally wherein the mutation is a non-natural mutation.

[0028] In another aspect, a guide nucleic acid is provided that binds to a target nucleic acid in the NAC7 gene having a gene identification number (gene ID) of GRMZM2G114850.

[0029] Also provided are polypeptides, polynucleotides, nucleic acid constructs, expression cassettes and vectors for making the plants of the invention.

[0030] These and other aspects of the invention will be described in more detail in the following description of the invention.

[0031] A brief description of the sequence

[0032] SEQ ID NOs: 1-17 are exemplary Cas12a amino acid sequences that can be used in the present invention.

[0033] SEQ ID NOs: 18-20 are exemplary Cas12a nucleotide sequences that can be used in the present invention.

[0034] SEQ ID NOs: 21-22 are exemplary regulatory sequences encoding promoters and introns.

[0035] SEQ ID NOs: 23-29 are exemplary cytosine deaminase sequences that can be used in the present invention.

[0036] SEQ ID NOs: 30-40 are exemplary adenine deaminase amino acid sequences that can be used in the present invention.

[0037] SEQ ID NO: 41 is an exemplary uracil-DNA glycosylase inhibitor (UGI) sequence that can be used in the present invention.

[0038] SEQ ID NOs: 42-44 provide examples of the locations of the protospacer-adjacent motifs of type V CRISPR-Cas12a nucleases.

[0039] SEQ ID NOs: 45-47 provide example peptide tags and affinity polypeptides that can be used in the present invention.

[0040] SEQ ID NOs: 48-58 provide example RNA recruitment motifs and corresponding affinity polypeptides that can be used in the present invention.

[0041] SEQ ID NOs:59-60 are exemplary Cas9 polypeptide sequences that can be used in the present invention.

[0042] SEQ ID NOs:61-71 are exemplary Cas9 polynucleotide sequences that can be used in the present invention.

[0043] SEQ ID NO:72 is an example NAC7 genomic sequence from maize.

[0044] SEQ ID NO:73 is an example NAC7 coding sequence from maize.

[0045] SEQ ID NO:74 is an example NAC7 polypeptide sequence from maize.

[0046] SEQ ID NOs:75-98 are example portions or regions of the maize NAC7 genomic sequence.

[0047] SEQ ID NOs: 99-101 are example spacer sequences that can be used in the nucleic acid guide sequences of the present invention.

[0048] SEQ ID NO: 102 and SEQ ID NO: 103 are example portions or regions of NAC7 polypeptides.

[0049] SEQ ID NO:104 is the NAC domain in the genomic and coding sequences of SEQ ID NO:72 and SEQ ID NO:73.

[0050] SEQ ID NOs: 105, 108, 110, 114 and 117 are example edited NAC7 nucleic acid sequences generated as described herein.

[0051] SEQ ID NOs: 106, 109, 111, 115 and 118 are example mutated NAC7 polypeptides generated from the edited nucleic acid sequences of SEQ ID NOs: 105, 108, 110, 114 and 117, respectively.

[0052] SEQ ID NOs: 107, 112, 116 and 119 are consecutive nucleotide portions deleted from SEQ ID NOs: 105, 110, 114 and 117, respectively.

[0053] SEQ ID NO:113 is the portion of consecutive amino acid residues deleted from the mutant NAC7 polypeptide encoded by SEQ ID NO:111. DETAILED DESCRIPTION

[0054] The present invention will now be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the present invention are shown. This specific embodiment is not intended to be a detailed catalog of all different ways in which the present invention can be implemented or all features that can be added to the present invention. For example, the features shown in one embodiment may be incorporated into other embodiments, and the features shown in a specific embodiment may be deleted from the embodiment. Therefore, the present invention contemplates that in some embodiments of the present invention, any feature or combination of features set forth herein may be excluded or omitted. In addition, it will be apparent to those skilled in the art, in accordance with the present disclosure, that many changes and additions to the various embodiments proposed herein will not deviate from the present invention. Therefore, the following description is intended to illustrate some specific embodiments of the present invention, rather than to describe in detail all its permutations, combinations and variations.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. The terms used in the description of the present invention are for the purpose of describing particular embodiments only and are not intended to be limiting of the present invention.

[0056] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0057] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein may be used in any combination. In addition, the present invention also contemplates that in some embodiments of the present invention, any feature or combination of features set forth herein may be excluded or omitted. For illustration, if the specification states that a composition comprises components A, B, and C, it is specifically intended that any one of A, B, or C or a combination thereof may be omitted and abandoned, either individually or in any combination.

[0058] As used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0059] Also as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of a combination when interpreted in the alternative ("or").

[0060] As used herein, the term "about" when referring to a measurable value such as an amount or concentration, is intended to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified value as well as the specified value. For example, "about X," where X is a measurable value, is intended to include X as well as variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of X. The ranges of measurable values ​​provided herein may include any other ranges and / or individual values ​​therein.

[0061] As used herein, phrases such as "between X and Y" and "between about X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between about X and Y" mean "between about X and about Y," and phrases such as "from about X to Y" mean "from about X to about Y."

[0062] Recitation of ranges of values ​​herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a range of 10 to 15 is disclosed, 11, 12, 13, and 14 are also disclosed.

[0063] As used herein, the terms “comprising,” “including,” and “having” specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0064] As used herein, the transitional phrase "consisting essentially of" means that the scope of the claim should be interpreted to encompass the specified materials or steps recited in the claim as well as those materials or steps that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term "consisting essentially of" is not intended to be interpreted as being equivalent to "comprising".

[0065] As used herein, the terms "increase", "increasing", "increased", "enhance", "enhanced", "enhancing" and "enhancement" (and grammatical variations thereof) describe an increase of at least about 5%, 10%, 15%, 20%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more compared to a control. For example, plants comprising a mutation in the NAC7 gene as described herein can exhibit improved yield traits (e.g., one or more improved yield traits including, but not limited to, increased yield (bushels per acre), increased biomass, increased number of flowers, increased seed size, increased seed weight, increased number of pods, increased number of pods per node, increased number of seeds per pod, increased size of floral structures and / or increased ear length) compared to control plants lacking at least one mutation. The control plant is typically the same plant as the edited plant, but the control plant has not been similarly edited and therefore lacks mutations. The control plant can be an isogenic plant and / or a wild-type plant. Therefore, the control plant can be the same breeding line, variety or cultivar as the test plant into which the mutation as described herein is introgressed, but the control breeding line, variety or cultivar does not have mutations. In some embodiments, the comparison between the plants of the present invention and the control plants is performed under the same growth conditions, such as the same environmental conditions (soil, hydration, light, heat, nutrients, etc.).

[0066] As used herein, the terms "reduce", "reduced", "reducing", "reduction", "decrease" and "lower" (and grammatical variations thereof) describe, for example, a reduction of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% as compared to a control. In certain embodiments, the reduction can result in no or substantially no (i.e., a negligible amount, e.g., less than about 10% or even 5%) detectable activity or amount.

[0067] As used herein, the term "expression" ("express", "expresses", "expressed" or "expression"), etc., with respect to nucleic acid molecules and / or nucleotide sequences (e.g., RNA or DNA) means that the nucleic acid molecules and / or nucleotide sequences are transcribed and optionally translated. Thus, the nucleic acid molecules and / or nucleotide sequences can express a polypeptide of interest or, for example, a functional non-translated RNA.

[0068] A "heterologous" or "recombinant" nucleotide sequence is a nucleotide sequence that is not naturally associated with the host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide sequence. A "heterologous" nucleotide / polypeptide may originate from a foreign species or, if from the same species, has been substantially modified from its native form in composition and / or genomic locus by deliberate human intervention.

[0069] A "native" or "wild-type" nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide, or amino acid sequence. In some contexts, a "wild-type" nucleic acid is an unedited nucleic acid as described herein, and may be different from an "endogenous" gene (e.g., a mutated endogenous gene) that may be edited as described herein. In some contexts, a "wild-type" nucleic acid (e.g., unedited) may be heterologous to an organism (e.g., a transgenic organism) in which the wild-type nucleic acid is found. As an example, a "wild-type endogenous NAC7 gene" is a NAC7 gene that is naturally present in a reference organism such as a plant (e.g., a corn plant) or endogenous to it, and may be subjected to modification as described herein, after which such modified endogenous gene is no longer wild-type.

[0070] As used herein, the term "heterozygous" refers to a genetic state in which different alleles are located at corresponding loci on homologous chromosomes.

[0071] As used herein, the term "homozygous" refers to a genetic state in which identical alleles are located at corresponding loci on homologous chromosomes.

[0072] As used herein, the term "allele" refers to one of two or more different nucleotides or nucleotide sequences occurring at a particular locus.

[0073] A "null allele" is a non-functional allele caused by a gene mutation that results in no production of the corresponding protein or production of a non-functional protein.

[0074] A "recessive mutation" is a genetic mutation that produces a phenotype when homozygous, but the phenotype is not observable when the locus is heterozygous.

[0075] A "dominant mutation" is a gene mutation that produces a mutant phenotype in the presence of a non-mutated copy of the gene. A dominant mutation can be a loss-of-function or gain-of-function mutation, a hypomorphic mutation, a hypermorphic mutation, or a weak loss-of-function or weak gain-of-function.

[0076] A "dominant negative mutation" is a mutation that produces an altered gene product (e.g., one that has an abnormal function relative to the wild type) that adversely affects the function of the wild type allele or gene product. For example, a "dominant negative mutation" can block the function of a wild type gene product. A dominant negative mutation may also be referred to as a "reversal allele mutation."

[0077] A "semidominant mutation" is a mutation in which the penetrance of the phenotype in a heterozygous organism is less than the penetrance of the phenotype observed in a homozygous organism.

[0078] A "weak loss-of-function mutation" is a mutation that results in a gene product that has partial function or reduced function (partial inactivation) compared to the wild-type gene product.

[0079] A "hypofunctional allele mutation" is a mutation that results in a partial loss of gene function, which may occur through reduced expression (e.g., reduced protein and / or reduced RNA) or reduced functional performance (e.g., reduced activity), but not a complete loss of function / activity. A "hypofunctional" allele is a semi-functional allele caused by a gene mutation that results in the production of a corresponding protein that functions at anywhere between 1% and 99% of normal efficiency.

[0080] A "hyperallelic mutation" is a mutation that results in increased expression of a gene product and / or increased activity of a gene product.

[0081] As used herein, "non-natural mutation" refers to a mutation that is produced by human intervention, which is different from a naturally occurring (eg, naturally occurring) mutation found in the same gene.

[0082] A "locus" is the location on a chromosome where a gene or marker or allele is located. In some embodiments, a locus may encompass one or more nucleotides.

[0083] As used herein, the terms "desired allele," "target allele," and / or "allele of interest" are used interchangeably to refer to an allele associated with a desired trait. In some embodiments, a desired allele may be associated with an increase or decrease (relative to a control) in a given trait, depending on the nature of the desired phenotype.

[0084] A marker is "associated with" a trait when it is linked to the marker and when the presence of the marker is an indication of whether and / or to what extent the desired trait or trait form occurs in the plant / germplasm containing the marker. Similarly, a marker is "associated with" an allele or chromosomal interval when it is linked to the allele or chromosomal interval and when the presence of the marker is an indication of whether the allele or chromosomal interval is present in the plant / germplasm containing the marker.

[0085] As used herein, the terms "backcross" and "backcrossing" refer to the process of crossing a progeny plant back to one of its parents one or more times (e.g., 1, 2, 3, 4, 5, 6, 7, 8 times, etc.). In a backcrossing protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or the "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed. For example, see Ragot, M. et al., Marker-assisted Backcrossing: A Practical Example, in TECHNIQUES ETUTILISATIONS DES MARQUEURS MOLECULAIRES LES COLLOQUES, Vol. 72, pp. 45-56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, in PROCEEDINGS OF THE SYMPOSIUM "ANALYSIS OF MOLECULAR MARKER DATA," pp. 41-43 (1994). The initial cross produces the F1 generation. The term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.

[0086] As used herein, the term "cross" or "crossed" refers to the production of offspring (e.g., cells, seeds, or plants) by the fusion of gametes through pollination. The term encompasses sexual crossing (pollination of one plant to another) and selfing (self-pollination, e.g., when pollen and ovules are from the same plant). The term "crossing" refers to the act of fusion of gametes through pollination to produce offspring.

[0087] As used herein, the terms "introgression", "introgressing" and "introgressed" refer to the natural and artificial transmission of a desired allele or combination of desired alleles of one or more genetic loci from one genetic background to another genetic background. For example, the desired allele at a given locus can be transmitted to at least one (e.g., one or more) progeny by sexual hybridization between two parents of the same species, wherein at least one parent has the desired allele in its genome. Alternatively, for example, the transmission of the allele can occur by recombination between two donor genomes, such as in fused protoplasts, wherein at least one donor protoplast has the desired allele in its genome. The desired allele can be a selected allele of a marker, QTL, transgenic, etc. The offspring comprising the desired allele can be backcrossed one or more times (e.g., 1, 2, 3, 4 or more times) with a strain having a desired genetic background, selecting the desired allele, with the result that the desired allele is fixed in the desired genetic background. For example, a marker associated with increased yield under non-water stress conditions can be introgressed from a donor into a recurrent parent that does not contain the marker and does not exhibit increased yield under non-water stress conditions. The resulting offspring can then be backcrossed one or more times and selected until the progeny possess the genetic marker associated with increased yield under non-water stress conditions in the recurrent parent background.

[0088] A "genetic map" is a description of the genetic linkage relationships between loci on one or more chromosomes within a given species, usually depicted in a graphical or tabular form. For each genetic map, the distances between loci are measured by the frequencies of recombination between them. A variety of markers can be used to detect recombination between loci. A genetic map is a product of the mapping population, the type of markers used, and the polymorphic potential of each marker between different populations. The order and genetic distance between loci can vary from genetic map to genetic map.

[0089] As used herein, the term "genotype" refers to the genetic constitution of an individual (or individual population) at one or more genetic loci, in contrast to observable and / or detectable and / or phenotype traits (phenotypes). Genotype is defined by the alleles of one or more known loci inherited by an individual from its parents. The term genotype can be used to refer to the genetic constitution of an individual at a single locus, a plurality of loci, or more generally, the term genotype can be used to refer to the genetic constitution of all genes in an individual genome. Genotype can be, for example, indirectly characterized using a mark and / or directly characterized by nucleic acid sequencing.

[0090] As used herein, the term "germplasm" refers to the genetic material of an individual (e.g., plant), a group of individuals (e.g., plant strains, varieties or families), or clones derived from strains, varieties, species or cultures, or from an individual (e.g., plant), a group of individuals (e.g., plant strains, varieties or families), or clones derived from strains, varieties, species or cultures. Germplasm can be a part of an organism or cell or can be separated from an organism or cell. In general, germplasm provides genetic material with a specific genetic composition, providing a basis for some or all of the genetic qualities of an organism or cell culture. As used herein, germplasm includes cells, seeds or tissues that can grow new plants, and plant parts (e.g., leaves, stems, buds, roots, pollen, cells, etc.) that can be cultured into complete plants.

[0091] As used herein, the terms "cultivar" and "variety" refer to a group of similar plants distinguishable from other varieties within the same species by structural or genetic characteristics and / or performance.

[0092] As used herein, the terms "exotic", "exotic strains" and "exotic germplasm" refer to any plant, strain or germplasm that is not superior. Generally speaking, the exotic plant / germplasm is not derived from any known superior plant or germplasm, but is selected to introduce one or more desired genetic elements into a breeding program (e.g., introducing new alleles into a breeding program).

[0093] As used herein, the term "hybrid" in the context of plant breeding refers to a plant that is the offspring of genetically distinct parents produced by crossing plants of different lines or varieties or species, including but not limited to a cross between two inbred lines.

[0094] As used herein, the term "inbred" refers to a substantially homozygous plant or variety. The term can refer to a plant or plant variety that is substantially homozygous throughout the genome, or a plant or plant variety that is substantially homozygous for a portion of the genome of particular interest.

[0095] A "haplotype" is the genotype of an individual at multiple genetic loci, i.e., a combination of alleles. Typically, the genetic loci that define a haplotype are physically and genetically linked, i.e., on the same chromosome segment. The term "haplotype" may refer to a polymorphism at a specific locus, such as a single marker locus, or a polymorphism at multiple loci along a chromosome segment.

[0096] Plants in which at least one (e.g., one or more, e.g., 1, 2, 3 or 4 or more) endogenous NAC7 gene is modified as described herein (e.g., comprises a modification as described herein) can have improved yield traits compared to plants that do not comprise (lack) the modification in at least one endogenous NAC7 gene. As used herein, "improved yield trait" refers to any plant trait related to growth, such as biomass, yield, nitrogen use efficiency (NUE), inflorescence size / weight, fruit yield, fruit quality, fruit size, seed size (e.g., seed area, seed size), seed number, leaf tissue weight, nodule number, nodule quality, nodulation activity, seed ear number, tiller number, branch number, flower number, tuber number, tuber quality, bulb quality, seed number, total seed mass, leaf emergence rate, tiller / branch emergence rate, seedling emergence rate, root length, root number, root mass size and / or weight, or any combination thereof. In some aspects, "improved yield traits" may include, but are not limited to, increased inflorescence yield, increased fruit yield (e.g., increased number, weight, and / or size of fruit; e.g., increased number, weight, and / or length of ears, e.g., for corn), increased fruit quality, increased number, size, and / or weight of roots, increased meristem size, increased seed size (e.g., seed area and / or seed weight), increased biomass, increased leaf size, improved nitrogen use efficiency, increased height, increased number of internodes, and / or increased internode length, compared to a control plant or part thereof (e.g., a plant that does not contain a mutated endogenous NAC7 nucleic acid as described herein). In some aspects, the improved yield trait may be expressed as the number of grains / seeds produced per unit area of ​​land (e.g., bushels per acre of land). In some embodiments, one or more improved yield traits may be increased number of flowers, increased size of floral structures, and / or increased ear length.

[0097] As used herein, "increased size of a floral structure" may refer to a floral structure that has increased area and / or increased weight. In some embodiments, the area of ​​the floral structure may be increased by 1% to about 50%, and any range or value therein (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 47%, 48%, 49% or 50%). In some embodiments, the weight of the floral structure can be increased by about 1% to about 50%, and any range or value therein (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 47%, 48%, 49%, or 50%). In some embodiments, the increase in flower size may include an increase in both area and weight.

[0098] As used herein, "increased ear length" can be an increase in length of about 1% to about 50%, and any range or value therein (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 47%, 48%, 49% or 50%).

[0099] As used herein, "increased flower number" can be an increase in flower number of a plant of the present invention by about 15% to about 100% as compared to the ear length of a control plant (e.g., a plant not comprising a mutation in an endogenous NAC7 gene as described herein), and any range or value therein (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, %, 42%, 43%, 44%, 45%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%).

[0100] As used herein, "control plants" refer to plants that do not contain an edited NAC7 gene as described herein, which confers enhanced / improved traits (e.g., yield traits) or altered phenotypes (e.g., increased number of flowers, increased flower structure size, and / or increased spike length). Control plants are used to identify and select plants edited as described herein that have enhanced traits or altered phenotypes compared to control plants. Suitable control plants can be parental line plants used to produce plants containing mutated NAC7 genes, for example, wild-type plants lacking editing in endogenous NAC7 genes as described herein. Suitable control plants can also be plants containing recombinant nucleic acids that confer other traits, for example, transgenic plants with enhanced herbicide tolerance. In some cases, suitable control plants can be progeny of heterozygous or hemizygous transgenic plant lines lacking mutated NAC7 genes as described herein, referred to as negative segregants or negative isogenic lines.

[0101] Enhanced traits (e.g., improved yield traits) may include, for example, reduced days from planting to maturity, increased stem size, increased leaf number, increased vegetative stage plant height growth rate, increased ear size, increased dry weight per plant ear, increased number of grains per ear, increased weight per grain, increased number of grains per plant, reduced empty ears, extended grain filling period, reduced plant height, increased number of root branches, increased total root length, increased yield, increased nitrogen use efficiency, and / or increased water use efficiency compared to control plants. The altered phenotype may be, for example, plant height, biomass, canopy area, anthocyanin content, chlorophyll content, water application, water content, and water use efficiency.

[0102] In some embodiments, plants of the present invention may comprise one or more improved yield traits, including but not limited to, in some embodiments, one or more improved yield traits include higher yield (bushels per acre), increased biomass, increased plant height, increased stem diameter, increased leaf area, increased number of flowers, increased number of kernel rows (optionally wherein ear length is not substantially reduced), increased number of kernels, increased kernel size, increased ear length, reduced number of tillers, reduced number of tassel branches, increased number of pods (including increased number of pods per node and / or increased number of pods per plant), increased number of seeds per pod, increased number of seeds, increased seed size, and / or increased seed weight (e.g., increased 100-seed weight) compared to a control plant lacking at least one mutation. In some embodiments, plants of the invention may comprise one or more improved yield traits, including, but not limited to, optionally increased yield (bushels per acre), seed size (including kernel size), seed weight (including kernel weight), increased number of kernel rows (optionally wherein ear length is not substantially reduced), increased number of pods, increased number of seeds per pod, and increased ear length, compared to control plants or parts thereof. In some embodiments, plants of the invention may exhibit increased number of flowers, increased size of floral structures, and / or increased ear length when compared to a control plant lacking a mutated NAC7 gene as described herein.

[0103] As used herein, "properties" are physiology, morphology, biochemistry or physical characteristics of plants or specific plant materials or cells. In some cases, this feature is visible to the human eye and can be measured mechanically, such as the size, weight, shape, form, length, height, growth rate and developmental stage of seeds or plants, or can be measured by biochemical techniques, such as protein, starch, some metabolites or the oil content of detection seeds or leaves, or by observing metabolism or physiological processes, for example, by measuring the tolerance to lack of water or specific salt or sugar concentration, or by measuring the expression level of one or more genes, for example, by adopting Northern analysis, RT-PCR, microarray gene expression array or reporter gene expression system, or by agricultural observations such as high osmotic stress tolerance or yield. However, any technology can be used to measure the amount, comparative level or difference of any selected chemical compound or macromolecule in transgenic plants.

[0104] As used herein, "enhanced traits" refers to plant characteristics caused by mutations in the NAC7 gene as described herein. Such traits include, but are not limited to, enhanced agronomic traits, characterized by enhanced plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance. In some embodiments, the enhanced trait / changed phenotype can be, for example, reduced days from planting to maturity, increased stem size, increased leaf number, increased nutrient stage plant height growth rate, increased ear size, increased dry weight per plant ear, increased number of grains per ear, increased per grain weight, increased number of grains per plant, reduced ear empty grains, extended filling period, reduced plant height, increased root branch number, increased total root length, drought tolerance, improved water use efficiency, cold tolerance, improved nitrogen use efficiency and / or increased yield. In some embodiments, the trait is the yield increased under non-stress conditions or the yield increased under environmental stress conditions. Stress conditions can include biotic and abiotic stresses, such as drought, shading, fungal diseases, viral diseases, bacterial diseases, insect infestation, nematode infestation, low temperature exposure, heat exposure, osmotic stress, nitrogen nutrient availability reduction, phosphorus nutrient availability reduction and high plant density. "Yield" can be affected by many characteristics, including but not limited to plant height, plant biomass, pod number, pod position on plant, internode number, pod cracking incidence, grain size, ear size, ear tip filling degree, grain abortion, nodulation and nitrogen fixation efficiency, nutrient assimilation efficiency, biotic and abiotic stress resistance, carbon assimilation, plant configuration, lodging resistance, seed germination percentage, seedling vigor and juvenile traits. Yield can also be affected by the following factors: germination efficiency (including germination under stress conditions), growth rate (including growth rate under stress conditions), flowering time and duration, ear number, ear size, ear weight, number of seeds per ear or per pod, seed size, composition (starch, oil, protein) of seed and the characteristics of seed filling.

[0105] As also used herein, the term "trait modification" encompasses altering a naturally occurring trait by producing a detectable characteristic difference in a plant comprising a mutation in an endogenous NAC71 gene as described herein relative to a plant that does not comprise the mutation (such as a wild-type plant, or a negative segregant). In some cases, trait modifications can be evaluated quantitatively. For example, a trait modification can result in an increase or decrease in an observed trait characteristic or phenotype compared to a control plant. It is well known that modified traits may have natural variation. Therefore, an observed trait modification can result in a normal distribution and a change in magnitude of a trait characteristic or phenotype in a plant compared to a control plant.

[0106] The present disclosure relates to plants having improved economically relevant characteristics, more specifically increased flower number, increased flower structure size, and / or increased ear length. More specifically, the present disclosure relates to a plant comprising a mutation in a NACL gene as described herein, wherein the plant exhibits increased flower number, increased flower structure size, and / or increased ear length compared to a control plant lacking the mutation. In some embodiments, the plants of the present disclosure exhibit further improved traits related to yield, including, but not limited to, increased nitrogen use efficiency, increased nitrogen stress tolerance, increased water use efficiency, and / or increased drought tolerance, as defined and discussed below.

[0107] Yield can be defined as a measurable product with economic value from a crop. Yield can be defined in terms of quantity and / or quality. Yield can depend directly on several factors, such as the number and size of organs (e.g., number of flowers), plant configuration (such as the number of branches, plant biomass, such as increased root biomass, steeper root angles and / or longer roots, etc.), flowering time and duration, grain filling period. Root configuration and development, photosynthetic efficiency, nutrient absorption, stress tolerance, early vigor, delayed senescence and functional stay-green phenotypes may be factors that determine yield. Therefore, optimizing the above factors can help increase crop yield.

[0108] The increase / improvement of the yield correlated traits mentioned herein also can be considered to refer to the increase of the biomass (weight) of one or more parts of plant, and these one or more parts can comprise above-ground and / or underground (can gather in the crops) plant parts.Particularly, this type of part that can gather in the crops is seed, and the execution of the disclosed method produces the plant of the seed yield with the yield of increase, particularly with respect to the seed yield of suitable control plant.The " yield " of term plant can relate to the nutrient biomass (root and / or seedling biomass), reproductive organ and / or propagule (such as seed) of this plant.

[0109] The increased yield of the plants of the present disclosure can be measured in a variety of ways, including test weight, number of seeds per plant, seed weight, number of seeds per unit area (e.g., number of seeds per acre or seed weight), bushels per acre, tons per acre, or kilograms per hectare. The increased yield can be attributed to improved utilization of key biochemical compounds (such as nitrogen, phosphorus, and carbohydrates), or to improved responses to environmental stresses (such as cold, heat, drought, salt, shade, high plant density, and pest or pathogen attack).

[0110] "Increased yield" can be manifested as one or more of the following: (i) increased plant biomass (weight) of one or more parts of the plant, in particular the aboveground (harvestable) parts of the plant, increased root biomass (increased number of roots, increased root thickness, increased root length) or increased biomass of any other harvestable part; or (ii) increased early vigour, defined herein as increased aboveground area of ​​seedlings about three weeks after germination.

[0111] "Early vigor" refers to active and healthy plant growth, especially in the early stages of plant growth, and can be due to, for example, plant better adapting to its environment (for example, optimizing the utilization of energy, nutrient absorption and carbon distribution between seedling and root) caused by the increase in plant fitness. For example, early vigor can be a combination of the ability of seeds to germinate and emerge after planting and the ability of seedlings to grow and develop after emergence. Plants with early vigor also show increased seedling survival rate and better crop planting, which can usually make the field highly uniform, wherein most plants basically reach each development stage at the same time, thereby usually increasing output. Therefore, early vigor can be determined by measuring various factors, such as grain weight, germination percentage, emergence percentage, seedling growth, seedling height, root length, root and seedling biomass, canopy size and color, etc.

[0112] In addition, increased yield can also be manifested as increased total seed yield, which can be attributed to one or more of the following: an increase in seed biomass (seed weight) due to an increase in seed weight per plant and / or individual seed, for example, an increased number of flowers / panicles per plant; an increased number of pods; an increased number of nodes; an increased number of flowers ("florets") per panicle / plant; an increased seed filling rate; an increased number of filled seeds; an increased seed size (length, width, area, circumference and / or weight), which can also affect seed composition; and / or an increased seed volume, which can also affect seed composition. In one embodiment, the increased yield can be an increased seed yield, for example, an increased seed weight; an increased number of filled seeds; and / or an increased harvest index.

[0113] Increased yield may also result from, or may occur as a result of, changes in plant architecture.

[0114] Increased yield can also be expressed as an increased harvest index, which is expressed as the ratio of the yield of harvestable parts (such as seeds) to the total biomass.

[0115] The present disclosure also extends to harvestable parts of plants, such as, but not limited to, seeds, leaves, fruits, flowers, pods, pods, siliques, nuts, stems, rhizomes, tubers and bulbs. The present disclosure also relates to products derived from harvestable parts of such plants, such as dry pellets, powders, oils, fats and fatty acids, starch or proteins.

[0116] The present disclosure provides a method for increasing the "yield" of a plant or the "broadacre yield" of a plant or plant part, which is defined as the harvestable plant part per unit area, such as number of seeds per acre or seed weight, pounds per acre, bushels per acre, tons per acre, tons per acre, kilograms per hectare.

[0117] As used herein, "nitrogen use efficiency" refers to the processes that lead to increased plant yield, biomass, vigor, and growth rate per unit of nitrogen applied. These processes may include plant absorption, assimilation, accumulation, signal transduction, sensing, retransfer (within the plant), and utilization of nitrogen.

[0118] As used herein, "increased nitrogen use efficiency" refers to the ability of a plant to grow, develop or produce faster or better than normal when subjected to the same available / applied amount of nitrogen as under normal or standard conditions; the ability of a plant to grow, develop or produce normally, or the ability to grow, develop or produce faster or better when subjected to less than optimal available / applied amounts of nitrogen or under nitrogen limiting conditions.

[0119] As used herein, "nitrogen limiting conditions" refers to growing conditions or environments that provide less than the optimal amount of nitrogen required for adequate or successful metabolism, growth, reproductive success, and / or survival of a plant.

[0120] As used herein, "increased nitrogen stress tolerance" refers to the ability of a plant to grow, develop or produce normally, or to grow, develop or produce faster or better, when subjected to less than optimal available / applied amounts of nitrogen or under nitrogen limiting conditions.

[0121] The improved plant nitrogen utilization efficiency can be converted into a similar amount of yield in the field while supplying less nitrogen, or an increased yield can be obtained by supplying an optimum / sufficient amount of nitrogen. The improved nitrogen utilization efficiency can improve plant nitrogen stress tolerance, and can also improve the biochemical composition of crop quality and seeds, such as protein yield and oil yield. The terms "improved nitrogen utilization efficiency", "enhanced nitrogen utilization efficiency" and "nitrogen stress tolerance" are used interchangeably in this disclosure and refer to plants with improved productivity under nitrogen limiting conditions.

[0122] As used herein, "water use efficiency" refers to the amount of carbon dioxide assimilated by leaves per unit of transpiration water vapor. It constitutes one of the most important traits controlling plant productivity in dry environments. "Drought tolerance" refers to the degree to which plants adapt to dry or drought conditions. The physiological response of plants to water shortage includes leaf wilting, reduced leaf area, leaf shedding, and stimulating root growth by directing nutrients to the underground parts of the plant. Generally, plants are more susceptible to drought during flowering and seed development (reproduction stage) because the resources of the plant are biased to support root growth. In addition, abscisic acid (ABA) is a plant stress hormone that induces the closure of leaf stomata (microscopic pores involved in gas exchange), thereby reducing water loss caused by transpiration and reducing photosynthesis rate. These reactions improve the water use efficiency of plants in the short term. The terms "improved water use efficiency", "enhanced water use efficiency" and "increased drought tolerance" are used interchangeably in this disclosure and refer to plants with improved productivity under water-limited conditions.

[0123] As used herein, "increased water use efficiency" refers to the ability of a plant to grow, develop or produce faster or better than normal when subjected to the same available / applied amount of water as under normal or standard conditions; the ability of a plant to grow, develop or produce normally, or the ability to grow, develop or produce faster or better when subjected to reduced available / applied amounts of water (water input) or under conditions of water stress or water deficiency stress.

[0124] As used herein, "increased drought tolerance" refers to the ability of a plant to grow, develop or produce normally, or to grow, develop or produce faster or better than normal, when subjected to reduced available / applied amounts of water and / or under conditions of short-term or long-term drought; the ability of a plant to grow, develop or produce normally when subjected to reduced available / applied amounts of water (water input) or under conditions of water stress or under conditions of short-term or long-term drought.

[0125] As used herein, "drought stress" refers to a dry period (short or long / extended) that results in a lack of water and stresses the plant and / or causes damage to plant tissue and / or has a negative impact on grain / crop yield; a dry period (short or long / extended) that results in a lack of water and / or an increase in temperature and stresses the plant and / or causes damage to plant tissue and / or has a negative impact on grain / crop yield.

[0126] As used herein, "water deficit" refers to conditions or circumstances that provide less than the optimal amount of water required for adequate / successful growth and development of plants.

[0127] As used herein, "water stress" refers to a condition or environment that provides an inappropriate amount of water (less / insufficient or more / excessive) relative to the amount of water required for adequate / successful growth and development of the plant / crop, thereby stressing the plant and / or causing damage to plant tissue and / or negatively affecting grain / crop yield.

[0128] As used herein, "water stress" refers to a condition or environment that provides less / insufficient water than required for adequate / successful growth and development of a plant / crop, thereby stressing the plant and / or causing damage to plant tissue and / or negatively affecting grain yield.

[0129] As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleotide sequence" and "polynucleotide" refer to linear or branched, single-stranded or double-stranded RNA or DNA, or a hybrid thereof. The term also encompasses RNA / DNA hybrids. When synthesizing dsRNA, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, etc. can also be used for antisense, dsRNA and ribozyme pairing. For example, polynucleotides containing C-5 propyne analogs of uridine and cytidine have been shown to bind RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications may also be made, such as modifications to the 2'-hydroxyl in the phosphodiester backbone or the RNA ribose group.

[0130] As used herein, the term "nucleotide sequence" refers to a heteropolymer of nucleotides or a sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule, and includes DNA or RNA molecules, including cDNA, DNA fragments or parts, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA and antisense RNA, any of which can be single-stranded or double-stranded. The terms "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid construct", "oligonucleotide" and "polynucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides. Nucleic acid molecules and / or nucleotide sequences provided herein are presented in 5' to 3' directions from left to right herein, and are represented by the standard code for representing nucleotide characters specified in U.S. sequence rules 37CFR§§1.821-1.825 and World Intellectual Property Organization (WIPO) standard ST.25. As used herein, "5' region" can represent the polynucleotide region closest to the 5' end of a polynucleotide. Therefore, for example, the element in the 5' region of a polynucleotide can be located at any position from the first nucleotide located at the 5' end of a polynucleotide to the nucleotide located in the middle of a polynucleotide. As used herein, "3' region" may refer to the region of a polynucleotide closest to the 3' end of a polynucleotide. Thus, for example, elements in the 3' region of a polynucleotide may be located anywhere from the first nucleotide at the 3' end of the polynucleotide to a nucleotide in the middle of the polynucleotide.

[0131] As used herein with respect to nucleic acids, the terms "fragment" or "portion" refer to a portion of a nucleic acid that is reduced in length (e.g., by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 400, 450, 500, 550, 660, 670, 680, 690, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 The nucleic acid fragment may be a nucleic acid having a length of 100, 200, 300, 400, 500, 600, 700, 750, 800, 850 or 900 nucleotides or more, or any range or value therein) and comprising, consisting essentially of and / or consisting of a nucleotide sequence of contiguous nucleotides that are identical or nearly identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the corresponding portion of the reference nucleic acid. Where appropriate, such a nucleic acid fragment may be contained in a larger polynucleotide of which the nucleic acid fragment is a component. As an example, the repetitive sequence of the guide nucleic acid of the present invention may include a "portion" of a wild-type CRISPR-Cas repetitive sequence (e.g., a wild-type CRISPR-Cas repetitive sequence; for example, a repetitive sequence from a CRISPR Cas system, such as Cas9, Cas12a (Cpf1), Cas12b, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12g, Cas12h, Cas12i, C2c4, C2c5, C2c8, C2c9, C2c10, Cas14a, Cas14b and / or Cas14c, etc.).

[0132] In some embodiments, the nucleic acid fragment may comprise, consist essentially of, or consist of the following consecutive nucleotides: about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 of a nucleic acid encoding a NAC7 domain-containing transcription factor polypeptide. ,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,70,75,80,85,90,95,100,105,110,115,120,125,130,135,140,145,150,155,160,165,170,175,180,185,1 90, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 320, 330, 340, 350, 360, 370, 380, 390, 395, 400, 410, 415, 420, 425, 430, 435, 440, 445 , 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1900, 2000, 3000, 4000 or 5000 or more consecutive nucleotides, or any range or value therein,Optionally, the length of the fragment of the NAC7 gene can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 ,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95, 96, 97, 98, 99, 100, 110, 115, 120, 125, 130, 135, 140, 145, 150 consecutive nucleotides to about 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 240, 245, 250, 255, , 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395 or 400 or more consecutive nucleotides, or any range or value therein (e.g., a fragment or portion of SEQ ID NO: 72 or SEQ ID NO: 73 (e.g., SEQ ID NO: 75-98)),

[0133] In some embodiments, a "sequence-specific nucleic acid binding domain" can bind to one or more fragments or portions of a nucleotide sequence (eg, DNA, RNA) encoding a NAC7 domain-containing transcription factor polypeptide, for example, as described herein.

[0134] As used herein with respect to polypeptides, the term "fragment" or "portion" may refer to a polypeptide that is reduced in length relative to a reference polypeptide and comprises, consists essentially of, and / or consists of an amino acid sequence of contiguous amino acids that are identical or nearly identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the corresponding portion of the reference polypeptide. Where appropriate, such a polypeptide fragment may be included in a larger polypeptide of which it is a component. In some embodiments, a polypeptide fragment may comprise, consist essentially of, or consist of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 191, 192, 193, 194, 195, 196, 197, or 198 or more consecutive amino acids of a reference polypeptide.In some embodiments, a polypeptide fragment may comprise, consist essentially of, or consist of about 3 to about 250 consecutive amino acid residues (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 , 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146 6, 147, 148, 149, 150, 151, 152, 152, 154, 155, 154, 155, 156, 157, 158, 159, 160, 165, 166, 167, 168, 169, 170, 175, 180, 185, 190, 195, 196, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 consecutive amino acid residues, or any range or value therein) (e.g., a fragment or portion of SEQ ID NO: 74). In some embodiments, a fragment of a NAC7 polypeptide can be the N-terminus of a polypeptide or portion thereof resulting from a premature stop codon (see, e.g., SEQ ID NO: 106, 115, or 118). In some embodiments, a fragment of a NAC7 polypeptide may be a portion of a NAC7 polypeptide that is deleted due to genome editing as described herein (e.g., a portion deleted due to a premature stop codon, e.g., a C-terminal truncated portion). In some embodiments, a fragment of a NAC7 polypeptide may be the result of a mutation in at least one endogenous gene encoding a NAC7 polypeptide as described herein (e.g., a deletion, insertion, etc. in one or more endogenous NAC7 genes in a plant).

[0135] In some embodiments, when included in a plant, such a modification (e.g., a deletion) can result in the plant exhibiting increased flower number, increased floral structure size, and / or increased panicle length compared to a plant without the deletion. The NAC7 gene can be edited at one or more than one position (and using one or more different editing tools) to provide a NAC7 gene comprising one or more mutations. In some embodiments, a NAC7 polypeptide mutated as described herein can comprise one or more edits that can result in the polypeptide lacking one or more amino acid residues (e.g., lacking about 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 ,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107 7, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155 , 194, 195, 196, 197, 198, 199, or 200 consecutive amino acid residues, and any range or value therein). In some embodiments, the deletion can result in a truncated polypeptide.

[0136] In some embodiments, reference to a "portion" or "region" of a nucleic acid refers to at least 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 9, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116 16, 117, 118, 119, 120, 125, 130, 135, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 160, 165, 170, 175, 180, 181, 182, 183,184, 185, 186, 187, 188, 189, 190, 191, 912, 913, 194, 195, 196, 197, 198, 199, 200, 210, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 240, 25 0, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 280, 285, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 310, 311, 312, 313, 314, 315, 3 16, 317, 318, 319, 320, 330, 340, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 370, 375, 376, 377, 378, 379, 380, 390, 395, 400, 405, 410, 415 , 420, 425, 430, 435, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 18 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 144, 145, 146, 147, 148, 149, or 150 consecutive nucleotides to about 155, 160, 165, 170, 175, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218184, 185, 186, 187, 188, 189, 190, 191, 912, 913, 194, 195, 196, 197, 198, 199, 200, 210, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 240, 250, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 280, 285, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 310, 311 , 312, 313, 314, 315, 316, 317, 318, 319, 320, 330, 340, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 370, 375, 376, 377, 378, 379, 380, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, or 450 or more consecutive nucleotides, or any range or value therein (e.g., a portion or region of SEQ ID NO: 72 or SEQ ID NO: 73 (e.g., SEQ ID NOs: 75-98)). ,

[0137] In some embodiments, a "portion" or "region" of a NAC7 polypeptide sequence can be from about 5 to about 200 or more contiguous amino acid residues in length (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 9, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 09, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 154, 155, 1 74, 195, 196, 197, 198, 199, or 200 or more consecutive amino acid residues (e.g., a portion of SEQ ID NO: 74).

[0138] As used herein with respect to nucleic acids, the term "functional fragment" refers to a nucleic acid encoding a functional fragment of a polypeptide. A "functional fragment" with respect to a polypeptide is a fragment of a polypeptide that retains one or more activities of a native reference polypeptide.

[0139] As used herein, the term "gene" refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotides (AMOs), etc. A gene may or may not be used to produce a functional protein or gene product. A gene may include coding regions and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences, and / or 5' and 3' untranslated regions). A gene can be "isolated," which means that the nucleic acid is substantially or substantially free of components that are usually present with the nucleic acid under natural conditions. Such components include other cell materials, culture media from recombinant production, and / or various chemicals for chemically synthesizing nucleic acids.

[0140] The term "mutation" refers to a point mutation (e.g., missense or nonsense, or insertion or deletion of a single base pair that results in a frameshift), insertion, deletion, inversion, and / or truncation. When a mutation is a replacement of a residue in an amino acid sequence by another residue, or a deletion or insertion of one or more residues in a sequence, the mutation is usually described by identifying the original residue, then identifying the position of the residue in the sequence, and the identity of the newly replaced residue. Truncation may include truncation at the C-terminus of a polypeptide or the N-terminus of a polypeptide. Truncation of a polypeptide may be the result of a corresponding 5' or 3' end deletion of a gene encoding a polypeptide. When a deletion or insertion of one or more base pairs is introduced into a gene, a frameshift mutation may occur, optionally resulting in an out-of-frame mutation or an in-frame mutation. A frameshift mutation in a gene may result in a polypeptide that is longer, shorter, or the same length as a wild-type polypeptide, depending on when the first stop codon appears after the mutation region of the gene. As an example, an out-of-frame mutation that produces an early stop codon may produce a polypeptide that is shorter than a wild-type polypeptide, or in some embodiments, the polypeptide may not be present / detectable. DNA inversions are the result of rotation of genetic segments within a chromosomal region.

[0141] As used herein, the terms "complementary" or "complementarity" refer to the natural binding of polynucleotides by base pairing under permissive salt and temperature conditions. For example, the sequence "AGT" (5' to 3') binds to the complementary sequence "TCA" (3' to 5'). The complementarity between two single-stranded molecules can be "partial", in which only some of the nucleotides bind, or it can be complete when there is complete complementarity between the single-stranded molecules. The degree of complementarity between nucleic acid chains has a significant effect on the efficiency and strength of hybridization between nucleic acid chains.

[0142] As used herein, "complement" can mean 100% complementarity to a compared nucleotide sequence, or it can mean less than 100% complementarity to a compared nucleotide sequence (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc. complementarity).

[0143] Different nucleic acids or proteins with homology are referred to herein as "homologs". The term homolog includes homologous sequences from the same species and other species and orthologous sequences from the same species and other species." Homology " refers to the level of similarity between two or more nucleic acid and / or amino acid sequences, expressed as a percentage of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of having similar functional properties between different nucleic acids or proteins. Therefore, the compositions and methods of the present invention also include homologs of the nucleotide sequences and polypeptide sequences of the present invention. As used herein, "orthologs" refer to homologous nucleotide sequences and / or amino acid sequences in different species, which are derived from common ancestral genes during the process of speciation. Homologs of the nucleotide sequences of the invention have substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to the nucleotide sequences of the invention.

[0144] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are unchanged over the entire component (e.g., nucleotide or amino acid) comparison window. "Identity" can be readily calculated by known methods, including but not limited to the methods described in the following documents: Computational Molecular Biology (Lesk, AM ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM and Griffin, HG ed.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G. ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J. ed.) Stockton Press, New York (1991).

[0145] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent sequence identity" may refer to the percentage of identical amino acids in an amino acid sequence compared to a reference polypeptide.

[0146] As used herein, the phrases "substantially identical" or "substantial identity" in the context of two nucleic acid molecules, nucleotide sequences, or polypeptide sequences, means that two or more sequences or subsequences have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence as determined using one of the following sequence comparison algorithms, or by visual inspection. In some embodiments of the invention, substantial identity exists over a region of contiguous nucleotides of a nucleotide sequence of the invention, the region being from about 10 nucleotides to about 20 nucleotides, from about 10 nucleotides to about 25 nucleotides, from about 10 nucleotides to about 30 nucleotides, from about 15 nucleotides to about 25 nucleotides, from about 30 nucleotides to about 40 nucleotides, from about 50 nucleotides to about 60 nucleotides, from about 70 nucleotides to about 80 nucleotides, from about 90 nucleotides to about 100 nucleotides, from about 100 nucleotides to about 200 nucleotides, from about 100 nucleotides to about 300 nucleotides, from about 100 nucleotides to about 400 nucleotides, from about 100 nucleotides to about 500 nucleotides, from about 100 nucleotides to about 600 nucleotides, from about 100 nucleotides to about 800 nucleotides, from about 100 nucleotides to about 900 nucleotides, or longer, or any range therein, up to the full length of the sequence. In some embodiments, the nucleotide sequences may be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 60, 70, or 80 nucleotides or more).

[0147] In some embodiments of the invention, substantial identity exists over a region of contiguous amino acid residues of a polypeptide of the invention that is from about 3 amino acid residues to about 20 amino acid residues, from about 5 amino acid residues to about 25 amino acid residues, from about 7 amino acid residues to about 30 amino acid residues, from about 10 amino acid residues to about 25 amino acid residues, from about 15 amino acid residues to about 30 amino acid residues, from about 20 amino acid residues to about 40 amino acid residues, from about 25 amino acid residues to about 40 amino acid residues, from about 25 amino acid residues to about 50 amino acid residues, from about 30 amino acid residues to about 50 amino acid residues, from about 40 amino acid residues to about 50 amino acid residues, from about 40 amino acid residues to about 70 amino acid residues, from about 50 amino acid residues to about 70 amino acid residues, from about 60 amino acid residues to about 80 amino acid residues, from about 70 amino acid residues to about 80 amino acid residues, from about 90 amino acid residues to about 100 amino acid residues, or more, and any ranges therein, up to the full length of the sequence. In some embodiments, the polypeptide sequence can be within at least about 8 consecutive amino acid residues (e.g., a length of about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 130, 140, 150, 175, 200, 225, 250, 275, 300, 310, 320, 330 or 340 or more amino acids or more consecutive amino acid residues are substantially identical to each other.In some embodiments, two or more NAC7 polypeptides may be identical or substantially identical (e.g., at least 70% to 99.9% identical; e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identical or any range or value therein) over at least 8 contiguous amino acids to about 350 contiguous amino acids. In some embodiments, two or more NAC7 polypeptides may be identical or substantially identical over at least 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids to about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 consecutive amino acids.

[0148] For sequence comparison, usually one sequence acts as a reference sequence compared to a test sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. Then, the sequence comparison algorithm calculates the sequence identity percentage of the test sequence relative to the reference sequence based on the specified program parameters.

[0149] Optimal alignment of sequences for comparison windows is well known to those skilled in the art and can be performed by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the similarity search method of Pearson and Lipman, and optionally by computerized implementations of these algorithms, such as GAP, BESTFIT, FASTA and TFASTA, which can be used as Wisconsin (Accelrys Inc., San Diego, CA). The "identity score" for the alignment fragment of the test sequence and the reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence fragment (e.g., the entire reference sequence or a smaller defined portion of the reference sequence). The percentage of sequence identity is expressed as the identity score multiplied by 100. The comparison of one or more polynucleotide sequences can be a comparison with a full-length polynucleotide sequence or a portion thereof, or a comparison with a longer polynucleotide sequence. For purposes of the present invention, BLASTX version 2.0 can also be used to determine the "identity percentage" for the translated nucleotide sequence, and BLASTN version 2.0 can be used to determine the "identity percentage" for the polynucleotide sequence.

[0150] When two nucleotide sequences hybridize to each other under stringent conditions, the two sequences may also be considered to be substantially complementary. In some embodiments, two nucleotide sequences that are considered to be substantially complementary hybridize to each other under highly stringent conditions.

[0151] In the context of nucleic acid hybridization experiments (such as Southern and Northern hybridizations), "stringent hybridization conditions" and "stringent hybridization wash conditions" are sequence-dependent and are different under different environmental parameters. An extensive guide to nucleic acid hybridization can be found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993). In general, highly stringent hybridization and wash conditions are selected to be higher than the thermal melting point (Tf) for the specific sequence at a defined ionic strength and pH. m ) is about 5℃ lower.

[0152] T m It is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen to be equal to the T for a specific probe. m. An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences with more than 100 complementary residues on a filter membrane in a Southern or Northern blot is hybridization overnight with 50% formamide and 1 mg of heparin at 42°C. An example of highly stringent washing conditions is washing with 0.15M NaCl at 72°C for about 15 minutes. An example of stringent washing conditions is washing with 0.2x SSC at 65°C for 15 minutes (for a description of SSC buffer, see Sambrook below). Typically, a low stringency wash is performed before a high stringency wash to remove background probe signals. For example, an example of a medium stringency wash for a duplex of more than 100 nucleotides is washing with 1x SSC at 45°C for 15 minutes. For example, an example of a low stringency wash for a duplex of more than 100 nucleotides is washing with 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and a temperature of typically at least about 30° C. Stringent conditions may also be achieved by adding a destabilizing agent such as formamide. In general, a signal-to-noise ratio of 2 times (or higher) that observed for an unrelated probe in a particular hybridization assay indicates that specific hybridization has been detected. Nucleotide sequences that do not hybridize to each other under stringent conditions are still substantially identical if the proteins encoded by the nucleotide sequences are substantially identical. This occurs, for example, when a copy of a nucleotide sequence is produced using the maximum codon degeneracy allowed by the genetic code.

[0153] The polynucleotides and / or recombinant nucleic acid constructs (e.g., expression cassettes and / or vectors) of the invention may be codon optimized for expression. In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes and / or vectors of the editing systems of the invention (e.g., comprising / encoding sequence-specific nucleic acid binding domains (e.g., sequence-specific nucleic acid binding domains (e.g., DNA binding domains) from: polynucleotide-guided endonucleases, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), Argonaute proteins and / or CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins) (e.g., type I CRISPR-Cas effector proteins, type II CRISPR-Cas effector proteins, type III CRISPR-Cas effector proteins, type IV CRISPR-Cas effector proteins) are codon-optimized for expression. ISPR-Cas effector protein, type V CRISPR-Cas effector protein or type VI CRISPR-Cas effector protein)), nucleases (e.g., endonucleases (e.g., Fok1), polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector protein), zinc finger nucleases and / or transcription activator-like effector nucleases (TALENs)), deaminase proteins / domains (e.g., adenine deaminase, cytosine deaminase), polynucleotides encoding reverse transcriptase proteins or domains, polynucleotides encoding 5'-3' exonuclease polypeptides and / or affinity polypeptides, peptide tags, etc.) can be codon-optimized for expression in plants. In some embodiments, a codon-optimized nucleic acid, polynucleotide, expression cassette, and / or vector of the invention has about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%) or more identity to a reference nucleic acid, polynucleotide, expression cassette, and / or vector that has not been codon-optimized.

[0154] In any of the embodiments described herein, the polynucleotides or nucleic acid constructs of the present invention may be operably associated with a variety of promoters and / or other regulatory elements for expression in plants and / or plant cells. Therefore, in some embodiments, the polynucleotides or nucleic acid constructs of the present invention may also include one or more promoters, introns, enhancers and / or terminators operably connected to one or more nucleotide sequences. In some embodiments, a promoter may be operably associated with an intron (e.g., Ubil promoter and intron). In some embodiments, a promoter associated with an intron may be referred to as a "promoter region" (e.g., Ubil promoter and intron).

[0155] As used herein, "operably linked" or "operably associated" in relation to a polynucleotide means that the indicated elements are functionally related to each other, and usually also physically related. Thus, as used herein, the term "operably linked" or "operably associated" refers to functionally associated nucleotide sequences on a single nucleic acid molecule. Thus, a first nucleotide sequence that is operably linked to a second nucleotide sequence refers to a situation where the first nucleotide sequence is in a functional relationship with the second nucleotide sequence. For example, if a promoter affects the transcription or expression of a nucleotide sequence, then the promoter is operably associated with the nucleotide sequence. Those skilled in the art will understand that a control sequence (e.g., a promoter) does not have to be adjacent to the nucleotide sequence to which it is operably associated, as long as the function of the control sequence is to direct its expression. Thus, for example, there may be an intervening untranslated but transcribed nucleic acid sequence between a promoter and a nucleotide sequence, and the promoter may still be considered to be "operably linked" to the nucleotide sequence.

[0156] As used herein, the term "linked" in relation to a polypeptide refers to the connection of one polypeptide to another polypeptide. A polypeptide can be linked to another polypeptide (at the N-terminus or C-terminus) directly (eg, via a peptide bond) or via a linker.

[0157] The term "joint" is recognized in the art and refers to a chemical group or molecule that connects two molecules or parts, such as two domains of a fusion protein, such as, for example, a nucleic acid binding polypeptide or domain and a peptide tag and / or a reverse transcriptase and an affinity polypeptide bound to the peptide tag; or a DNA endonuclease polypeptide or domain and a peptide tag and / or a reverse transcriptase and an affinity polypeptide bound to the peptide tag. The joint may consist of a single connecting molecule, or may contain more than one connecting molecule. In some embodiments, the joint may be an organic molecule, a group, a polymer, or a chemical moiety, such as a divalent organic moiety. In some embodiments, the joint may be an amino acid, or may be a peptide. In some embodiments, the joint is a peptide.

[0158] In some embodiments, the length of a peptide linker useful in the invention can be from about 2 to about 100 or more amino acids, for example, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids (e.g., about 2 to about 40, about 2 to about 50, about 2 to about 60, about 4 to about 40, about 4 to about 50, about 4 to about 60, about 5 to about 40, about 5 to about 50, about 5 to about 60 35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50,51,52,53,54,55,56,57,58,59,50 In some embodiments, the peptide linker can be a GS linker.

[0159] As used herein, the term "connection" or "fusion" related to polynucleotides refers to the connection of one polynucleotide to another polynucleotide. In some embodiments, two or more polynucleotide molecules can be connected by a joint, which can be an organic molecule, a group, a polymer or a chemical part, such as a divalent organic part. Polynucleotides can be connected or fused to another polynucleotide (at the 5' end or 3' end) by covalent or non-covalent bonds or in conjunction (including, for example, by Watson-Crick base pairing or by one or more connecting nucleotides). In some embodiments, a polynucleotide motif of a certain structure can be inserted into another polynucleotide sequence (for example, an extension of a hairpin structure in a guide RNA). In some embodiments, the connecting nucleotides can be naturally occurring nucleotides. In some embodiments, the connecting nucleotides can be non-naturally occurring nucleotides.

[0160] "Promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) operably associated with the promoter. The coding sequence controlled or regulated by the promoter can encode a polypeptide and / or a functional RNA. Generally, "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and guides transcription initiation. In general, the promoter is located at 5' or upstream of the start of the coding region of the corresponding coding sequence. The promoter may include other elements that act as gene expression regulatory factors; for example, a promoter region. These include a TATA box consensus sequence, and generally also include a CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50: 349). In plants, the CAAT box can be replaced by an AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).

[0161] Promoters useful in the present invention may include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue-specific promoters for use in preparing recombinant nucleic acid molecules, for example, "synthetic nucleic acid constructs" or "protein-RNA complexes." These different types of promoters are known in the art.

[0162] The selection of promoters may vary depending on the temporal and spatial requirements of expression, and may also vary depending on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge available in the art, appropriate promoters may be selected for a particular host organism of interest. Thus, for example, promoters upstream of genes that are highly constitutively expressed in model organisms are well known, and this knowledge may be easily obtained and implemented in other systems where appropriate.

[0163] In some embodiments, a promoter functional in plants can be used with the construct of the present invention. Non-limiting examples of promoters that can be used to drive expression in plants include the promoter of RubisCo small subunit gene 1 (PrbcS1), the promoter of the actin gene (Pactin), the promoter of the nitrate reductase gene (Pnr), and the promoter of the repeat carbonic anhydrase gene 1 (Pdca1) (see Walker et al., Plant Cell Rep. 23: 727-735 (2005); Li et al., Gene 403: 132-142 (2007); Li et al., Mol Biol. Rep. 37: 1143-1154 (2010)). PrbcS1 and Pactin are constitutive promoters, and Pnr and Pdca1 are inducible promoters. Pnr is induced by nitrate and repressed by ammonium (Li et al., Gene 403: 132-142 (2007)), and Pdca1 is induced by salt (Li et al., Mol Biol. Rep. 37: 1143-1154 (2010)). In some embodiments, the promoter useful in the present invention is an RNA polymerase II (Pol II) promoter. In some embodiments, the U6 promoter or 7SL promoter from corn (Zea mays) can be used in the constructs of the present invention. In some embodiments, the U6c promoter and / or the 7SL promoter from corn can be used to drive the expression of the guide nucleic acid. In some embodiments, the U6c promoter, U6i promoter and / or 7SL promoter from soybean (Glycine max) can be used in the constructs of the present invention. In some embodiments, the U6c promoter, U6i promoter and / or 7SL promoter from soybean can be used to drive the expression of the guide nucleic acid.

[0164] Examples of constitutive promoters useful in plants include, but are not limited to, the cestrum virus promoter (cmp) (U.S. Pat. No. 7,166,770), the rice actin 1 promoter (Wang et al. (1992) Mol. Cell. Biol. 12:3399-3406; and U.S. Pat. No. 5,641,876), the CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812), the CaMV 19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-324), the nos promoter (Ebert et al. (1987) Proc. Natl. Acad. Sci. USA 84:5745-5749), the Adh promoter (Walker et al. (1987) Proc. Natl. Acad. Sci. USA 84:5745-5749), the 84:6624-6629), sucrose synthase promoter (Yang and Russell (1990) Proc. Natl. Acad. Sci. USA 87:4144-4148) and ubiquitin promoter. Constitutive promoters derived from ubiquitin accumulate in many cell types. Ubiquitin promoters have been cloned from several plant species for use in transgenic plants, for example, sunflower (Binet et al., 1991. Plant Science 79:87-94), corn (Christensen et al., 1989. Plant Molec. Biol. 12:619-632) and Arabidopsis thaliana (Norris et al., 1993. Plant Molec. Biol. 21:895-906). The corn ubiquitin promoter (UbiP) has been developed in a transgenic monocot system, and its sequence and vectors constructed for monocot transformation are disclosed in patent publication EP 0 342 926. The ubiquitin promoter is suitable for expressing the nucleotide sequence of the present invention in transgenic plants, especially monocotyledons. In addition, the promoter expression cassette described by McElroy et al. (Mol. Gen. Genet. 231: 150-160 (1991)) can be easily modified for the expression of the nucleotide sequence of the present invention, and is particularly suitable for monocotyledon hosts.

[0165] In some embodiments, tissue-specific / tissue-preferred promoters can be used to express heterologous polynucleotides in plant cells. Tissue-specific or preferred expression patterns include, but are not limited to, green tissue-specific or preferred, root-specific or preferred, stem-specific or preferred, flower-specific or preferred, or pollen-specific or preferred. Promoters suitable for expression in green tissues include many promoters of genes involved in photosynthesis, many of which are cloned from monocots and dicots. In one embodiment, a promoter useful in the present invention is the corn PEPC promoter (Hudspeth and Grula, Plant Molec.Biol.12:579-589 (1989)) from the phosphoenol carboxylase gene. Non-limiting examples of tissue-specific promoters include those associated with genes encoding seed storage proteins (such as β-conglycinin, cruciferin, napin, and phaseolin), zein or oil body proteins (such as oleosin), or proteins involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase, and fatty acid desaturase (fad 2-1), as well as other nucleic acids expressed during embryo development (such as Bce4, see, e.g., Kridl et al. (1991) Seed Sci. Res. 1: 209-219; and EP Patent No. 255378). Tissue-specific or tissue-preferred promoters useful for expressing the nucleotide sequences of the present invention in plants, particularly corn, include, but are not limited to, those that direct expression in roots, pith, leaves, or pollen. Such promoters are disclosed, for example, in WO 93 / 07278 (incorporated herein by reference in its entirety).Other non-limiting examples of tissue-specific or tissue-preferred promoters that can be used in the present invention are the cotton rubisco promoter disclosed in U.S. Pat. No. 6,040,504; the rice sucrose synthase promoter disclosed in U.S. Pat. No. 5,604,121; the root-specific promoter described by de Framond (FEBS 290: 103-106 (1991); EP 0 452 269 to Ciba-Geigy); the stem-specific promoter described in U.S. Pat. No. 5,625,136 (to Ciba-Geigy), which drives expression of the maize trpA gene; the tuberose yellow leaf curl virus promoter disclosed in WO 01 / 73087; and pollen-specific or -preferred promoters, including but not limited to ProOsLPS10 and ProOsLPS11 from rice (Nguyen et al., Plant Biotechnol. Reports 2004). 9(5):297-306 (2015)), ZmSTK2_USP from maize (Wang et al., Genome 60(6):485-495 (2017)), LAT52 and LAT59 from tomato (Twell et al., Development 109(3):705-713 (1990)), Zm13 (U.S. Pat. No. 10,421,972), PLA2-δ promoter from Arabidopsis thaliana (U.S. Pat. No. 7,141,424) and / or ZmC5 promoter from maize (International PCT Publication No. WO1999 / 042587).

[0166] Additional examples of plant tissue-specific / tissue-preferred promoters include, but are not limited to, root hair-specific cis-element (RHE) (Kim et al., The Plant Cell 18:2958-2970 (2006)), root-specific promoters RCc3 (Jeong et al., Plant Physiol. 153:185-197 (2010)) and RB7 (U.S. Pat. No. 5,459,252), lectin promoter (Lindstrom et al. (1990) Der. Genet. 11:160-167; and Vodkin (1983) Prog. Clin. Biol. Res. 138:87-98), corn alcohol dehydrogenase 1 promoter (Dennis et al. (1984) Nucleic Acids Res. 12:3983-4000), S-adenosyl-L-methionine synthetase (SAMS) (Vander Mijnsbrugge et al. (1996) Plant and Cell Physiology, 37 (8): 1108-1115), the maize light harvesting complex promoter (Bansal et al. (1992) Proc. Natl. Acad. Sci. USA 89: 3654-3658), the maize heat shock protein promoter (O'Dell et al. (1985) EMBO J. 5: 451-458; and Rochester et al. (1986) EMBO J. 5: 451-458), the pea small subunit RuBP carboxylase promoter (Cashmore, "Nuclear genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase" pp. 29-39, in: Genetic Engineering of Plants (Hollaender, ed., Plenum Press, 1996), 1983; and Poulsen et al. (1986) Mol. Gen. Genet. 205:193-200), the Ti plasmid mannopine synthase promoter (Langridge et al. (1989) Proc. Natl. Acad. Sci. USA 86:3219-3223), the Ti plasmid nopaline synthase promoter (Langridge et al. (1989), supra), the petunia chalcone isomerase promoter (van Tunen et al. (1988) EMBO J. 7:1257-1263), the legume glycine-rich protein 1 promoter (Keller et al. (1989) Genes Dev.3:1639-1646), a truncated CaMV 35S promoter (O'Dell et al. (1985) Nature 313:810-812), a potato glycoprotein promoter (Wenzler et al. (1989) Plant Mol. Biol. 13:347-354), a root cell promoter (Yamamoto et al. (1990) Nucleic Acids Res. 18:7449), a zein promoter (Kriz et al. (1987) Mol. Gen. Genet. 207:90-98; Langridge et al. (1983) Cell 34:1015-1022; Reina et al. (1990) Nucleic Acids Res. 18:6425; Reina et al. (1990) Nucleic Acids Res. 18: 7449; and Wandelt et al. (1989) Nucleic Acids Res. 17: 2354), globulin-1 promoter (Belanger et al. (1991) Genetics 129: 863-872), α-tubulin cab promoter (Sullivan et al. (1989) Mol. Gen. Genet. 215: 431-440), PEPCase promoter (Hudspeth and Grula (1989) Plant Mol. Biol. 12: 579-589), R gene complex-associated promoter (Chandler et al. (1989) Plant Cell 1: 1175-1183) and chalcone synthase promoter (Franken et al. (1991) EMBO J. 10: 2605-2612).

[0167] Useful for seed-specific expression is the vicilin promoter (Czako et al. (1992) Mol. Gen. Genet. 235:33-40; and seed-specific promoters disclosed in U.S. Pat. No. 5,625,136). Useful promoters for expression in mature leaves are those that switch at the onset of senescence, such as the SAG promoter from Arabidopsis thaliana (Gan et al. (1995) Science 270:1986-1988).

[0168] In addition, promoters that are functional in chloroplasts can be used. Non-limiting examples of such promoters include phage T3 gene 9 5'UTR and other promoters disclosed in U.S. Patent No. 7,579,516. Other promoters that can be used in the present invention include, but are not limited to, the S-E9 small subunit RuBP carboxylase promoter and the Kunitz trypsin inhibitor gene promoter (Kti3).

[0169] Additional regulatory elements useful in the present invention include, but are not limited to, introns, enhancers, termination sequences, and / or 5' and 3' untranslated regions.

[0170] Introns that can be used in the present invention can be identified in plants and separated from plants, and then inserted into introns in expression cassettes for plant transformation. As will be appreciated by those skilled in the art, introns can include sequences required for self-excision and are incorporated into nucleic acid constructs / expression cassettes in frame. Introns can be used as spacers to separate multiple protein coding sequences in a nucleic acid construct, or introns can be used in a protein coding sequence, for example, to stabilize mRNA. If they are used in a protein coding sequence, they are inserted "in frame" and include excision sites. Introns can also be associated with promoters to improve or modify expression. As an example, promoter / intron combinations that can be used in the present invention include but are not limited to promoter / intron combinations of corn Ubil promoters and introns (see, for example, SEQ ID NO:21 and SEQ ID NO:22).

[0171] Non-limiting examples of introns that can be used in the present invention include introns from the following genes: ADHI gene (e.g., Adh1-S intron 1, 2 and 6), ubiquitin gene (Ubil), RuBisCO small subunit (rbcS) gene, RuBisCO large subunit (rbcL) gene, actin gene (e.g., actin-1 intron), pyruvate dehydrogenase kinase gene (pdk), nitrate reductase gene (nr), repeated carbonic anhydrase gene 1 (Tdca1), psbA gene, atpA gene, or any combination thereof.

[0172] In some embodiments, the polynucleotides and / or nucleic acid constructs of the present invention may be "expression cassettes", or may be contained within expression cassettes. As used herein, "expression cassettes" refer to recombinant nucleic acid molecules comprising, for example, one or more polynucleotides of the present invention (e.g., polynucleotides encoding sequence-specific nucleic acid binding domains, polynucleotides encoding deaminase proteins or domains, polynucleotides encoding reverse transcriptase proteins or domains, polynucleotides encoding 5'-3' exonuclease polypeptides or domains, guide nucleic acids and / or reverse transcriptase (RT) templates), wherein the polynucleotides are operably associated with one or more control sequences (e.g., promoters, terminators, etc.). Thus, in some embodiments, one or more expression cassettes may be provided, which are designed to express, for example, a nucleic acid construct of the invention (e.g., a polynucleotide encoding a sequence-specific nucleic acid binding domain, a polynucleotide encoding a nuclease polypeptide / domain, a polynucleotide encoding a deaminase protein / domain, a polynucleotide encoding a reverse transcriptase protein / domain, a polynucleotide encoding a 5'-3' exonuclease polypeptide / domain, a polynucleotide encoding a peptide tag, and / or a polynucleotide encoding an affinity polypeptide, etc., or comprising a guide nucleic acid, an extended guide nucleic acid, and / or an RT template, etc.). When the expression cassette of the invention comprises more than one polynucleotide, the polynucleotide may be operably linked to a single promoter that drives expression of all polynucleotides, or the polynucleotide may be operably linked to one or more separate promoters (e.g., three polynucleotides may be driven by one, two, or three promoters in any combination). When two or more separate promoters are used, the promoters may be the same promoter, or they may be different promoters. Thus, when contained in a single expression cassette, a polynucleotide encoding a sequence-specific nucleic acid binding domain, a polynucleotide encoding a nuclease protein / domain, a polynucleotide encoding a CRISPR-Cas effector protein / domain, a polynucleotide encoding a deaminase protein / domain, a polynucleotide encoding a reverse transcriptase polypeptide / domain (e.g., an RNA-dependent DNA polymerase) and / or a polynucleotide encoding a 5'-3' exonuclease polypeptide / domain, a guide nucleic acid, an extended guide nucleic acid and / or an RT template can each be operably linked to a single promoter or separate promoters in any combination.

[0173] The expression cassette comprising the nucleic acid construct of the invention may be chimeric, meaning that at least one (e.g., one or more) of its components is heterologous relative to at least one of its other components (e.g., a promoter from a host organism is operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from an organism different from the host, or is not normally associated with the promoter). The expression cassette may also be naturally occurring, but has been obtained in a recombinant form that can be used for heterologous expression.

[0174] The expression cassette may optionally include a transcription and / or translation termination region (i.e., termination region) and / or an enhancer region that is functional in a selected host cell. A variety of transcription terminators and enhancers are known in the art and can be used in expression cassettes. Transcription terminators are responsible for terminating transcription and correcting mRNA polyadenylation. Termination regions and / or enhancer regions may be natural to the transcription initiation region, may be natural to the following: for example, a gene encoding a sequence-specific nucleic acid binding protein, a gene encoding a nuclease, a gene encoding a reverse transcriptase, a gene encoding a deaminase, etc., or may be natural to a host cell, or may be natural to another source (e.g., to a promoter, a gene encoding a sequence-specific nucleic acid binding protein, a gene encoding a nuclease, a gene encoding a reverse transcriptase, a gene encoding a deaminase, etc., or to a host cell, or any combination thereof, exogenous or heterologous).

[0175] The expression cassette of the present invention may also include a polynucleotide encoding a selectable marker that can be used to select transformed host cells. As used herein, a "selectable marker" refers to a polynucleotide sequence that, when expressed, imparts a unique phenotype to the host cell expressing the marker, thereby allowing such transformed cells to be distinguished from cells without the marker. This polynucleotide sequence can encode a selectable or screenable marker, depending on whether the marker imparts a trait that can be selected by chemical means, such as by using a selection agent (e.g., antibiotics, etc.), or whether the marker is simply a trait that can be identified by observation or testing, such as by screening (e.g., fluorescence). Many examples of suitable selectable markers are known in the art and can be used in expression cassettes described herein.

[0176] In addition to expression cassettes, nucleic acid molecules / constructs and polynucleotide sequences described herein can also be used in combination with vectors. The term "vector" refers to a composition for transferring, delivering or introducing nucleic acids (or multiple nucleic acids) into a cell. Vectors include nucleic acid constructs (e.g., expression cassettes) comprising nucleotide sequences to be transferred, delivered or introduced. Vectors for transforming host organisms are well known in the art. Non-limiting examples of general class vectors include viral vectors, plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, fosmid vectors, phages, artificial chromosomes, minicircles or double-stranded or single-stranded linear or circular forms of Agrobacterium binary vectors, which may or may not be self-transferable or removable. In some embodiments, viral vectors may include, but are not limited to, retroviruses, slow viruses, adenoviruses, adeno-associated viruses or herpes simplex virus vectors. Vectors as defined herein can be transformed prokaryotic or eukaryotic hosts by being integrated into the cell genome or being present outside the chromosome (e.g., autonomously replicating plasmids with a replication origin). In addition, shuttle vectors are also included, and shuttle vectors refer to DNA vectors that can be naturally or intentionally replicated in two different host organisms, and host organisms can be selected from actinomycetes and related species, bacteria and eukaryotic organisms (for example, higher plants, mammals, yeast or fungal cells). In some embodiments, the nucleic acid in the vector is controlled by a suitable promoter or other regulatory elements, and is operably connected to a suitable promoter or other regulatory elements so as to be transcribed in a host cell. The vector can be a bifunctional expression vector that works in a variety of hosts. In the case of genomic DNA, this can include its own promoter and / or other regulatory elements, and in the case of cDNA, this can be controlled by a suitable promoter and / or other regulatory elements so as to be expressed in a host cell. Therefore, the nucleic acid or polynucleotide of the present invention and / or the expression cassette comprising the nucleic acid or polynucleotide can be included in a vector as described herein and known in the art.

[0177] As used herein, "contact," "contacting," "contacted," and grammatical variations thereof refer to bringing together the components of a desired reaction under conditions suitable for carrying out the desired reaction (e.g., transformation, transcriptional control, genome editing, nicking and / or cleavage). As an example, a target nucleic acid can be contacted with a sequence-specific nucleic acid binding protein (e.g., a polynucleotide-guided endonuclease, a CRISPR-Cas endonuclease (e.g., a CRISPR-Cas effector protein), a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN) and / or an Argonaute protein)) and a deaminase or a nucleic acid construct encoding these under the following conditions: the sequence-specific nucleic acid binding protein, the reverse transcriptase and / or the deaminase are expressed, the sequence-specific nucleic acid binding protein binds to the target nucleic acid, and the reverse transcriptase and / or the deaminase can be fused to the sequence-specific nucleic acid binding protein or recruited to the sequence-specific nucleic acid binding protein (e.g., by a peptide tag fused to the sequence-specific nucleic acid binding protein and an affinity tag fused to the reverse transcriptase and / or the deaminase), so that the deaminase and / or the reverse transcriptase are located near the target nucleic acid, thereby modifying the target nucleic acid. Other methods of recruiting reverse transcriptases and / or deaminases using other protein-protein interactions can be used, and RNA-protein interactions and chemical interactions can also be used for protein-protein and protein-nucleic acid recruitment.

[0178] As used herein, "modification" ("modifying" or "modification") of a target nucleic acid includes editing (e.g., mutation), covalent modification, exchange / replacement of nucleic acid / nucleotide bases, deletion, cleavage, nicking, and / or alteration of transcriptional control of a target nucleic acid. In some embodiments, the modification may include any type of one or more single base changes (SNPs).

[0179] "Introducing", "introduce", "introduced" (and grammatical variations thereof) in the context of a polynucleotide of interest refers to presenting a nucleotide sequence of interest (e.g., a polynucleotide, RT template, nucleic acid construct and / or guide nucleic acid) to a plant, a plant part thereof, or a cell thereof in a manner that enables the nucleotide sequence to enter the interior of the cell.

[0180] The terms "transformation" or "transfection" are used interchangeably and as used herein refer to the introduction of a heterologous nucleic acid into a cell. The transformation of a cell can be stable or transient. Thus, in some embodiments, a host cell or host organism (e.g., a plant) can be stably transformed with a polynucleotide / nucleic acid molecule of the present invention. In some embodiments, a host cell or host organism can be transiently transformed with a polynucleotide / nucleic acid molecule of the present invention.

[0181] "Transient transformation" in the context of a polynucleotide means that the polynucleotide is introduced into a cell but is not integrated into the genome of the cell.

[0182] "Stably introduced" or "stably introduced" in the context of a polynucleotide being introduced into a cell means that the introduced polynucleotide is stably incorporated into the genome of the cell, so that the cell is stably transformed with the polynucleotide.

[0183] As used herein, "stable transformation" or "stably transformed" refers to a nucleic acid molecule that is introduced into a cell and integrated into the genome of the cell. Thus, the integrated nucleic acid molecule is capable of being inherited by its progeny, more specifically, by successive generations of progeny. As used herein, "genome" includes nuclear and plastid genomes, and thus includes integration of nucleic acids into, for example, chloroplast or mitochondrial genomes. As used herein, stable transformation may also refer to a transgene that is maintained extrachromosomally, for example, as a minichromosome or plasmid.

[0184] Transient transformation can be detected by, for example, enzyme-linked immunosorbent assay (ELISA) or Western blotting, which can detect the presence of peptides or polypeptides encoded by one or more transgenics introduced into an organism. Stable transformation of cells can be detected by, for example, Southern blot hybridization assays of the genomic DNA of the cells with nucleic acid sequences that specifically hybridize with nucleotide sequences of transgenics introduced into an organism (e.g., a plant). Stable transformation of cells can be detected by, for example, Northern blot hybridization assays of the RNA of the cells with nucleic acid sequences that specifically hybridize with nucleotide sequences of transgenics introduced into a host organism. Stable transformation of cells can also be detected by, for example, polymerase chain reaction (PCR) or other amplification reactions well known in the art, which employ specific primer sequences that hybridize with target sequences of transgenics, resulting in amplification of transgenic sequences, which can be detected according to standard methods. Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0185] Thus, in some embodiments, the nucleotide sequences, polynucleotides, nucleic acid constructs and / or expression cassettes of the invention can be transiently expressed and / or they can be stably incorporated into the genome of a host organism. Thus, in some embodiments, the nucleic acid constructs of the invention (e.g., one or more expression cassettes comprising polynucleotides for editing as described herein) can be transiently introduced into a cell along with a guide nucleic acid, and therefore, DNA is not maintained in the cell.

[0186] The nucleic acid construct of the present invention can be introduced into plant cells by any method known to those skilled in the art. The non-limiting examples of transformation methods include conversion by bacterial-mediated nucleic acid delivery (for example, by Agrobacterium), virus-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker-mediated nucleic acid delivery, liposome-mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium phosphate-mediated conversion, cyclodextrin-mediated conversion, electroporation, nanoparticle-mediated conversion, ultrasonic treatment, infiltration, PEG-mediated nucleic acid uptake, and any other electrical, chemical, physical (mechanical) and / or biological mechanism that nucleic acid is introduced into plant cells, including any combination thereof. The program for transforming eukaryotic organisms and prokaryotic organisms is well known in the art and conventional, and is described in the literature (see, for example, Jiang et al., 2013.Nat.Biotechnol.31:233-239; Ran et al., Nature Protocols 8:2281–2308 (2013)). General guides to various plant transformation methods known in the art include Miki et al. ("Procedures for Introducing Foreign DNA into Plants", in Methods in Plant Molecular Biology and Biotechnology, Glick, BR and Thompson, JE, eds. (CRC Press, Inc., Boca Raton, 1993), pp. 67-88) and Rakowoczy-Trojanowska (Cell. Mol. Biol. Lett. 7:849-858 (2002)).

[0187] In some embodiments of the present invention, the transformation of cells may include nuclear transformation. In other embodiments, the transformation of cells may include plastid transformation (e.g., chloroplast transformation). In further embodiments, nucleic acids of the present invention may be introduced into cells by conventional breeding techniques. In some embodiments, one or more of polynucleotides, expression cassettes and / or vectors may be introduced into plant cells by Agrobacterium transformation.

[0188] Therefore, polynucleotide can be introduced into plant, plant part, plant cell in any number of ways known in the art.Method of the present invention does not rely on the ad hoc method for introducing one or more nucleotide sequences into plant, as long as they can enter the interior of the cell.If more than one polynucleotide is to be introduced, they can be assembled as a part of a single nucleic acid construct or assembled as an independent nucleic acid construct, and can be located on the same or different nucleic acid constructs.Therefore, polynucleotide can be introduced into interested cell in a single transformation event, or introduced into interested cell in an independent transformation event, or alternatively, polynucleotide can be incorporated into plant as a part of a breeding scheme.

[0189] The present invention relates to modifying the NAC7 gene in plants by editing technology to provide plants exhibiting one or more improved yield traits and / or improved plant architecture, including but not limited to increased flower number, increased flower structure size and / or increased panicle length. The NAC gene family name is derived from the names of three transcription factors: NAM (no apical meristem, petunia), ATAF1-2 (Arabidopsis thaliana activating factor) and CUC2 (cup cotyledon, Arabidopsis), which share the same DNA binding domain (Souer et al., Cell 85, 159-170 (1996); Aida et al., Plant Cell 9, 841-857 (1997)).

[0190] When stressed, plants have homeostatic mechanisms that reduce growth and development (negative factors), while when conditions are favorable, plants have other homeostatic mechanisms that maximize growth and development. One regulator involved in this balance is the NAC transcription factor, called NAC7. Transgenic reduction of NAC7 transcription factor activity increases corn yield in a range of environments (Zhang et al., Plant Biotechnol J.17(12):2272-2285(2019)). NAC transcription factors are involved in many important regulatory processes in plants (Olsen et al., Plant Sci 169,785–797(2005); Fan et al., Plos One 9,e111837(2014); Wang et al., Trends Plant Sci 25,291–301(2020); Wang et al., Plant Sci 294,110436(2020)).

[0191] NAC7 is a NAC gene encoding a transcription factor polypeptide containing a NAC7 domain. The present invention relates to modifying the NAC7 gene in plants by genome editing. The editing strategy that can be used for the present invention may include generating mutations in one or more than one (e.g., 1, 2, 3 and / or 4) NAC7 genes. Mutations that can be used to generate plants with one or more improved yield traits (e.g., increased number of flowers, increased flower structure size and / or increased spike length) include, for example, substitutions, deletions and / or insertions. The mutations generated by the editing technology are non-natural mutations. In some aspects, the mutations generated by the editing technology may be point mutations. In some embodiments, mutations in one or more NAC7 genes as described herein result in knockdown of the expression of one or more NAC7 genes. In some embodiments, a mutation as described herein results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0192] In some embodiments, the present invention provides a plant or plant part thereof comprising at least one mutation in (e.g., one or more) endogenous NAC7 genes encoding a transcription factor polypeptide containing a NAC7 domain. In some embodiments, the mutation may be a dominant negative mutation. In some embodiments, the mutation may be a non-natural mutation. In some embodiments, the mutation may be a knockout mutation or a knockdown mutation. As used herein, a knockout mutation results in little or no expression of the encoded polypeptide and / or a zero percent activity. The knockout mutation results in at least a 5% decrease in activity (e.g., a decrease in activity of about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111 %, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, and any range or value therein).

[0193] In some embodiments, a plant cell is provided, the plant cell comprising an editing system, the editing system comprising: (a) a CRISPR-Cas effector protein; and (b) a guide nucleic acid (e.g., gRNA, gDNA, crRNA, crDNA, sgRNA, sgDNA), the guide nucleic acid comprising a spacer sequence complementary to an endogenous target gene encoding a transcription factor polypeptide containing a NAC7 domain in the plant cell. The editing system can be used to generate a mutation in an endogenous target gene encoding a transcription factor polypeptide containing a NAC7 domain. In some embodiments, the mutation is a deletion that results in truncation of a transcription factor polypeptide containing a NAC7 domain (e.g., truncation of about 2 to about 200 amino acid residues from the C-terminus of the polypeptide). In some embodiments, the endogenous target gene is an endogenous NAC7 gene. In some embodiments, the mutation is a non-natural mutation. In some embodiments, the endogenous target gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73, (b) comprises a region having at least 80% sequence identity to any one of SEQ ID NOs: 75-98, (c) encodes a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 74; and / or (d) encodes a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103. In some embodiments, the guide nucleic acid of the editing system may comprise a nucleotide sequence (spacer sequence, e.g., one or more spacers) of any one of SEQ ID NOs: 99-101 (e.g., SEQ ID NO: 99 (PWsp1634), SEQ ID NO: 100 (PWsp1635), and / or SEQ ID NO: 101 (PWsp1636)) or a reverse complement thereof.

[0194] The mutation in the NAC7 gene of the plant, plant part thereof (e.g., plant cell) useful in the present invention can be any type of mutation, including base substitution, base deletion and / or base insertion. In some embodiments, at least one mutation can be a non-natural mutation. In some embodiments, the mutation can include a base substitution to A, T, G or C.In some embodiments, the mutation can be at least one base pair (e.g., 1 base pair to about 200 base pairs; e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129 9, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 154, 155, 156, 157, 158, 159, 160, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 or 200 consecutive base pairs; for example, 1 to about 150 consecutive base pairs, 1 to about 100 base pairs, 1 to about 50 consecutive base pairs, 1 to about 30 consecutive base pairs, 1 to about 15 consecutive base pairs), or an insertion of at least one base pair (e.g., 1 base pair to about 15 base pairs; for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 consecutive base pairs), optionally wherein the deletion or insertion is an out-of-frame deletion or out-of-frame insertion.In some embodiments, the mutation can be an insertion of at least one base pair (e.g., 1 base pair to about 30 base pairs; e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive base pairs; optionally 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, or 15 consecutive base pairs), optionally wherein the insertion is an out-of-frame insertion.

[0195] In some embodiments, the mutation in the endogenous NAC7 gene may be located in exon 3, exon 4 and / or the non-coding region between exon 3 and exon 4, optionally in the region of the endogenous NAC7 gene between about nucleotide 5094 to about nucleotide 5607 with reference to nucleotide position numbering of SEQ ID NO: 72. In some embodiments, the mutation may be an out-of-frame deletion or out-of-frame insertion, which may result in a truncated polypeptide, such as a C-terminal truncation, optionally wherein the N-terminus of the protein is retained, optionally wherein the mutation results in a truncated NAC7 polypeptide, which may comprise about 150 to about 200 N-terminal residues of the endogenous NAC7 polypeptide. In some embodiments, the out-of-frame deletion or out-of-frame insertion may be a dominant negative mutation. In some embodiments, the mutation located in exon 3, exon 4, and / or the non-coding region between exon 3 and exon 4 of the NAC7 gene may be a deletion or insertion that results in a premature stop codon (e.g., an out-of-frame base insertion or an out-of-frame base deletion) and a truncated NAC7 domain-containing transcription factor polypeptide. In some embodiments, the mutation may result in a NAC7 domain-containing transcription factor polypeptide with a C-terminal truncation, optionally wherein the C-terminal truncation results in a deletion of about 1 amino acid residue to about 200 amino acid residues from the C-terminus of the NAC7 domain-containing transcription factor polypeptide (e.g.,1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 or 200 consecutive amino acid residues, optionally about 1 to about 198 consecutive amino acid residues, optionally deleted from about 140 amino acid residues to about 200 amino acid residues (e.g.,About 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 1, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 or 200 consecutive amino acid residues)).

[0196] Types of editing tools that can be used to generate these and other mutations in the NAC7 gene include any base editor or cutter that is directed to a target site using a spacer that is at least 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to a portion or region of the NAC7 gene as described herein.

[0197] In some embodiments, the mutation in the NAC7 gene may be within a portion or region of an endogenous NAC7 gene having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-98, and / or within a region of the NAC7 gene encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103.

[0198] In some embodiments, a mutation as described herein results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0199] An endogenous NAC7 gene (e.g., an endogenous target gene) useful in the present invention encodes a transcription factor polypeptide containing a NAC7 domain. In some embodiments, the endogenous NAC7 gene (e.g., an endogenous target gene) (1) may comprise a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73, (2) may comprise a region having at least 80% sequence identity to any one of SEQ ID NOs: 75-98, (3) may encode a polypeptide having at least 80% sequence identity to SEQ ID NO: 74, and / or (4) may encode a NAC7 polypeptide region having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO: 103.

[0200] In some embodiments, a plant (e.g., a corn plant) comprising at least one (e.g., one or more) mutation in an endogenous NAC7 gene (in at least one endogenous NAC7 gene, e.g., in one or more NAC7 genes) can exhibit one or more improved yield traits (e.g., increased flower number, increased floral structure size, and / or increased ear length) compared to a plant lacking the at least one mutation (e.g., an isogenic plant (e.g., a wild-type, unedited plant or a null segregant). In some embodiments, a plant comprising at least one mutation in an endogenous NAC7 gene can exhibit increased flower number, increased floral structure size, and / or increased ear length compared to a plant lacking the at least one mutation (e.g., an isogenic plant (e.g., a wild-type, unedited plant or a null segregant). In some embodiments, at least one mutation can be a non-natural mutation.

[0201] In some embodiments, plants can be regenerated from plant parts and / or plant cells of the present invention comprising a mutation in one or more endogenous NAC7 genes as described herein, wherein the regenerated plant comprises a mutation in one or more endogenous NAC7 genes and has a phenotype of increased flower number, increased floral structure size, and / or increased panicle length compared to a plant lacking the same mutation in one or more NAC7 genes. In some embodiments, the regenerated plant may comprise a mutant NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or may encode a mutant NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0202] In some embodiments, a plant cell is provided, the plant cell comprising at least one (e.g., one or more) mutations within an endogenous NAC7 gene, wherein at least one mutation is a substitution, insertion, or deletion introduced using an editing system comprising a nucleic acid binding domain that binds to a target site in an endogenous NAC7 gene. In some embodiments, the substitution, insertion, or deletion results in, for example, an early stop codon. In some embodiments, the substitution, insertion, or deletion results in, for example, a truncated NAC7 domain-containing transcription factor polypeptide (e.g., truncation results in a protein with a C-terminal truncation). In some embodiments, at least one mutation may be a point mutation, optionally resulting in an early stop codon, optionally a truncated NAC7 domain-containing transcription factor polypeptide. In some embodiments, at least one mutation within the NAC7 gene may be an insertion and / or deletion, optionally at least one mutation may be an out-of-frame insertion or out-of-frame deletion. In some embodiments, at least one mutation may be a non-natural mutation. In some embodiments, a plant cell produced as described herein may comprise a mutant NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or may encode a mutant NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0203] In some embodiments, the target site in the NAC7 gene of a plant cell may be within a region or portion of an endogenous NAC7 gene that has at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-98, and / or that encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103.

[0204] In some embodiments, mutations can be generated after cleavage by an editing system comprising a nuclease and a nucleic acid binding domain that binds to a target site within a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 72 or SEQ ID NO: 73, optionally to a target site located in exon 3, exon 4, and / or a non-coding region between exon 3 and exon 4, optionally to a target site in an endogenous NAC7 gene region located between about nucleotide 5094 and about nucleotide 5607 with reference to nucleotide position numbering of SEQ ID NO: 72, or to a target site within an endogenous NAC7 gene region having at least 80% sequence identity to any one of SEQ ID NOs: 75-98 or encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO: 103, and at least one mutation within the NAC7 gene is generated after cleavage by the nuclease. In some embodiments, at least one mutation can be a non-natural mutation. In some embodiments, the mutations generated after cleavage by the editing system can result in a mutant NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or can encode a mutant NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118. In some embodiments, at least one mutation can result in a dominant negative mutation.

[0205] In some embodiments, the plant cell is regenerated into a plant comprising at least one mutation, optionally wherein the plant regenerated from the plant cell exhibits a phenotype of one or more improved yield traits compared to a wild-type plant not comprising / lacking the allele (e.g., an isogenic wild-type plant), optionally wherein the one or more improved yield traits include, but are not limited to, increased yield (bushels / acre), increased biomass, increased number of flowers, altered flowering time (earlier or later), increased flower structure size, increased ear length, increased kernel number, increased kernel size, increased number of pods (including increased number of pods per node and / or increased number of pods per plant), increased number of seeds per pod, increased number of seeds, increased seed size, and / or increased seed weight (e.g., increased 100-seed weight) compared to a control plant lacking at least one mutation. In some embodiments, the plant regenerated from the plant cell exhibits a phenotype of increased number of flowers, increased flower structure size, and / or increased ear length compared to a control plant lacking at least one mutation.

[0206] In some embodiments, a method for producing / cultivating a transgenic-free edited plant (e.g., a corn plant) is provided, the method comprising: crossing a plant of the present invention (e.g., a plant comprising one or more mutations (e.g., non-natural mutations) in one or more NAC7 genes and having increased flower number, increased floral structure size, and / or increased ear length) with a transgenic-free plant, thereby introducing the mutation into the transgenic-free plant; and selecting progeny plants comprising the mutation and being free of the transgene, thereby producing a transgenic-free edited plant.

[0207] Also provided herein is a method of providing a plurality of plants (e.g., corn plants) exhibiting increased flower number, increased floral structure size, and / or increased ear length, the method comprising planting two or more plants of the present invention (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, 400, 5000, or 10,000 or more plants comprising one or more mutations (e.g., non-natural mutations) in one or more NAC7 genes and exhibiting increased flower number, increased floral structure size, and / or increased ear length) in a growing area (e.g., a field (e.g., cultivated land, agricultural field), a growth chamber, a greenhouse, a recreational area, a lawn, and / or a roadside, etc.), thereby providing a plurality of plants exhibiting increased flower number, increased floral structure size, and / or increased ear length compared to a plurality of control plants lacking the mutation.

[0208] In some embodiments, a method of generating a mutation in an endogenous NAC7 gene of a plant is provided, the method comprising: (a) targeting a gene editing system to a portion of a NAC1 gene comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; and (b) selecting a plant comprising a modification located in a region of the NAC7 gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-98. In some embodiments, the modification is an out-of-frame deletion or out-of-frame insertion, optionally resulting in a truncated NAC7 domain-containing transcription factor polypeptide. In some embodiments, the mutation generated may result in a NAC7 gene comprising a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117.

[0209] In some embodiments, a method of generating a variation in a NAC7 gene is provided, the method comprising: introducing an editing system into a plant cell, wherein the editing system targets a region of the NAC7 gene encoding a transcription factor polypeptide containing a NAC7 domain; and contacting the region of the NAC7 gene with the editing system, thereby introducing a mutation into the NAC7 gene and generating a variation in the NAC7 gene in the plant cell. In some embodiments, the NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO:102 or SEQ ID NO:103, optionally wherein the targeted NAC7 gene region has at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-98, and / or encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103. In some embodiments, contacting a region of an endogenous NAC7 gene in a plant cell with an editing system produces a plant cell comprising an edited endogenous NAC7 gene in its genome, the method further comprising (a) regenerating a plant from the plant cell; (b) selfing the plant to produce a progeny plant (E1); (c) analyzing the progeny plant of (b) for increased flower number, increased floral structure size and / or increased ear length; and (d) selecting progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length to produce selected progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length compared to a control plant. In some embodiments, the method of editing a specific site may also include (e) selfing the selected progeny plant of (d) to produce a progeny plant (E2); (f) analyzing the progeny plant of (e) for increased flower number, increased floral structure size and / or increased ear length; and (g) selecting progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length to produce selected progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length compared to control plants, optionally repeating (e) to (g) one or more times.

[0210] In some embodiments, a method for detecting a mutant NAC7 gene in a plant (a mutation in an endogenous NAC7 gene) is provided, the method comprising detecting a NAC7 gene in the genome of a plant, the NAC7 gene having at least one mutation in a region located from about nucleotide 5165 to about nucleotide 5607 with reference to the nucleotide position numbering of SEQ ID NO: 72. In some embodiments, the detected mutation is an out-of-frame insertion or an out-of-frame insertion. In some embodiments, the detected mutant NAC7 gene may comprise a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NO: 105, 108, 110, 114, or 117.

[0211] In some embodiments, a method for editing a specific site in the genome of a plant cell is provided, the method comprising: cleaving a target site within an endogenous NAC7 gene in a plant cell in a site-specific manner, the endogenous NAC7 gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region having at least 80% sequence identity to SEQ ID NO:75-98; and / or (c) encoding an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103, thereby generating an edit in the endogenous NAC7 gene of the plant cell, and generating a plant cell comprising the edit in the endogenous NAC7 gene. In some embodiments, the plant cell may be from a corn plant.

[0212] In some embodiments, the editing in the endogenous NAC7 gene results in a mutation, including but not limited to a base deletion, a base substitution, or a base insertion. In some embodiments, the mutation may be a non-natural mutation. In some embodiments, the editing may be located in the non-coding region between exon 3, exon 4, and / or exon 3 and exon 4 of the NAC7 genomic sequence. In some embodiments, the editing may result in a mutation inserted into at least one base pair (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs, e.g., about 1 to about 30 base pairs, e.g., 1 base pair to about 16 consecutive base pairs; e.g., 1, 2, 4, 5, 7, 8, 10, 11, 13, or 14 consecutive base pairs).In some embodiments, the editing may result in a mutation that is a deletion, optionally wherein the deletion is from about 1 to about 150 consecutive base pairs in length, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 9, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150 or more base pairs; for example, from about 1 base pair to about 50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50) consecutive base pairs, about 1-30 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) consecutive base pairs, or about 1-15 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) consecutive base pairs. Deletions or insertions useful in the present invention can be out-of-frame insertions or out-of-frame deletions. In some embodiments, an out-of-frame insertion or out-of-frame deletion can result in a premature stop codon and a truncated protein, optionally wherein the out-of-frame insertion or out-of-frame deletion results in a truncated protein.In some embodiments, the edits in the NAC7 gene result in a truncated NAC7 polypeptide, optionally a C-terminal truncation of the NAC7 polypeptide, optionally wherein the C-terminal truncation results in a deletion of 1 amino acid residue to about 198 contiguous amino acid residues from the C-terminus of the NAC7 domain-containing transcription factor polypeptide, optionally a deletion of about 140 amino acid residues to about 200 amino acid residues (e.g., about 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175 194, 195, 196, 197, 198, 199, or 200 consecutive amino acid residues, and any range or value therein). In some embodiments, a deletion as described herein may result in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0213] In some embodiments, the editing method may further comprise regenerating a plant from a plant cell comprising an edit in an endogenous NAC7 gene, thereby producing a plant comprising an edit in its endogenous NAC7 gene (optionally in exon 3, exon 4 and / or a non-coding region between exon 3 and exon 4) and having a phenotype of one or more improved yield traits, the one or more improved yield traits comprising increased flower number, increased floral structure size and / or increased ear length compared to a control plant lacking the edit, optionally wherein the regenerated plant may comprise a mutant NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encoding a mutant NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

[0214] In some embodiments, a method for preparing a plant is provided, the method comprising (a) contacting a population of plant cells comprising an endogenous NAC7 gene (e.g., one or more endogenous NAC7 genes) with a nuclease linked to a nucleic acid binding domain (e.g., an editing system) that binds a sequence that (i) has at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73, (ii) comprises a region that has at least 80% identity to any one of SEQ ID NOs:75-98; (iii) encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO:74, and / or encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103, and / or; (b) selecting a plant cell from a population of plant cells in which an endogenous NAC7 gene (e.g., one or more endogenous NAC7 genes) has been mutated, thereby producing a plant cell comprising a mutation in the endogenous NAC7 gene; and (c) growing the selected plant cell into a plant.

[0215] In some embodiments, a method for improving one or more yield traits in a plant is provided, the method comprising (a) contacting a plant cell comprising an endogenous NAC7 gene with a nuclease targeted to the endogenous NAC7 gene, wherein the nuclease is linked to a nucleic acid binding domain (e.g., an editing system) that binds to a target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (i) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (ii) comprises a region having at least 80% identity to any one of SEQ ID NOs:75-98; and / or (iii) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74, and / or (iv) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103. NO:103 having an amino acid sequence with at least 80% sequence identity, to produce a plant cell comprising a mutation in an endogenous NAC7 gene; and (b) growing the plant cell into a plant comprising the mutation in the endogenous NAC7 gene, thereby producing a plant having the mutated endogenous NAC7 gene and exhibiting increased flower number, increased floral structure size and / or increased ear length compared to a control plant lacking the mutation.

[0216] In some embodiments, a method for producing a plant or part thereof comprising at least one cell having a mutation in an endogenous NAC7 gene, the method comprising contacting a target site in an endogenous NAC7 gene in a plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene (a) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% identity to any one of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:103, thereby producing a plant or part thereof comprising at least one cell having a mutation in an endogenous NAC7 gene.

[0217] Also provided herein is a method for producing a plant or part thereof comprising a mutated endogenous NAC7 gene and exhibiting increased flower number, increased floral structure size and / or increased ear length, the method comprising contacting a target site in an endogenous NAC7 gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% identity to any one of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103. The amino acid sequence of NO:103 has a region of at least 80% sequence identity, thereby producing a plant or part thereof comprising an endogenous NAC7 gene with a mutation and exhibiting increased flower number, increased floral structure size and / or increased ear length.

[0218] In some embodiments, the one or more improved yield traits may include, but are not limited to, increased yield (bushels per acre), increased biomass, increased number of flowers, altered flowering time (earlier or later), increased flower size, increased ear length, increased kernel number, increased kernel size, increased number of pods (including increased number of pods per node and / or increased number of pods per plant), increased number of seeds per pod, increased number of seeds, increased seed size and / or increased seed weight (e.g., increased 100-seed weight), optionally wherein the one or more improved yield traits are increased number of flowers, increased flower size and / or increased ear length compared to a control plant lacking at least one mutation.

[0219] In some embodiments, the nuclease can cleave the endogenous NAC7 gene, thereby introducing a mutation into the endogenous NAC7 gene. The nuclease that can be used in the present invention can be any nuclease that can be used to edit / modify the target nucleic acid. Such nucleases include, but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), endonucleases (e.g., Fok1), and / or CRISPR-Cas effector proteins. Similarly, any nucleic acid binding domain that can be used in the present invention can be any DNA binding domain or RNA binding domain that can be used to edit / modify the target nucleic acid. Such nucleic acid binding domains include, but are not limited to, zinc fingers, transcription activator-like DNA binding domains (TALs), argonautes, and / or CRISPR-Cas effector DNA binding domains.

[0220] In some embodiments, the nucleic acid binding domain (e.g., DNA binding domain) is included in the nucleic acid binding polypeptide. As used herein, "nucleic acid binding protein" or "nucleic acid binding polypeptide" refers to a polypeptide that binds and / or can bind to nucleic acids in a site-specific and / or sequence-specific manner. In some embodiments, the nucleic acid binding polypeptide can be a sequence-specific nucleic acid binding polypeptide (e.g., sequence-specific DNA binding domain), such as but not limited to sequence-specific binding polypeptides and / or domains from, for example, polynucleotide-guided endonucleases, CRISPR-Cas effector proteins (e.g., CRISPR-Cas endonucleases), zinc finger nucleases, transcription activator-like effector nucleases (TALENs) and / or Argonaute proteins. In some embodiments, the nucleic acid binding polypeptide includes a cleavage polypeptide (e.g., nuclease polypeptide and / or domain), such as but not limited to endonucleases (e.g., Fok1), polynucleotide-guided endonucleases, CRISPR-Cas endonucleases, zinc finger nucleases and / or transcription activator-like effector nucleases (TALENs). In some embodiments, the nucleic acid binding polypeptide is associated with and / or is capable of associating with (e.g., forming a complex with) one or more nucleic acid molecules (e.g., forming a complex with a guide nucleic acid as described herein), and the one or more nucleic acid molecules can guide or direct the nucleic acid binding polypeptide to a specific target nucleotide sequence (e.g., a genomic locus) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof), so that the nucleic acid binding polypeptide binds to the nucleotide sequence at the specific target site. In some embodiments, the nucleic acid binding polypeptide is a CRISPR-Cas effector protein as described herein. In some embodiments, for simplicity, CRISPR-Cas effector proteins are specifically mentioned, but nucleic acid binding polypeptides as described herein may also be used. In some embodiments, the polynucleotides and / or nucleic acid constructs of the present invention may be "expression cassettes" or may be contained in expression cassettes.

[0221] In some embodiments, a method of editing endogenous NAC7 in a plant or a plant part is provided, the method comprising contacting a target site in an endogenous NAC7 gene in the plant or a plant part with a cytosine base editing system, the cytosine base editing system comprising a cytosine deaminase and a nucleic acid binding domain that binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:103, thereby editing the endogenous NAC7 gene in the plant or a part thereof, and producing a plant or a part thereof comprising at least one cell having a mutation in the endogenous NAC7 gene.

[0222] In some embodiments, a method of editing endogenous NAC7 in a plant or a plant part is provided, the method comprising contacting a target site in a NAC7 gene in the plant or a plant part with an adenosine base editing system, the adenosine base editing system comprising an adenosine deaminase and a nucleic acid binding domain that binds to the target site in the NAC7 gene, wherein the NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:103, thereby editing the endogenous NAC7 gene in the plant or a part thereof, and producing a plant or a part thereof comprising at least one cell having a mutation in the endogenous NAC7 gene.

[0223] The mutation provided by the method of the present invention can be a non-natural mutation. In some embodiments, the mutation can be a displacement, insertion and / or deletion, and optionally wherein the insertion or deletion is an out-of-frame insertion or out-of-frame deletion. In some embodiments, the mutation can include a base substitution to A, T, G or C. In some embodiments, the mutation can be a deletion (for example, out-of-frame deletion) of about 1 base pair to about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 or more continuous base pairs, and optionally, the deletion can be 1 to about 50 continuous base pairs, 1 to about 30 continuous base pairs, 1 to about 15 continuous base pairs. In some embodiments, the mutation can be an insertion (e.g., an out-of-frame deletion) of at least one base pair (e.g., 1 base pair to about 16 base pairs; e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive base pairs, optionally 1, 2, 4, 5, 7, 8, 10, 11, 13, or 14 consecutive base pairs). The mutation in the NAC7 gene can be located in exon 3, exon 4, and / or in the non-coding region between exon 3 and exon 4 (e.g., adjacent to exon 3 and / or exon 4), optionally in the endogenous NAC7 gene region at about nucleotide 5094 to about nucleotide 5607 with reference to nucleotide position numbering of SEQ ID NO: 72, optionally wherein the mutation can result in a C-terminal truncation of a polypeptide produced by the mutated NAC7 gene. As used herein, "in or adjacent to an exon" refers to within 1 to about 50 consecutive nucleotides of the 5' or 3' end of an exon (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive nucleotides of the 5' or 3' end of an exon). In some embodiments, an out-of-frame deletion or out-of-frame insertion mutation of the NAC7 gene results in a truncated polypeptide. In some embodiments, an out-of-frame deletion or out-of-frame insertion can be a dominant recessive mutation. In some embodiments, the out-of-frame deletion or out-of-frame insertion may be located in or adjacent to exon 3 and / or exon 4 of the NAC7 gene, which may result in a premature stop codon (e.g., an out-of-frame base insertion or an out-of-frame base deletion) and a truncated NAC7 domain-containing transcription factor polypeptide.

[0224] In some embodiments, the present invention provides a method for producing a plant comprising a mutation in an endogenous NAC7 and at least one polynucleotide of interest, the method comprising crossing a plant of the present invention (a first plant) comprising at least one mutation in an endogenous NAC7 gene with a second plant comprising at least one polynucleotide of interest to produce progeny plants; and selecting progeny plants comprising at least one mutation in the NAC7 gene and at least one polynucleotide of interest, thereby producing a plant comprising a mutation in the endogenous NAC7 gene and at least one polynucleotide of interest.

[0225] The present invention also provides a method of producing a plant comprising a mutation in an endogenous NAC7 and at least one polynucleotide of interest, the method comprising introducing at least one polynucleotide of interest into a plant of the present invention comprising at least one mutation in a NAC7 gene, thereby producing a plant comprising at least one mutation in a NAC7 gene and at least one polynucleotide of interest. In some embodiments, the plant is a corn plant.

[0226] In some embodiments, a method of producing a plant comprising a mutation in an endogenous NAC7 and exhibiting a phenotype of improved yield traits, improved plant architecture and / or improved defense traits is also provided, the method comprising crossing a first plant (i.e., a plant of the present invention comprising at least one mutation in the NAC7 gene) with a second plant exhibiting a phenotype of improved yield traits, improved plant architecture and / or improved defense traits; and selecting progeny plants comprising a mutation in the NAC7 gene and having a phenotype of improved yield traits, improved plant architecture and / or improved defense traits, thereby producing a plant comprising a mutation in the endogenous NAC7 gene and exhibiting a phenotype of improved yield traits, improved plant architecture and / or improved defense traits compared to a control plant.

[0227] Also provided is a method for controlling weeds in a container (e.g., a pot or seed tray, etc.), a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, the method comprising applying a herbicide to one or more (a large number of) plants of the present invention (e.g., plants comprising at least one mutation in NAC7 as described herein) growing in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, thereby controlling the weeds in the container, growth chamber, greenhouse, field, recreational area, lawn, or roadside where the one or more plants are growing.

[0228] In some embodiments, a method of reducing insect predation on a plant is provided, the method comprising applying an insecticide to one or more plants of the present invention, optionally wherein the one or more plants are grown in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, thereby reducing insect predation on the one or more plants.

[0229] In some embodiments, a method of reducing fungal diseases on plants is provided, the method comprising applying a fungicide to one or more plants of the present invention, optionally wherein the one or more plants are grown in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, thereby reducing fungal diseases on the one or more plants.

[0230] The polynucleotide of interest may be any polynucleotide that can confer a desired phenotype on a plant or otherwise alter the phenotype or genotype of a plant. In some embodiments, the polynucleotide of interest may be a polynucleotide that confer herbicide tolerance, insect resistance, nematode resistance, disease resistance, increased yield, increased nutrient use efficiency, or abiotic stress resistance.

[0231] Therefore, plants or plant cultivars to be preferentially treated according to the invention include all plants which, by genetic modification, have acquired genetic material which imparts particularly advantageous useful properties ("traits") to these plants. Examples of such properties are better plant growth, vigor, stress tolerance, uprightness, resistance to lodging, nutrient uptake, plant nutrition and / or yield, in particular improved growth, increased tolerance to high or low temperatures, increased tolerance to drought or water or soil salinity levels, enhanced flowering performance, easier harvesting, accelerated maturation, higher yield, higher quality and / or higher nutritional value of the harvested product, better storage life and / or processability of the harvested product.

[0232] A further example of such a property is an increased resistance to animal and microbial pests, such as insects, arachnids, nematodes, mites, slugs and snails, due, for example, to toxins formed in the plant. Among the DNA sequences encoding proteins conferring tolerance properties to such animal and microbial pests, in particular insects, mention will be made in particular of the genetic material encoding the Bt protein from Bacillus thuringiensis, which is widely described in the literature and is well known to the person skilled in the art. Mention will also be made of proteins extracted from bacteria such as Photorhabdus (WO 97 / 17432 and WO 98 / 08932). Specifically, mention will be made of Bt Cry or VIP proteins, which include Cry1A, Cry1Ab, Cry1Ac, CryIIA, CryIIIA, CryIIIB2, Cry9c Cry2Ab, Cry3Bb and CryIF proteins or toxic fragments thereof, and hybrids or combinations thereof, in particular Cry1F protein or hybrids derived from Cry1F protein (e.g., hybrid Cry1A-CrylF protein or toxic fragments thereof), Cry1A-type proteins or toxic fragments thereof, preferably Cry1Ac protein or hybrids derived from Cry1Ac protein (e.g., hybrid Cry1Ab-CrylAc protein) or Cry1Ab or Bt2 protein or toxic fragments thereof, Cry2Ae, Cry2Af or Cry2Ag protein or toxic fragments thereof, Cry1A.105 protein or toxic fragments thereof, VIP3Aa19 protein, VIP3Aa20 protein, VIP3A protein produced in COT202 or COT203 cotton events, as described in Estruch et al. (1996), Proc Natl Acad Sci US A.28; 93 (11): 5389-94 or a toxic fragment thereof, such as the Cry protein described in WO2001 / 47952, an insecticidal protein from a strain of Xenorhabdus (such as described in WO98 / 50427), Serratia (especially from S. entomophila) or Photorhabdus, such as the Tc protein from Photorhabdus described in WO98 / 08932. In addition, any variant or mutant of any of these proteins that differs from any of the above-named sequences in some amino acids (1-10, preferably 1-5) is also included herein, and these sequences are particularly the sequences of their toxic fragments, or are fused to a transit peptide, such as a plastid transit peptide, or another protein or peptide.

[0233] Another particularly emphasized example of such properties is the conferring of tolerance to one or more herbicides, such as imidazolinone, sulfonylurea, glyphosate or glufosinate. Among the DNA sequences (i.e., polynucleotides of interest) encoding proteins that confer the properties of tolerance to certain herbicides on transformed plant cells and plants, particular mention will be made of the bar or PAT gene or the Streptomyces coelicolor gene described in WO2009 / 152359, which confer tolerance to glufosinate herbicides; genes encoding suitable EPSPS (5-enolpyruvylshikimate-3-phosphate-synthetase), which confer tolerance to herbicides targeting EPSPS, in particular herbicides such as glyphosate and its salts; genes encoding glyphosate-n-acetyltransferase, or genes encoding glyphosate oxidoreductase. Additional suitable herbicide tolerance traits include at least one ALS (acetolactate synthase) inhibitor (e.g., WO2007 / 024782); a mutated Arabidopsis ALS / AHAS gene (e.g., U.S. Pat. No. 6,855,533); a gene encoding 2,4-D-monooxygenase, which confers tolerance to 2,4-D (2,4-dichlorophenoxyacetic acid); and a gene encoding dicamba monooxygenase, which confers tolerance to dicamba (3,6-dichloro-2-methoxybenzoic acid).

[0234] Further examples of such traits are increased resistance to phytopathogenic fungi, bacteria and / or viruses due to, for example, systemic acquired resistance (SAR), systemins, phytoalexins, elicitors and resistance genes and correspondingly expressed proteins and toxins.

[0235] Particularly useful transgenic events in transgenic plants or plant cultivars that can be preferentially treated according to the present invention include: event 531 / PV-GHBK04 (cotton, insect control, described in WO2002 / 040677), event 1143-14A (cotton, insect control, not deposited, described in WO2006 / 128569); event 1143-51B (cotton, insect control, not deposited, described in WO2006 / 128570); event 1445 (cotton, herbicide tolerance, not deposited, described in US-A 2002-120964 or WO2002 / 034946); Event 17053 (rice, herbicide tolerance, deposited as PTA-9843, described in WO2010 / 117737); Event 17314 (rice, herbicide tolerance, deposited as PTA-9844, described in WO2010 / 117735); Event 281-24-236 (cotton, insect control-herbicide tolerance, deposited as PTA-6233, described in WO2005 / 103266 or US-A 2005-216969); Event 3006-210-23 (cotton, insect control-herbicide tolerance, deposited as PTA-6233, described in US-A 2007-143876 or WO2005 / 103266); event 3272 (corn, quality traits, deposited as PTA-9972, described in WO2006 / 098952 or US-A2006-230473); event 33391 (wheat, herbicide tolerance, deposited as PTA-2347, described in WO2002 / 027004), event 40416 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-11508, described in WO 11 / 075593); event 43A47 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-11509, described in WO2011 / 075595); event 5307 (corn, insect control, deposited as ATCC PTA-9561, described in WO2010 / 077816); event ASR-368 (benthgrass, herbicide tolerance, deposited as ATCC PTA-4816, described in US-A 2006-162007 or WO2004 / 053062); event B16 (corn, herbicide tolerance, not deposited, described in US-A 2003-126634); event BPS-CV127-9 (soybean, herbicide tolerance, deposited as NCIMB No. 41603, described in WO2010 / 080829); event BLR1 (canola, male sterility restoration, deposited as NCIMB 41193, described in WO2005 / 074671), event CE43-67B (cotton, insect control,Deposited as DSMACC2724, described in US-A 2009-217423 or WO 2006 / 128573); Event CE44-69D (cotton, insect control, not deposited, described in US-A 2010-0024077); Event CE44-69D (cotton, insect control, not deposited, described in WO 2006 / 128571); Event CE46-02A (cotton, insect control, not deposited, described in WO 2006 / 128572); Event COT102 (cotton, insect control, not deposited, described in US-A 2006-130175 or WO 2004 / 039986); Event COT202 (cotton, insect control, not deposited, described in US-A 2007-067868 or WO2005 / 054479); event COT203 (cotton, insect control, not deposited, described in WO2005 / 054480);); event DAS21606-3 / 1606 (soybean, herbicide tolerance, deposited as PTA-11028, described in WO2012 / 033794), event DAS40278 (corn, herbicide tolerance, deposited as ATCC PTA-10244, described in WO2011 / 022469); event DAS-44406-6 / pDAB8264.44.06.1 (soybean, herbicide tolerance, deposited as PTA-11336, described in WO2012 / 075426), event DAS-14536-7 / pDAB8291.45.36.2 (soybean, herbicide tolerance, deposited as PTA-11335, described in WO2012 / 075429), event DAS-59122-7 (corn, insect control - herbicide tolerance, deposited as ATCC PTA11384, described in US-A2006-070139); event DAS-59132 (corn, insect control-herbicide tolerance, not deposited, described in WO2009 / 100188); event DAS68416 (soybean, herbicide tolerance, deposited as ATCC PTA-10442, described in WO2011 / 066384 or WO2011 / 066360); event DP-098140-6 (corn, herbicide tolerance, deposited as ATCC PTA-8296, described in US-A2009-137395 or WO 08 / 112019); event DP-305423-1 (soybean, quality traits, not deposited, described in US-A 2008-312082 or WO2008 / 054747); event DP-32138-1 (maize, hybrid system, deposited as ATCC PTA-9158,described in US-A 2009-0210970 or WO2009 / 103049); event DP-356043-5 (soybean, herbicide tolerance, deposited as ATCC PTA-8287, described in US-A 2010-0184079 or WO2008 / 002872); event EE-I (eggplant, insect control, not deposited, described in WO 07 / 091277); event Fil 17 (corn, herbicide tolerance, deposited as ATCC 209031, described in US-A 2006-059581 or WO 98 / 044140); event FG72 (soybean, herbicide tolerant, deposited as PTA-11041, described in WO2011 / 063413), event GA21 (corn, herbicide tolerant, deposited as ATCC 209033, described in US-A 2005-086719 or WO 98 / 044140); event GG25 (corn, herbicide tolerant, deposited as ATCC 209032, described in US-A 2005-188434 or WO98 / 044140); event GHB119 (cotton, insect control-herbicide tolerant, deposited as ATCC PTA-8398, described in WO2008 / 151780); event GHB614 (cotton, herbicide tolerant, deposited as ATCC PTA-6878, described in US-A 2010-050282 or WO 2007 / 017186); event GJ11 (maize, herbicide tolerance, deposited as ATCC 209030, described in US-A 2005-188434 or WO 98 / 044140); event GM RZ13 (sugar beet, virus resistance, deposited as NCIMB-41601, described in WO 2010 / 076212); event H7-1 (sugar beet, herbicide tolerance, deposited as NCIMB 41158 or NCIMB 41159, described in US-A 2004-172669 or WO 2004 / 074492); event JOPLIN1 (wheat, disease resistance, not deposited, described in US-A 2008-064032); event LL27 (soybean, herbicide tolerant, deposited as NCIMB 41658, described in WO 2006 / 108674 or US-A 2008-320616); event LL55 (soybean, herbicide tolerant, deposited as NCIMB 41660, described in WO 2006 / 108675 or US-A 2008-196127); event LLcotton25 (cotton, herbicide tolerant, deposited as ATCC PTA-3343,described in WO2003 / 013224 or US-A 2003-097687); event LLRICE06 (rice, herbicide tolerance, deposited as ATCC 203353, described in US 6,468,747 or WO2000 / 026345); event LLRICE62 (rice, herbicide tolerance, deposited as ATCC 203352, described in WO2000 / 026345), event LLRICE601 (rice, herbicide tolerance, deposited as ATCC PTA-2600, described in US-A 2008-2289060 or WO2000 / 026356); event LY038 (maize, quality traits, deposited as ATCC PTA-5623, described in US-A 2007-028322 or WO2005 / 061720); event MIR162 (corn, insect control, deposited as PTA-8166, described in US-A 2009-300784 or WO2007 / 142840); event MIR604 (corn, insect control, not deposited, described in US-A 2008-167456 or WO2005 / 103301); event MON15985 (cotton, insect control, deposited as ATCC PTA-2516, described in US-A 2004-250317 or WO2002 / 100163); event MON810 (corn, insect control, not deposited, described in US-A 2002-102582); event MON863 (corn, insect control, deposited as ATCC PTA-2605, described in WO2004 / 011601 or US-A 2006-095986); event MON87427 (corn, pollination control, deposited as ATCC PTA-7899, described in WO2011 / 062904); event MON87460 (corn, stress tolerance, deposited as ATCC PTA-8910, described in WO2009 / 111263 or US-A 2011-0138504); event MON87701 (soybean, insect control, deposited as ATCC PTA-8194, described in US-A 2009-130071 or WO2009 / 064652); event MON87705 (soybean, quality trait - herbicide tolerance, deposited as ATCC PTA-9241, described in US-A 2010-0080887 or WO2010 / 037016); event MON87708 (soybean, herbicide tolerance, deposited as ATCC PTA-9670, described in WO2011 / 034704); event MON87712 (soybean, yield, deposited as PTA-10296, described in WO2012 / 051199),Event MON87754 (soybean, quality traits, deposited as ATCC PTA-9385, described in WO2010 / 024976); Event MON87769 (soybean, quality traits, deposited as ATCC PTA-8911, described in US-A 2011-0067141 or WO2009 / 102873); Event MON88017 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-5582, described in US-A 2008-028482 or WO2005 / 059103); Event MON88913 (cotton, herbicide tolerance, deposited as ATCC PTA-4854, described in WO2004 / 072235 or US-A 2006-059590); event MON88302 (canola, herbicide tolerant, deposited as PTA-10955, described in WO2011 / 153186), event MON88701 (cotton, herbicide tolerant, deposited as PTA-11754, described in WO2012 / 134808), event MON89034 (maize, insect control, deposited as ATCC PTA-7455, described in WO 07 / 140256 or US-A 2008-260932); event MON89788 (soybean, herbicide tolerant, deposited as ATCC PTA-6708, described in US-A 2006-282915 or WO2006 / 130436); event MS11 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-850 or PTA-2485, described in WO2001 / 031042); event MS8 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-730, described in WO2001 / 041558 or US-A 2003-188347); event NK603 (maize, herbicide tolerance, deposited as ATCC PTA-2478, described in US-A 2007-292854); event PE-7 (rice, insect control, not deposited, described in WO2008 / 114282); event RF3 (canola, pollination control-herbicide tolerance, deposited as ATCC PTA-730, described in WO2001 / 041558 or US-A2003-188347); event RT73 (rapeseed, herbicide tolerant, not deposited, described in WO2002 / 036831 or US-A2008-070260); event SYHT0H2 / SYN-000H2-5 (soybean, herbicide tolerant, deposited as PTA-11226, described in WO2012 / 082548), event T227-1 (sugar beet, herbicide tolerant, not deposited,described in WO2002 / 44407 or US-A 2009-265817); Event T25 (corn, herbicide tolerance, not deposited, described in US-A 2001-029014 or WO2001 / 051654); Event T304-40 (cotton, insect control-herbicide tolerance, deposited as ATCC PTA-8171, described in US-A 2010-077501 or WO2008 / 122406); Event T342-142 (cotton, insect control, not deposited, described in WO2006 / 128568); Event TC1507 (corn, insect control-herbicide tolerance, not deposited, described in US-A 2005-039226 or WO2004 / 099447); event VIP1034 (corn, insect control-herbicide tolerance, deposited as ATCC PTA-3925, described in WO2003 / 052073), event 32316 (corn, insect control-herbicide tolerance, deposited as PTA-11507, described in WO2011 / 084632), event 4114 (corn, insect control-herbicide tolerance, deposited as PTA-11506, described in WO2011 / 084621), event EE-GM3 / FG72 (soybean, herbicide tolerance, ATCC accession number PTA -11041), optionally stacked with event EE-GM1 / LL27 or event EE-GM2 / LL55 (WO2011 / 063413A2), event DAS-68416-4 (soybean, herbicide tolerant, ATCC Accession No. PTA-10442, WO2011 / 066360A1), event DAS-68416-4 (soybean, herbicide tolerant, ATCC Accession No. PTA-10442, WO2011 / 066384A 1), event DP-040416-8 (corn, insect control, ATCC accession number PTA-11508, WO2011 / 075593A1), event DP-043A47-3 (corn, insect control, ATCC accession number PTA-11509, WO2011 / 075595A1), event DP-004114-3 (corn, insect control, ATCC accession number PTA-11506, WO2011 / 084621A1), Event DP-032316-8 (corn, insect control, ATCC Accession No. PTA-11507, WO2011 / 084632A1), Event MON-88302-9 (canola, herbicide tolerance, ATCC Accession No. PTA-10955, WO2011 / 153186A1), Event DAS-21606-3 (soybean, herbicide tolerance, ATCC Accession No. PTA-11028, WO2012 / 033794A2),Event MON-87712-4 (soybean, quality traits, ATCC accession number PTA-10296, WO2012 / 051199A2), event DAS-44406-6 (soybean, stacked herbicide tolerance, ATCC accession number PTA-11336, WO2012 / 075426A1), event DAS-14536-7 (soybean, stacked herbicide tolerance, ATCC accession number PTA-11335, WO2012 / 075429 A1), event SYN-000H2-5 (soybean, herbicide tolerance, ATCC accession number PTA-11226, WO2012 / 082548A2), event DP-061061-7 (canola, herbicide tolerance, no deposit number available, WO2012071039A1), event DP-073496-4 (canola, herbicide tolerance, no deposit number available, US2012131692), event 8264.44.06.1 (soybean, added herbicide tolerance, accession number PTA-11336, WO2012075426A2), event 8291.45.36.2 (soybean, superimposed herbicide tolerance, accession number PTA-11335, WO2012075429A2), event SYHT0H2 (soybean, ATCC accession number PTA-11226, WO2012 / 082548A2), event MON88701 (cotton, ATCC accession number PTA-11754, WO 2012 / 134808A1), event KK179-2 (alfalfa, ATCC accession number PTA-11833, WO2013 / 003558A1), event pDAB8264.42.32.1 (soybean, superimposed with herbicide tolerance, ATCC accession number PTA-11993, WO2013 / 010094A1), event MZDT09Y (corn, ATCC accession number PTA-13025, WO2013 / 012775A1). ,

[0236] The genes / events that confer the desired traits in question (e.g., polynucleotides of interest) may also be present in combination with one another in transgenic plants. Examples of transgenic plants that may be mentioned are important crop plants such as cereals (wheat, rice, triticale, barley, rye, oats), corn, soybeans, potatoes, sugar beets, sugar cane, tomatoes, peas and other types of vegetables, cotton, tobacco, rapeseed and fruit plants (fruits are apples, pears, citrus fruits and grapes), with particular emphasis on corn, soybeans, wheat, rice, potatoes, cotton, sugar cane, tobacco and rapeseed. Traits that are particularly emphasized are the increased resistance of the plants to insects, arachnids, nematodes, slugs and snails, and the increased resistance of the plants to one or more herbicides.

[0237] Commercially available examples of such plants, plant parts or plant seeds that may be preferentially treated according to the invention include commercial products such as RIB ROUNDUP VT DOUBLE VT TRIPLE BOLLGARD ROUNDUP READY 2 ROUNDUP 2XTENDTM、INTACTA RR2 VISTIVE and / or XTENDFLEX TM Plant seeds sold or distributed under a trade name.

[0238] NAC7 genes useful in the present invention include any NAC7 gene, wherein a mutation as described herein can confer an improvement in plant architecture and / or one or more yield traits, such as increased flower number, increased flower structure size, and / or increased panicle length, in a plant or part thereof comprising the mutation. In some embodiments, the endogenous NAC7 gene (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to a nucleotide sequence of any one of SEQ ID NOs:75-98; (c) encodes a NAC7 domain-containing transcription factor polypeptide having at least 80% sequence identity to an amino acid sequence of SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO:102 or SEQ ID NO:103.

[0239] In some embodiments, the mutation in the endogenous NAC7 gene in the plant can be a base substitution, a base deletion and / or a base insertion, optionally a non-natural mutation. In some embodiments, at least one mutation in the endogenous NAC7 gene in the plant can result in a phenotype of increased flower number, increased flower structure size and / or increased panicle length in the plant compared to a control plant lacking the edit / mutation.

[0240] In some embodiments, the mutation in the endogenous NAC7 gene can be a base substitution, base deletion, and / or base insertion of at least 1 base pair. In some embodiments, the base deletion can be from 1 nucleotide to about 150 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 、101、102、103、104、105、106、107、108、109、110、111、112、113、114、115、116、117、118、119、120、121、122、123、124、125、126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、 142, 143, 144, 145, 146, 147, 148, 149 or 150 or more base pairs, or any range or value therein, e.g., 1 to about 50 base pairs, 1 to about 30 base pairs, 1 to about 15 base pairs, or any range or value therein), optionally wherein the mutation is located at about 2 to about 100 consecutive nucleotides (e.g., 1 to about 50 consecutive base pairs, 1 to about 30 consecutive base pairs, 1 to about 15 consecutive base pairs)). In some embodiments, the mutation in the endogenous NAC7 gene can be a base insertion of 1 to about 30 nucleotides, optionally 1-16 consecutive nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, optionally consecutive nucleotides) of the NAC7 gene. In some embodiments, the mutation in the endogenous NAC7 gene can be an out-of-frame insertion or out-of-frame deletion resulting in a truncated NAC7 protein (e.g., a truncated NAC7 domain-containing transcription factor polypeptide). In some embodiments, at least one mutation can be a base substitution, optionally a substitution of A, T, G or C. Mutations useful in the present invention can be point mutations.

[0241] In some embodiments, mutations in the endogenous NAC7 gene can be generated following cleavage by an editing system comprising a nuclease and a nucleic acid binding domain that binds to a target site within a target nucleic acid comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO: 72 or SEQ ID NO: 73, and / or encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74, optionally wherein the target site is located in a region of the NAC7 gene comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 75-98, and / or encoding a sequence having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO: 103. In some embodiments, the mutation may result in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115, or 118.

[0242] Also provided is a guide nucleic acid (e.g., gRNA, gDNA, crRNA, crDNA) that binds to a target site in NAC7, wherein the target site is located within a NAC7 gene region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-98, or within a NAC7 gene region encoding a sequence having at least 80% sequence identity to SEQ ID NOs: 102 or 103. In some embodiments, the guide nucleic acid comprises a spacer region comprising any one of the nucleotide sequences of SEQ ID NOs: 99-101, or a reverse complement thereof.

[0243] In some embodiments, a corn plant or plant part thereof is provided, comprising at least one mutation in at least one endogenous NAC7 gene having a gene identification number (Gene ID) of GRMZM2G114850, optionally wherein the mutation is a non-natural mutation.

[0244] In some embodiments, a guide nucleic acid is provided that binds to a target nucleic acid in the NAC7 gene having a gene identification number (gene ID) of GRMZM2G114850.

[0245] In some embodiments, a system comprising a guide nucleic acid and a CRISPR-Cas effector protein associated with the guide nucleic acid is provided, the guide nucleic acid comprising a spacer (e.g., one or more spacers) having a nucleotide sequence of any one of SEQ ID NOs: 99-101 (or its reverse complement). In some embodiments, the system may also comprise a tracr nucleic acid associated with the guide nucleic acid and the CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

[0246] As used herein, “CRISPR-Cas effector protein associated with a guide nucleic acid” refers to a complex formed between the CRISPR-Cas effector protein and the guide nucleic acid to direct the CRISPR-Cas effector protein to a target site in a gene.

[0247] The present invention also provides a gene editing system, comprising a CRISPR-Cas effector protein associated with a guide nucleic acid, and the guide nucleic acid comprises a spacer sequence that binds to the NAC7 gene, optionally wherein NAC7 (a) comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprises a region having at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NO: 75-98; (c) encodes a polypeptide having at least 80% sequence identity with SEQ ID NO: 74; and / or (d) encodes a region having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103. In some embodiments, the spacer sequence of the guide nucleic acid may comprise a nucleotide sequence of any one of SEQ ID NO: 99-101, or a reverse complement thereof. In some embodiments, the gene editing system may further comprise a tracr nucleic acid associated with the guide nucleic acid and the CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

[0248] The present invention also provides a complex comprising a CRISPR-Cas effector protein containing a cleavage domain and a guide nucleic acid, wherein the guide nucleic acid binds to a target site in an endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprises a region having at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NOs: 75-98; (c) encodes a polypeptide having at least 80% sequence identity with SEQ ID NO: 74; and / or (d) encodes a region having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, and the cleavage domain cleaves the target chain in the NAC7 gene.

[0249] In some embodiments, an expression cassette is provided, comprising (a) a polynucleotide encoding a CRISPR-Cas effector protein comprising a cleavage domain and (b) a guide nucleic acid that binds to a target site in an endogenous NAC7 gene, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to: (i) a portion of a nucleic acid having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73; (ii) a portion of a nucleic acid having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; (iii) a portion of a nucleic acid encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74; and / or (iv) a portion of a nucleic acid encoding a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103.

[0250] Also provided are nucleic acids encoding mutant NAC7 domain-containing transcription factor polypeptides, optionally wherein when present in a plant or plant part, the mutant NAC7 polypeptide / mutated NAC7 gene causes the plant to exhibit a phenotype of increased flower number, increased floral structure size and / or increased ear length compared to a plant or plant part lacking the mutation.

[0251] The nucleic acid constructs of the present invention (e.g., constructs comprising a sequence-specific nucleic acid binding domain (e.g., a sequence-specific DNA binding domain), a CRISPR-Cas effector domain, a deaminase domain, a reverse transcriptase (RT), an RT template and / or a guide nucleic acid, etc.) and expression cassettes / vectors comprising the same can be used as the editing system of the present invention for modifying target nucleic acids (e.g., endogenous NAC7 genes) and / or their expression.

[0252] Any plant comprising an endogenous NAC7 gene (which, when modified as described herein, is capable of conferring at least one improved yield trait and / or improved plant architecture, such as increased flower number, increased floral structure size and / or increased ear length) can be modified (e.g., mutated, e.g., base edited, cleaved, nicked, etc.) as described herein (e.g., using the polypeptides, polynucleotides, RNPs, nucleic acid constructs, expression cassettes and / or vectors of the invention) to improve one or more yield traits in the plant. Plants exhibiting improved yield traits can show an improvement in yield traits of about 5% to about 100% (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 100%, , 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 9 ...4%, 96%, 97%, 99%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 90%, 91%, 92%, 93%, 94%, 96%, 97%, 99%, 90%, 91%, 92%, 93%, 95%, 96%, 97%, 99%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 90%, 91%, 92%, 93%, 1%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or more, or any range or value therein; for example, about 1% to about 50%, about 5% to about 10%, about 5% to about 15%, about 5% to about 20%, about 5% to about 25%, about 5% to about 30%, about 5% to about 35%, about 5% to about 40%, about 5% to about 50%, about 5% to about 60%, about 5% to about 60%, about 5% to about 70%, about 5% to about 70%, about 5% to about 80%, about 5% to about 80%, about 5% to about 90%, about 5% to about 10 ... to about 20%, about 10% to about 50%, about 10% to about 80%, about 10% to about 90%, about 10% to about 100%, about 20% to about 50%, about 20% to about 80%, about 20% to about 90%, about 20% to about 100%, about 30% to about 50%, about 30% to about 80%, about 30% to about 90%, about 30% to about 100%, about 50% to about 100%, about 75% to about 100%, or more, and any range or value therein).

[0253] The editing system that can be used for the present invention can be any site-specific (sequence-specific) genome editing system that is now known or developed later, which can introduce mutations in a target-specific manner. For example, the editing system (e.g., a site-specific or sequence-specific editing system) may include, but is not limited to, a CRISPR-Cas editing system, a meganuclease editing system, a zinc finger nuclease (ZFN) editing system, a transcription activator-like effector nuclease (TALEN) editing system, a base editing system, and / or a lead editing system, each of which may include one or more polypeptides and / or one or more polynucleotides that can modify (mutate) a target nucleic acid in a sequence-specific manner when expressed as a system in a cell. In some embodiments, the editing system (e.g., a site-specific or sequence-specific editing system) may include one or more polynucleotides and / or one or more polypeptides, including but not limited to a nucleic acid binding domain (DNA binding domain), a nuclease, and / or other polypeptides and / or polynucleotides.

[0254] In some embodiments, the editing system may include one or more sequence-specific nucleic acid binding domains (DNA binding domains), which may be derived from, for example, polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and / or Argonaute proteins. In some embodiments, the editing system may include one or more cleavage domains (e.g., nucleases), including but not limited to endonucleases (e.g., Fok1), polynucleotide-guided endonucleases, CRISPR-Cas endonucleases (e.g., CRISPR-Cas effector proteins), zinc finger nucleases, and / or transcription activator-like effector nucleases (TALENs). In some embodiments, the editing system may include one or more polypeptides, including but not limited to deaminases (e.g., cytosine deaminases, adenine deaminases), reverse transcriptases, Dna2 polypeptides, and / or 5' flap endonucleases (FENs). In some embodiments, the editing system may comprise one or more polynucleotides, including but not limited to a CRISPR array (CRISPR guide sequence) nucleic acid, an extended guide nucleic acid, and / or a reverse transcriptase template.

[0255] In some embodiments, methods of modifying or editing a NAC7 gene may include contacting a target nucleic acid (e.g., a nucleic acid encoding a transcription factor polypeptide containing a NAC7 domain) with a base editing fusion protein (e.g., a sequence-specific DNA binding protein (e.g., a CRISPR-Cas effector protein or domain)) fused to a deaminase domain (e.g., an adenine deaminase and / or a cytosine deaminase) and a guide nucleic acid, wherein the guide nucleic acid is capable of guiding / targeting the base editing fusion protein to the target nucleic acid, thereby editing a locus within the target nucleic acid. In some embodiments, the base editing fusion protein and the guide nucleic acid may be contained in one or more expression cassettes. In some embodiments, the target nucleic acid may be contacted with a base editing fusion protein and an expression cassette containing a guide nucleic acid. In some embodiments, the sequence-specific nucleic acid binding fusion protein and the guide sequence may be provided as a ribonucleoprotein (RNP). In some embodiments, a cell may be contacted with more than one base editing fusion protein and / or one or more guide nucleic acids, which may target one or more target nucleic acids in the cell.

[0256] In some embodiments, a method of modifying or editing a NAC7 gene may include contacting a target nucleic acid (e.g., a nucleic acid encoding a transcription factor polypeptide containing a NAC7 domain) with a sequence-specific nucleic acid binding fusion protein (e.g., a sequence-specific DNA binding protein (e.g., a CRISPR-Cas effector protein or domain) fused to a peptide tag, a deaminase fusion protein comprising a deaminase domain (e.g., adenine deaminase and / or cytosine deaminase) fused to an affinity polypeptide capable of binding to the peptide tag, and a guide nucleic acid, wherein the guide nucleic acid is capable of guiding / targeting the sequence-specific nucleic acid binding fusion protein to the target nucleic acid, and the sequence-specific nucleic acid binding fusion protein is capable of directing the deaminase fusion protein to the target nucleic acid through a peptide tag-affinity polypeptide interaction. In some embodiments, the sequence-specific nucleic acid binding fusion protein can be fused to an affinity polypeptide that binds a peptide tag, and the deaminase can be fused to the peptide tag, thereby recruiting the deaminase to the sequence-specific nucleic acid binding fusion protein and the target nucleic acid. In some embodiments, the sequence-specific binding fusion protein, the deaminase fusion protein, and the guide nucleic acid can be included in one or more expression cassettes. In some embodiments, the target nucleic acid can be contacted with the sequence-specific binding fusion protein, the deaminase fusion protein, and the expression cassette containing the guide nucleic acid. In some embodiments, the sequence-specific nucleic acid binding fusion protein, the deaminase fusion protein, and the guide sequence can be provided as a ribonucleoprotein (RNP).

[0257] In some embodiments, methods such as lead editing can be used to generate mutations in the endogenous NAC7 gene. In lead editing, RNA-dependent DNA polymerase (reverse transcriptase, RT) and reverse transcriptase template (RT template) are used in combination with sequence-specific nucleic acid binding domains, which confer the ability to recognize and bind to targets in a sequence-specific manner, and can also cause incisions containing PAM chains in the target. The nucleic acid binding domain can be a CRISPR-Cas effector protein, and in this case, the CRISPR array or guide RNA can be an extended guide sequence comprising an extension portion, which comprises a primer binding site (PSB) and an editor to be incorporated into the genome (template). Similar to base editing, lead editing can utilize various methods to recruit proteins for target site editing, including non-covalent and covalent interactions between proteins and nucleic acids used in the selected process of genome editing.

[0258] As used herein, a "CRISPR-Cas effector protein" is a protein or polypeptide or a domain thereof that cleaves or cuts a nucleic acid, binds a nucleic acid (e.g., a target nucleic acid and / or a guide nucleic acid), and / or identifies, recognizes, or binds a guide nucleic acid as defined herein. In some embodiments, a CRISPR-Cas effector protein may be an enzyme (e.g., a nuclease, an endonuclease, a nickase, etc.) or a portion thereof and / or may act as an enzyme. In some embodiments, a CRISPR-Cas effector protein refers to a CRISPR-Cas nuclease polypeptide or a domain thereof that comprises nuclease activity or wherein the nuclease activity has been reduced or eliminated, and / or comprises nickase activity or wherein the nickase activity has been reduced or eliminated, and / or comprises single-stranded DNA cleavage activity (ss DNA enzyme activity) or wherein the ss DNA enzyme activity has been reduced or eliminated, and / or comprises self-processing RNA enzyme activity or wherein the self-processing RNA enzyme activity has been reduced or eliminated. A CRISPR-Cas effector protein may bind to a target nucleic acid.

[0259] In some embodiments, the sequence-specific nucleic acid binding domain may be a CRISPR-Cas effector protein. In some embodiments, the CRISPR-Cas effector protein may be from a type I CRISPR-Cas system, a type II CRISPR-Cas system, a type III CRISPR-Cas system, a type IV CRISPR-Cas system, a type V CRISPR-Cas system, or a type VI CRISPR-Cas system. In some embodiments, the CRISPR-Cas effector protein of the present invention may be from a type II CRISPR-Cas system or a type V CRISPR-Cas system. In some embodiments, the CRISPR-Cas effector protein may be a type II CRISPR-Cas effector protein, such as a Cas9 effector protein. In some embodiments, the CRISPR-Cas effector protein may be a type V CRISPR-Cas effector protein, such as a Cas12 effector protein.

[0260] In some embodiments, the CRISPR-Cas effector protein may include, but is not limited to, Cas9, C2c1, C2c3, Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4 (dinG) and / or Csf5 nuclease, optionally wherein the CRISPR-Cas effector protein can be a Cas9, Cas12a (Cpf1), Cas12b, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12g, Cas12h, Cas12i, C2c4, C2c5, C2c8, C2c9, C2c10, Cas14a, Cas14b and / or Cas14c effector protein.

[0261] In some embodiments, the CRISPR-Cas effector protein useful in the present invention may comprise a mutation in its nuclease active site (e.g., RuvC, HNH, e.g., a RuvC site of a Cas12a nuclease domain; e.g., a RuvC site and / or an HNH site of a Cas9 nuclease domain). The CRISPR-Cas effector protein has a mutation in its nuclease active site and therefore no longer comprises nuclease activity, and is often referred to as "dead", e.g., dCas. In some embodiments, a CRISPR-Cas effector protein domain or polypeptide having a mutation in its nuclease active site may have impaired activity or reduced activity compared to the same CRISPR-Cas effector protein (e.g., a nickase, e.g., a Cas9 nickase, a Cas12a nickase) without the mutation.

[0262] CRISPR Cas9 effector proteins or CRISPR Cas9 effector domains useful in the present invention can be any known or later identified Cas9 nuclease. In some embodiments, the CRISPR Cas9 polypeptide can be a Cas9 polypeptide from, for example, Streptococcus spp. (e.g., S. pyogenes, S. thermophilus), Lactobacillus spp., Bifidobacterium spp., Kandleria spp., Leuconostoc spp., Oenococcus spp., Pediococcus spp., Weissella spp., and / or Olsenella spp. Example Cas9 sequences include, but are not limited to, the amino acid sequences of SEQ ID NO:59 and SEQ ID NO:60 or the nucleotide sequences of SEQ ID NO:61-71.

[0263] In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus pyogenes and recognizes the PAM sequence motifs NGG, NAG, NGA (Mali et al., Science 2013; 339(6121): 823-826). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus thermophiles and recognizes the PAM sequence motifs NGGNG and / or NNAGAAW (W=A or T) (see, e.g., Horvath et al., Science, 2010; 327(5962): 167-170, and Deveau et al., J Bacteriol 2008; 190(4): 1390-1400). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus mutans and recognizes the PAM sequence motifs NGG and / or NAAR (R=A or G) (see, e.g., Deveau et al., J BACTERIOL 2008; 190(4): 1390-1400). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus and recognizes the PAM sequence motifs NNGRR (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus and recognizes the PAM sequence motifs N GRRT (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Streptococcus aureus that recognizes the PAM sequence motifs N GRRV (R=A or G). In some embodiments, the CRISPR-Cas effector protein can be a Cas9 polypeptide derived from Neisseria meningitidis, and recognizes the PAM sequence motif NGATT or NGCTT (R = A or G, V = A, G or C) (see, e.g., Hou et al., PNAS 2013, 1-6). In the above embodiments, N can be any nucleotide residue, such as any one of A, G, C or T. In some embodiments, the CRISPR-Cas effector protein can be a Cas13a protein derived from Leptotrichia shahii, which recognizes a single 3'A, U or C protospacer flanking sequence (PFS) (or RNA PAM (rPAM)) sequence motif that can be located in the target nucleic acid.

[0264] In some embodiments, the CRISPR-Cas effector protein may be derived from Cas12a, which is a V-type regularly interspaced clustered short palindromic repeats (CRISPR)-Cas nuclease (see, e.g., SEQ ID NO: 1-20). Cas12a differs from the more well-known type II CRISPR Cas9 nuclease in several aspects. For example, Cas9 recognizes a G-rich protospacer adjacent motif (PAM) (3'-NGG) located 3' of its guide RNA (gRNA, sgRNA, crRNA, crDNA, CRISPR array) binding site (protospacer, target nucleic acid, target DNA), while Cas12a recognizes a T-rich PAM (5'-TTN, 5'-TTTN) located 5' of the target nucleic acid. In fact, the orientation of Cas9 and Cas12a binding to their guide RNAs is almost opposite relative to their N and C termini. In addition, the Cas12a enzyme uses a single guide RNA (gRNA, CRISPR array, crRNA), rather than the dual guide RNA (sgRNA (e.g., crRNA and tracrRNA)) found in the natural Cas9 system, and Cas12a processes its own gRNA. In addition, the Cas12a nuclease activity produces staggered DNA double-strand breaks, rather than the flat ends produced by the Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave two DNA chains, while Cas9 utilizes the HNH domain and the RuvC domain to cleave.

[0265] CRISPR Cas12a effector proteins / domains useful in the present invention may be any known or later identified Cas12a polypeptide (formerly known as Cpf1) (see, e.g., U.S. Pat. No. 9,790,490, which is incorporated by reference for its disclosure of Cpf1 (Cas12a) sequences). The term "Cas12a", "Cas12a polypeptide" or "Cas12a domain" refers to an RNA-guided nuclease comprising a Cas12a polypeptide or a fragment thereof, the fragment comprising a guide nucleic acid binding domain of Cas12a and / or an active, inactive or partially active DNA cleavage domain of Cas12a. In some embodiments, Cas12a useful in the present invention may comprise a mutation in a nuclease active site (e.g., a RuvC site of a Cas12a domain). A Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site and thus no longer comprising nuclease activity is generally referred to as a dead Cas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site may have impaired activity, for example, may have nickase activity.

[0266] Any deaminase domain / polypeptide that can be used for base editing can be used in the present invention. In some embodiments, the deaminase domain can be a cytosine deaminase domain or an adenine deaminase domain. The cytosine deaminase (or cytidine deaminase) that can be used in the present invention can be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Patent No. 10,167,457 and Thuronyi et al., Nat. Biotechnol. 37: 1070–1079 (2019), each of which is incorporated herein by reference for its disclosure of cytosine deaminase). Cytosine deaminase can catalyze the hydrolysis and deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. Therefore, in some embodiments, the deaminase or deaminase domain that can be used in the present invention can be a cytidine deaminase domain that catalyzes the hydrolysis and deamination of cytosine to uracil. In some embodiments, the cytosine deaminase can be a variant of a naturally occurring cytosine deaminase, including but not limited to primates (e.g., humans, monkeys, chimpanzees, gorillas), dogs, cows, rats, or mice. Thus, in some embodiments, the cytosine deaminase useful in the present invention can be about 70% to about 100% identical to a wild-type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a naturally occurring cytosine deaminase, and any range or value therein).

[0267] In some embodiments, the cytosine deaminase that can be used in the present invention can be an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation-induced deaminase (hAID), rAPOBEC1, FERNY and / or CDA1, optionally pmCDA1, atCDA1 (e.g., At2g19570), and their evolutionary forms (e.g., SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29). In some embodiments, the cytosine deaminase can be an APOBEC1 deaminase having an amino acid sequence of SEQ ID NO: 23. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO: 24. In some embodiments, the cytosine deaminase may be a CDA1 deaminase, optionally a CDA1 having the amino acid sequence of SEQ ID NO: 25. In some embodiments, the cytosine deaminase may be a FERNY deaminase, optionally a FERNY having the amino acid sequence of SEQ ID NO: 26. In some embodiments, a cytosine deaminase useful in the present invention can be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an evolved deaminase).In some embodiments, a cytosine deaminase useful in the present invention may be about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, or SEQ ID NO: NO:29 is at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical). In some embodiments, the polynucleotide encoding the cytosine deaminase can be codon-optimized for expression in plants, and the codon-optimized polypeptide can be about 70% to 99.5% identical to the reference polynucleotide.

[0268] In some embodiments, the nucleic acid constructs of the present invention may also encode uracil glycosylase inhibitor (UGI) (e.g., uracil-DNA glycosylase inhibitor) polypeptides / domains. Thus, in some embodiments, nucleic acid constructs encoding CRISPR-Cas effector proteins and cytosine deaminase domains (e.g., encoding a fusion protein comprising a CRISPR-Cas effector protein domain fused to a cytosine deaminase domain, and / or a CRISPR-Cas effector protein domain fused to a peptide tag or an affinity polypeptide capable of binding a peptide tag, and / or a deaminase protein domain fused to a peptide tag or an affinity polypeptide capable of binding a peptide tag) may also encode uracil-DNA glycosylase inhibitor (UGI), optionally wherein UGI may be codon-optimized for expression in plants. In some embodiments, the present invention provides fusion proteins comprising CRISPR-Cas effector polypeptides, deaminase domains, and UGI and / or one or more polynucleotides encoding them, optionally wherein one or more polynucleotides may be codon-optimized for expression in plants. In some embodiments, the present invention provides fusion proteins, wherein the CRISPR-Cas effector polypeptide, the deaminase domain and the UGI can be fused to any combination of peptide tags and affinity polypeptides as described herein, thereby recruiting the deaminase domain and the UGI to the CRISPR-Cas effector polypeptide and the target nucleic acid. In some embodiments, the guide nucleic acid can be linked to a recruitment RNA motif, and one or more of the deaminase domain and / or the UGI can be fused to an affinity polypeptide capable of interacting with the recruitment RNA motif, thereby recruiting the deaminase domain and the UGI to the target nucleic acid.

[0269] The "uracil glycosylase inhibitor" useful in the present invention may be any protein capable of inhibiting uracil-DNA glycosylase base excision repair enzymes. In some embodiments, the UGI domain comprises a wild-type UGI or a fragment thereof. In some embodiments, the UGI domain useful in the present invention may be about 70% to about 100% identical to the amino acid sequence of a naturally occurring UGI domain (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical and any range or value therein). In some embodiments, the UGI domain may comprise the amino acid sequence of SEQ ID NO:41, or a polypeptide having about 70% to about 99.5% sequence identity to the amino acid sequence of SEQ ID NO:41 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:41). For example, in some embodiments, the UGI domain may comprise a fragment of the amino acid sequence of SEQ ID NO:41 that is 100% identical to a portion of consecutive nucleotides (e.g., 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45 to about 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides) of the amino acid sequence of SEQ ID NO:41. In some embodiments, the UGI domain can be a variant of a known UGI (e.g., SEQ ID NO: 41) having about 70% to about 99.5% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% sequence identity, and any range or value therein) to the known UGI. In some embodiments, the polynucleotide encoding the UGI can be codon-optimized for expression in a plant (e.g., a plant), and the codon-optimized polypeptide can be about 70% to about 99.5% identical to the reference polynucleotide.

[0270] Adenine deaminase (or adenosine deaminase) useful in the present invention can be any known or later identified adenine deaminase from any organism (see, e.g., U.S. Pat. No. 10,113,163, the disclosure of which is incorporated herein by reference for adenine deaminase). Adenine deaminase can catalyze the hydrolytic deamination of adenine or adenosine. In some embodiments, adenine deaminase can catalyze the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, adenosine deaminase can catalyze the hydrolytic deamination of adenine or adenosine in DNA. In some embodiments, adenine deaminase encoded by a nucleic acid construct of the present invention can produce an A→G transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a T→C transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0271] In some embodiments, the adenosine deaminase may be a variant of a naturally occurring adenine deaminase. Thus, in some embodiments, the adenosine deaminase may be about 70% to 100% identical to a wild-type adenine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a naturally occurring adenine deaminase, and any range or value therein). In some embodiments, the deaminase or deaminase is not naturally occurring and may be referred to as an engineered, mutated or evolved adenosine deaminase. Thus, for example, an engineered, mutated or evolved adenine deaminase polypeptide or adenine deaminase domain can be about 70% to 99.9% identical to a naturally occurring adenine deaminase polypeptide / domain (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 11 In some embodiments, the adenine deaminase polypeptide / domain may be codon-optimized for expression in plants.

[0272] In some embodiments, the adenine deaminase domain can be a wild-type tRNA-specific adenosine deaminase domain, such as a tRNA-specific adenosine deaminase (TadA), and / or a mutant / evolved adenosine deaminase domain, such as a mutant / evolved tRNA-specific adenosine deaminase domain (TadA*). In some embodiments, the TadA domain can be from Escherichia coli (E. coli). In some embodiments, TadA can be modified, such as truncated, with one or more N-terminal and / or C-terminal amino acids missing relative to full-length TadA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19 or 20 N-terminal and / or C-terminal amino acid residues may be missing relative to full-length TadA). In some embodiments, the TadA polypeptide or TadA domain does not include an N-terminal methionine. In some embodiments, the wild-type E. coli TadA comprises the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mutant / evolved E. coli TadA* comprises the amino acid sequence of SEQ ID NO: 31-40 (e.g., SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40). In some embodiments, the polynucleotide encoding TadA / TadA* can be codon-optimized for expression in plants.

[0273] Cytosine deaminase catalyzes the deamination of cytosine and produces thymidine (via a uracil intermediate), causing a C to T transition or a G to A transition in the complementary strand of the genome. Thus, in some embodiments, a cytosine deaminase encoded by a polynucleotide of the invention produces a C→T transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a G→A transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0274] In some embodiments, an adenine deaminase encoded by a nucleic acid construct of the invention produces an A→G transition in the sense (e.g., "+"; template) strand of a target nucleic acid or a T→C transition in the antisense (e.g., "-", complementary) strand of a target nucleic acid.

[0275] The nucleic acid construct encoding the base editor comprising a sequence-specific nucleic acid binding protein and a cytosine deaminase polypeptide of the present invention, and the nucleic acid construct / expression cassette / vector encoding the same, can be used in combination with a guide nucleic acid for modifying a target nucleic acid, including but not limited to generating a C→T or G→A mutation in a target nucleic acid (including but not limited to a plasmid sequence); generating a C→T or G→A mutation in a coding sequence to change the amino acid identity; generating a C→T or G→A mutation in a coding sequence to generate a stop codon; generating a C→T or G→A mutation in a coding sequence to destroy a start codon; generating a point mutation in genomic DNA to destroy function; and / or generating a point mutation in genomic DNA to destroy a splice junction.

[0276] The nucleic acid constructs of the present invention encoding base editors comprising sequence-specific nucleic acid binding proteins and adenine deaminase polypeptides, as well as expression cassettes and / or vectors encoding the same, can be used in combination with guide nucleic acids to modify target nucleic acids, including but not limited to generating A→G or T→C mutations in target nucleic acids (including but not limited to plasmid sequences); generating A→G or T→C mutations in coding sequences to change amino acid identity; generating A→G or T→C mutations in coding sequences to generate stop codons; generating A→G or T→C mutations in coding sequences to destroy start codons; generating point mutations in genomic DNA to destroy function; and / or generating point mutations in genomic DNA to destroy splice junctions.

[0277] The nucleic acid constructs of the present invention comprising a CRISPR-Cas effector protein or a fusion protein thereof can be used in combination with a guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA) to modify a target nucleic acid, which is designed to function with the encoded CRISPR-Cas effector protein or domain. The guide nucleic acid that can be used in the present invention comprises at least one spacer sequence and at least one repeat sequence. The guide nucleic acid is capable of forming a complex with the CRISPR-Cas nuclease domain encoded and expressed by the nucleic acid construct of the present invention, and the spacer sequence is capable of hybridizing with the target nucleic acid, thereby guiding the complex (e.g., a CRISPR-Cas effector fusion protein (e.g., a CRISPR-Cas effector domain fused to a deaminase domain and / or a CRISPR-Cas effector domain fused to a peptide tag or affinity polypeptide to recruit a deaminase domain and optionally a UGI) to a target nucleic acid, wherein the target nucleic acid can be modified (e.g., cleaved or edited) or regulated (e.g., regulated transcription) by the deaminase domain.

[0278] As an example, a nucleic acid construct encoding a Cas9 domain (e.g., a fusion protein) connected to a cytosine deaminase domain can be used in combination with a Cas9 guide nucleic acid to modify a target nucleic acid, wherein the cytosine deaminase domain of the fusion protein deaminates cytosine bases in the target nucleic acid, thereby editing the target nucleic acid. In another example, a nucleic acid construct encoding a Cas9 domain (e.g., a fusion protein) connected to an adenine deaminase domain can be used in combination with a Cas9 guide nucleic acid to modify a target nucleic acid, wherein the adenine deaminase domain of the fusion protein deaminates adenosine bases in the target nucleic acid, thereby editing the target nucleic acid.

[0279] Similarly, encoding a Cas12a domain (or other selected CRISPR-Cas nucleases, such as C2c1, C2c3, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Nucleic acid constructs of Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4(dinG) and / or Csf5) (e.g., fusion proteins) can be used in combination with a Cas12a guide nucleic acid (or a guide nucleic acid of another selected CRISPR-Cas nuclease) to modify a target nucleic acid, wherein the cytosine deaminase domain or adenine deaminase domain of the fusion protein deaminates cytosine bases in the target nucleic acid, thereby editing the target nucleic acid.

[0280] As used herein, “guide nucleic acid,” “guide RNA,” “gRNA,” “CRISPR RNA / DNA,” “crRNA,” or “crDNA” refers to a sequence comprising at least one spacer sequence complementary to (and hybridizing with) a target DNA (e.g., a protospacer) and at least one repeat sequence (e.g., a repeat sequence of a type V Cas12a CRISPR-Cas system, or a fragment or portion thereof; a repeat sequence of a type II Cas9 CRISPR-Cas system, or a fragment thereof; a type V C2c1 CRISPR Repeat sequences of the Cas system, or fragments thereof; for example, C2c3, Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4 (dinG) and / or Csf5 CRISPR-Cas system repetitive sequence, or its fragment) nucleic acid, wherein the repetitive sequence can be connected to the 5' end and / or 3' end of the spacer sequence. The design of the gRNA of the present invention can be based on type I, type II, type III, type IV, type V or type VI CRISPR-Cas system.

[0281] In some embodiments, the Cas12a gRNA may comprise a repeat sequence (full length or a portion thereof ("handle"); e.g., a pseudoknot-like structure) and a spacer sequence from 5' to 3'.

[0282] In some embodiments, the guide nucleic acid may comprise more than one repeat-spacer sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more repeat-spacer sequences) (e.g., repeat-spacer-repeat, e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer, etc.). The guide nucleic acids of the invention are synthetic, artificial, and do not exist in nature. The gRNA can be very long and can be used as an aptamer (e.g., in the MS2 recruitment strategy) or other RNA structures with hanging spacers.

[0283] As used herein, "repetitive sequence" refers to any repetitive sequence of, for example, a wild-type CRISPR Cas locus (e.g., Cas9 locus, Cas12a locus, C2c1 locus, etc.) or a repetitive sequence of a synthetic crRNA that works together with a CRISPR-Cas effector protein encoded by a nucleic acid construct of the present invention. The repetitive sequence that can be used in the present invention can be any known or later identified repetitive sequence (e.g., type I, type II, type III, type IV, type V, or type VI) of the CRISPR-Cas locus, or it can be a synthetic repetitive sequence designed to work in a type I, II, III, IV, V, or VI CRISPR-Cas system. The repetitive sequence may include a hairpin structure and / or a stem-loop structure. In some embodiments, the repetitive sequence may form a pseudoknot-like structure (i.e., "handle") at its 5' end. Thus, in some embodiments, the repetitive sequence may be identical or substantially identical to a repetitive sequence from a wild-type type I CRISPR-Cas locus, a type II CRISPR-Cas locus, a type III CRISPR-Cas locus, a type IV CRISPR-Cas locus, a type V CRISPR-Cas locus, and / or a type VI CRISPR-Cas locus. Repetitive sequences from wild-type CRISPR-Cas loci can be determined by established algorithms, such as using CRISPRfinder provided by CRISPRdb (see, Grissa et al., Nucleic Acids Res. 35 (web server album): W52-7). In some embodiments, the repetitive sequence or a portion thereof is linked to the 5' end of the spacer sequence at its 3' end, thereby forming a repeat-spacer sequence (e.g., a guide nucleic acid, a guide RNA / DNA, a crRNA, a crDNA).

[0284] In some embodiments, the repetitive sequence comprises, consists essentially of, or consists of at least 10 nucleotides, depending on the particular repetitive sequence and whether the guide nucleic acid comprising the repetitive sequence is processed or unprocessed (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 to 100 or more nucleotides, or any range or value therein). In some embodiments, the repetitive sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.

[0285] The repeat sequence linked to the 5' end of the spacer sequence may comprise a portion of the repeat sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive nucleotides of the wild-type repeat sequence). In some embodiments, the portion of the repeat sequence linked to the 5' end of the spacer sequence can be about five to about ten contiguous nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) and have at least 90% sequence identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (e.g., 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the same region (e.g., 5' end) of a wild-type CRISPR Cas repeat nucleotide sequence. In some embodiments, a portion of the repeat sequence can include a pseudoknot-like structure (e.g., a "handle") at its 5' end.

[0286] As used herein, a "spacer sequence" is a nucleotide sequence complementary to a target nucleic acid (e.g., target DNA) (e.g., a pre-spacer) (e.g., a portion of contiguous nucleotides of the following sequence: (a) comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73; (b) comprising a region having at least 80% sequence identity to a nucleotide sequence of any one of SEQ ID NOs: 75-98; (c) encoding a NAC7 domain-containing transcription factor polypeptide having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 74; and / or (d) encoding a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103). In some embodiments, the spacer sequence (e.g., one or more spacers) may include, but are not limited to, a nucleotide sequence of any one of SEQ ID NOs: 99-101 or a reverse complementary sequence thereof. The spacer sequence can be completely complementary or substantially complementary (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more (e.g., Thus, in some embodiments, the spacer sequence may have one, two, three, four, or five mismatches compared to the target nucleic acid, and these mismatches may be continuous or discontinuous. In some embodiments, the spacer sequence may have 70% complementarity with the target nucleic acid. In other embodiments, the spacer nucleotides may have 50% complementarity with the target nucleic acid. Sequence can have 80% complementarity with target nucleic acid.In other embodiments, spacer nucleotide sequence can have 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% complementarity with target nucleic acid (pre-spacer) etc.In some embodiments, spacer sequence is 100% complementary with target nucleic acid.Spacer sequence can have the length of about 15 nucleotides to about 30 nucleotides (for example, 15,16,17,18,19,20,21,22,23,24,25,26,27,28,29 or 30 nucleotides, or any range or value therein).Therefore, in some embodiments, spacer sequence can have complete complementarity or basic complementarity in the target nucleic acid (for example, pre-spacer) region of at least about 15 nucleotides to about 30 nucleotides in length.In some embodiments, the length of spacer is about 20 nucleotides.In some embodiments, the length of spacer is about 21,22 or 23 nucleotides.

[0287] In some embodiments, the 5' region of the spacer sequence of the guide nucleic acid may be identical to the target DNA, while the 3' region of the spacer may be substantially complementary to the target DNA (e.g., type V CRISPR-Cas), or the 3' region of the spacer sequence of the guide nucleic acid may be identical to the target DNA, while the 5' region of the spacer may be substantially complementary to the target DNA (e.g., type II CRISPR-Cas), and thus, the overall complementarity of the spacer sequence to the target DNA may be less than 100%. Thus, for example, in the guide sequence of the type V CRISPR-Cas system, for example, the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 5' region (i.e., seed region) of the 20-nucleotide spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 70% complementary). In some embodiments, the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8 nucleotides, and any range therein) of the 5' end of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 3' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more).

[0288] As another example, in the guide sequence of a type II CRISPR-Cas system, the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 3' region (i.e., seed region) of, for example, a 20-nucleotide spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 70% complementary). In some embodiments, the first 1 to 10 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, and any ranges therein) of the 3' end of the spacer sequence may be 100% complementary to the target DNA, while the remaining nucleotides in the 5' region of the spacer sequence are substantially complementary to the target DNA (e.g., at least about 50% complementary (e.g., at least about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more or any range or value therein) .

[0289] In some embodiments, the seed region of the spacer can be about 8 to about 10 nucleotides long, about 5 to about 6 nucleotides long, or about 6 nucleotides long.

[0290] As used herein, "target nucleic acid," "target DNA," "target nucleotide sequence," "target region," or "target region in a genome" refers to a region of a plant genome that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more)) to a spacer sequence in a guide nucleic acid of the invention. The target region that can be used for a CRISPR-Cas system can be positioned immediately 3' (e.g., a type V CRISPR-Cas system) or immediately 5' (e.g., a type II CRISPR-Cas system) to a PAM sequence in the genome of an organism (e.g., a plant genome). The target region can be selected from any region of at least 15 consecutive nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides, etc.) located immediately adjacent to the PAM sequence.

[0291] "Pre-spacer sequence" refers to the target double-stranded DNA, specifically to the portion of the target DNA (e.g., or a target region in the genome) that is completely or substantially complementary (and hybridizes) to the spacer sequence of a CRISPR repeat-spacer sequence (e.g., a guide nucleic acid, a CRISPR array, a crRNA).

[0292] In the case of type V CRISPR-Cas (e.g., Cas12a) systems and type II CRISPR-Cas (Cas9) systems, the protospacer sequence is flanked by (e.g., immediately adjacent to) a protospacer adjacent motif (PAM). For type IV CRISPR-Cas systems, the PAM is located at the 5' end of the non-target strand and the 3' end of the target strand (see below, as an example).

[0293]

[0294] In the case of type II CRISPR-Cas (e.g., Cas9) systems, the PAM is positioned immediately 3' to the target region. The PAM of type I CRISPR-Cas systems is located 5' to the target strand. There is no known PAM for type III CRISPR-Cas systems. Makarova et al. describe the nomenclature for all classes, types, and subtypes of CRISPR systems (Nature Reviews Microbiology 13:722–736 (2015)). R. Barrangou (Genome Biol. 16:247 (2015)) describes guide structures and PAMs.

[0295] Typical Cas12a PAMs are T-rich. In some embodiments, typical Cas12a PAM sequences can be 5'-TTN, 5'-TTTN, or 5'-TTTV. In some embodiments, typical Cas9 (e.g., Streptococcus pyogenes) PAMs can be 5'-NGG-3'. In some embodiments, atypical PAMs can be used, but the efficiency may be lower.

[0296] Those skilled in the art can determine additional PAM sequences by established experimental and computational methods. Therefore, for example, experimental methods include targeting sequences flanking all possible nucleotide sequences and identifying sequence members that do not undergo targeting, such as by transformation of target plasmid DNA (Esvelt et al., 2013. Nat. Methods 10: 1116-1121; Jiang et al., 2013. Nat. Biotechnol. 31: 233-239). In some aspects, computational methods may include performing BLAST searches on natural spacers to identify the original target DNA sequence in phage or plasmids, and aligning these sequences to determine conserved sequences adjacent to the target sequence (Briner and Barrangou, 2014. Appl. Environ. Microbiol. 80: 994-1001; Mojica et al., 2009. Microbiology 155: 733-740).

[0297] In some embodiments, the present invention provides expression cassettes and / or vectors comprising nucleic acid constructs of the present invention (e.g., one or more components of the editing system of the present invention). In some embodiments, expression cassettes and / or vectors comprising nucleic acid constructs of the present invention and / or one or more guide nucleic acids may be provided. In some embodiments, nucleic acid constructs of the present invention encoding base editors (e.g., constructs (e.g., fusion proteins) comprising CRISPR-Cas effector proteins and deaminase domains) or components for base editing (e.g., CRISPR-Cas effector proteins fused to peptide tags or affinity polypeptides, deaminase domains fused to peptide tags or affinity polypeptides, and / or UGI fused to peptide tags or affinity polypeptides) may be included in an expression cassette or vector that is the same as or separate from an expression cassette or vector comprising one or more guide nucleic acids. When the nucleic acid construct encoding a base editor or the components for base editing are contained on an expression cassette or vector separate from the expression cassette or vector comprising a guide nucleic acid, the target nucleic acid can be contacted with (e.g., provided together with) the expression cassette or vector encoding the base editor or the components for base editing in any order with each other and the guide nucleic acid, for example, before, simultaneously with, or after providing the expression cassette comprising the guide nucleic acid (e.g., contacting with the target nucleic acid).

[0298] The fusion protein of the present invention may comprise a sequence-specific nucleic acid binding domain (e.g., a sequence-specific DNA binding domain), a CRISPR-Cas polypeptide and / or a deaminase domain fused to a peptide tag as known in the art or an affinity polypeptide that interacts with a peptide tag, for recruiting the deaminase to the target nucleic acid. The recruitment method may also include a guide nucleic acid connected to an RNA recruitment motif and a deaminase fused to an affinity polypeptide that can interact with the RNA recruitment motif, thereby recruiting the deaminase to the target nucleic acid. Alternatively, chemical interactions can be used to recruit polypeptides (e.g., deaminase) to target nucleic acids.

[0299] Peptide tags (e.g., epitopes) that can be used in the present invention may include, but are not limited to, GCN4 peptide tags (e.g., Sun-Tag), c-Myc affinity tags, HA affinity tags, His affinity tags, S affinity tags, methionine-His affinity tags, RGD-His affinity tags, FLAG octapeptide, strep tags or strep tags II, V5 tags and / or VSV-G epitopes. Any epitope that can be linked to a polypeptide and has a corresponding affinity polypeptide that can be linked to another polypeptide can be used as a peptide tag in the present invention. In some embodiments, the peptide tag may include 1 or 2 or more copies of a peptide tag (e.g., repeating unit, multimerized epitope (e.g., tandem repeat)) (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more repeating units). In some embodiments, the affinity polypeptide that interacts / binds with the peptide tag can be an antibody. In some embodiments, the antibody can be a scFv antibody. In some embodiments, the affinity polypeptide that binds to the peptide tag can be synthetic (e.g., evolved for affinity interaction), including but not limited to affibodies, anticalins, monobodies, and / or DARPins (see, e.g., Sha et al., Protein Sci. 26(5):910-924(2017)); Gilbreth (Curr Opin Struc Biol 22(4):413-420(2013)), U.S. Patent No. 9,982,053, each of which is incorporated by reference for its entirety for its teachings on affibodies, anticalins, monobodies, and / or DARPins. Example peptide tag sequences and affinity polypeptides thereof include but are not limited to the amino acid sequences of SEQ ID NOs: 45-47.

[0300] In some embodiments, the guide nucleic acid can be linked to an RNA recruitment motif, and the polypeptide to be recruited (e.g., a deaminase) can be fused to an affinity polypeptide that binds to the RNA recruitment motif, wherein the guide sequence binds to the target nucleic acid and the RNA recruitment motif binds to the affinity polypeptide, thereby recruiting the polypeptide to the guide sequence and contacting the target nucleic acid with the polypeptide (e.g., a deaminase). In some embodiments, two or more polypeptides can be recruited to the guide nucleic acid, thereby contacting the target nucleic acid with two or more polypeptides (e.g., a deaminase). Example RNA recruitment motifs and affinity polypeptides thereof include, but are not limited to, sequences of SEQ ID NOs: 48-58.

[0301] In some embodiments, the polypeptide fused to the affinity polypeptide can be a reverse transcriptase, and the guide nucleic acid can be an extended guide nucleic acid connected to an RNA recruitment motif. In some embodiments, the RNA recruitment motif can be located at the 3' end of the extended portion of the extended guide nucleic acid (e.g., 5'-3', repeat-spacer-extension portion (RT template-primer binding site)-RNA recruitment motif). In some embodiments, the RNA recruitment motif can be embedded in the extension portion.

[0302] In some embodiments of the invention, the extended guide RNA and / or guide RNA can be linked to one or two or more RNA recruitment motifs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more motifs; e.g., at least 10 to about 25 motifs), optionally wherein the two or more RNA recruitment motifs can be the same RNA recruitment motif or different RNA recruitment motifs. In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide may include, but are not limited to, the telomerase Ku binding motif (e.g., Ku binding hairpin) and the corresponding affinity polypeptide Ku (e.g., Ku heterodimer), the telomerase Sm7 binding motif and the corresponding affinity polypeptide Sm7, the MS2 phage operator stem loop and the corresponding affinity polypeptide MS2 coat protein (MCP), the PP7 phage operator stem loop and the corresponding affinity polypeptide PP7 coat protein (PCP), the SfMu phage Com stem loop and the corresponding affinity polypeptide Com RNA binding protein, the PUF binding site (PBS) and the affinity polypeptide Pumilio / fem-3 mRNA binding factor (PUF), and / or a synthetic RNA aptamer and an aptamer ligand as the corresponding affinity polypeptide. In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide may be the MS2 phage operator stem loop and the affinity polypeptide MS2 coat protein (MCP). In some embodiments, the RNA recruitment motif and the corresponding affinity polypeptide can be a PUF binding site (PBS) and an affinity polypeptide Pumilio / fem-3m RNA binding factor (PUF).

[0303] In some embodiments, the components used to recruit polypeptides and nucleic acids can be those that function through chemical interactions, which can include, but are not limited to, rapamycin-induced FRB-FKBP dimerization; biotin-streptavidin; SNAP tag; Halo tag; CLIP tag; compound-induced DmrA-DmrC heterodimer; bifunctional ligands (e.g., two protein-binding chemicals fused together; such as dihydrofolate reductase (DHFR).

[0304] In some embodiments, a nucleic acid construct, expression cassette, or vector of the invention optimized for expression in plants may be about 70% to 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) to a nucleic acid construct, expression cassette, or vector comprising the same polynucleotide but which has not been codon-optimized for expression in plants.

[0305] Also provided herein are cells comprising one or more polynucleotides, guide nucleic acids, nucleic acid constructs, expression cassettes or vectors of the invention.

[0306] The nucleic acid constructs of the present invention (e.g., constructs comprising a sequence-specific DNA binding domain, a CRISPR-Cas effector domain, a deaminase domain, a reverse transcriptase (RT), an RT template and / or a guide nucleic acid, etc.) and expression cassettes / vectors comprising the same can be used as the editing system of the present invention for modifying target nucleic acids and / or their expression.

[0307] The target nucleic acid of any plant or plant part (or plant grouping into groups such as genera or higher classifications) can be modified (e.g., mutated, e.g., base edited, cleaved, cut, etc.) using the polypeptides, polynucleotides, ribonucleoproteins (RNPs), nucleic acid constructs, expression cassettes and / or vectors of the present invention, including angiosperms, gymnosperms, monocots, dicots, C3, C4, CAM plants, mosses, ferns and / or pseudoferns, microalgae and / or macroalgae. The plants and / or plant parts that can be modified as described herein can be plants and / or plant parts of any plant species / variety / cultivar. In some embodiments, the plants that can be modified as described herein are monocots. In some embodiments, the plants that can be modified as described herein are dicots.

[0308] As used herein, the term "plant part" includes, but is not limited to, reproductive tissue (e.g., petals, sepals, stamens, pistils, receptacles, anthers, pollen, flowers, fruits, buds, ovules, seeds, embryos, nuts, kernels, spikes, cobs, and husks); vegetative tissue (e.g., petioles, stems, roots, root hairs, root tips, pith, coleoptiles, stalks, shoots, branches, bark, apical meristems, axillary buds, cotyledons, hypocotyls, and leaves); vascular tissue (e.g., phloem and xylem); specialized cells, such as epidermal cells, parenchyma cells, collenchyma cells, stomata, guard cells, cuticles, mesophyll cells; callus; and cuttings. The term "plant part" also includes plant cells, including intact plant cells in plants and / or plant parts, plant protoplasts, plant tissues, plant organs, plant cell tissue cultures, plant callus, plant clumps, and the like. As used herein, "seedlings" refer to aerial parts, including leaves and stems. As used herein, the term "tissue culture" encompasses cultures of tissues, cells, protoplasts, and callus.

[0309] As used herein, "plant cell" refers to the structural and physiological unit of a plant, which generally includes a cell wall, but also includes a protoplast. The plant cell of the present invention can be in the form of an isolated unicellular cell, or can be a cultured cell, or can be a part of a higher organizational unit such as, for example, a plant tissue (including callus) or a plant organ. In some embodiments, the plant cell can be an algae cell." protoplast" is a plant cell that does not have a cell wall or only has a partial cell wall. Therefore, in some embodiments of the present invention, the transgenic cell comprising the nucleic acid molecule of the present invention and / or the nucleotide sequence is a cell of any plant or plant part, including but not limited to root cells, leaf cells, tissue culture cells, seed cells, flower cells, fruit cells, pollen cells, etc. In some aspects of the present invention, a plant part can be a plant germplasm. In some aspects, a plant cell can be a non-breeding plant cell that no longer generates a plant.

[0310] "Plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various stages of development.

[0311] As used herein, a "plant organ" is a distinct and clearly structured and differentiated part of a plant, such as a root, stem, leaf, flower bud, or embryo.

[0312] As used herein, "plant tissue" refers to a group of plant cells organized into a structural and functional unit. Included is any plant tissue in situ or in culture. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into a structural and / or functional unit. The term, when used with or without any specific type of plant tissue listed above or included in this definition, is not intended to exclude any other type of plant tissue.

[0313] In some embodiments of the invention, transgenic tissue cultures or transgenic plant cell cultures are provided, wherein the transgenic tissue or cell culture comprises the nucleic acid molecules / nucleotide sequences of the invention. In some embodiments, the transgenic tissue or cell culture is provided, wherein the transgenic tissue or cell culture comprises the nucleic acid molecules / nucleotide sequences of the invention. In some embodiments, the transgenic tissue or cell is provided, wherein the transgenic tissue or cell culture ...

[0314] Any plant comprising an endogenous NAC7 gene can be modified as described herein to improve one or more yield traits. Non-limiting examples of plants that can be modified as described herein can include, but are not limited to, turf grasses (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, tufted hairgrass, miscanthus, reed, switchgrass, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., cabbage, leaf lettuce, romaine lettuce), yellow taro, melons (e.g., musk melon, watermelon, Crenshaw melon, honeydew melon, cantaloupe), Brassica crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoons, carrots, sauerkraut, okra, onions, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, zucchini, pumpkin, squash, honeydew melon, watermelon, cantaloupe), radishes, dry bulb onions (e.g., cauliflower, cauliflower, broccoli, kale, kale, Chinese cabbage, pak choi), onion), rutabaga, eggplant, salsify, endive, shallots, endive, garlic, spinach, shallots, pumpkin, leafy greens, beets (sugar and fodder), sweet potatoes, chard, horseradish, tomatoes, carrots, and spices; fruit crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, figs, nuts (e.g., chestnuts, pecans, pistachios, hazelnuts, pistachios, peanuts, walnuts, macadamia nuts, almonds etc.), citrus (e.g., clementines, kumquats, oranges, grapefruits, tangerines, mandarins, lemons, limes, etc.), blueberries, black raspberries, boysenberries, cranberries, currants, gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (wine and table grapes), avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomegranates, cantaloupe, mangoes, papayas, and lychees, field crops such as clover, alfalfa, timothy, evening primrose, silvergrass, corn / Maize (fodder corn, sweet corn, popcorn), hops, jojoba, buckwheat, safflower, quinoa, wheat, rice, barley, rye, millet, sorghum, oats, triticale, sorghum, tobacco, kapok, legumes (legumes (e.g., green and dry beans), lentils, peas, soybeans), oil plants (rapeseed, canola, mustard, olives, sunflower, coconut, castor oil plants, cocoa beans, peanuts, oil palm), duckweed, Arabidopsis, fiber plants (cotton, flax, , jute), Lauraceae (cinnamon, camphor) or plants such as coffee, sugar cane, tea and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants (e.g., roses, tulips, violets), and trees, such as forest trees (broad-leaved and evergreen trees, such as conifers; e.g., elm, ash, oak, maple, fir, spruce, cedar, pine, birch, cypress, eucalyptus, willow) and shrubs and other nursery stock. In some embodiments, the nucleic acid constructs of the invention and / or expression cassettes and / or vectors encoding the same can be used to modify, for example, corn.

[0315] In some embodiments, plants that can be modified as described herein can include, but are not limited to, corn, soybean, canola, wheat, rice, cotton, sugarcane, sugar beet, barley, oats, alfalfa, sunflower, safflower, oil palm, sesame, coconut, tobacco, potato, sweet potato, cassava, coffee tree, apple, plum, apricot, peach, cherry, pear, fig, banana, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, grape, tomato, cucumber, or Brassica spp (e.g., B. napus, B. oleracea, B. rapa, B. juncea, and / or B. nigra). In some embodiments, plants that can be modified as described herein are dicots. In some embodiments, plants that can be modified as described herein are monocots. In some embodiments, plants that can be modified as described herein are corn.

[0316] The present invention will now be described with reference to the following examples. It should be understood that these examples are not intended to limit the scope of the claims of the present invention, but are intended to be examples of certain embodiments. Any changes to the exemplary methods that occur to the technician are intended to fall within the scope of the present invention.

[0317] Example

[0318] Example 1. Editing strategy

[0319] An editing strategy was developed to generate altered alleles in the maize NAC7 transcription factor gene of GRMZM2G114850, thereby altering ear size, which could be accompanied by C-terminal truncation of the encoded NAC7 polypeptide. To generate a series of alleles, multiple CRISPR guide nucleic acids containing spacers PWsp1634, PWsp1635 and / or PWsp1636 with complementarity (inverse) to targets within the NAC7 gene were designed and placed in separate constructs (see Table 1).

[0320] Table 1. Boot spacer

[0321] Spacer ID sequence SEQ ID NO: PWsp1634 CCTTGGAGTTGGATGAGGAGGGT 99 PWsp1635 CCTCCTGCGCGGCCTCCTGCTGC 100 PWsp1636 TGTCCATGCGAGGTGGCAGCGGC 101

[0322] Lines carrying edits in the NAC7 gene were screened, and those showing approximately 10% of sequenced reads with edits in the target gene were advanced to the next generation.

[0323] Example 2. Edited NAC7 alleles

[0324] Edited NAC7 alleles were generated as described in Example 1, and these edited NAC7 alleles are further described in Table 2.

[0325] Table 2. Edited NAC7 alleles

[0326]

[0327]

[0328] Example 3: Phenotypic analysis of edited alleles

[0329] Seeds were sown on flat ground and then transferred to pots after seedlings were formed. All materials were cultivated under standard greenhouse conditions and grown to reproductive maturity. As standard practice, newly emerged ears were covered with small paper bags before silking, and tassels were covered plant by plant during flowering to capture pollen. In some cases, flowering and silking may not be synchronized.

[0330] The mature ears were imaged so that ear length and ear width could be calculated based on analysis of the images. Ear length and ear width were measured in centimeters. Ear length and ear width were measured in centimeters and are further described in Tables 3 and 4. The altered NAC7 alleles tended to result in an increase in ear length without significantly changing ear width.

[0331] Table 3. Ear length (cm)

[0332]

[0333] Table 4. Ear width (cm)

[0334]

[0335] The foregoing is illustrative of the present invention and should not be construed as limiting the present invention. The present invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

1. A plant or plant part thereof comprising at least one mutation in at least one (eg, one or more) endogenous NAC7 gene encoding a NAC7 domain-containing transcription factor polypeptide.

2. The plant or plant part thereof according to claim 1, wherein said at least one mutation results in a dominant negative mutation.

3. The plant or part thereof according to claim 1 or claim 2, wherein the at least one mutation is a base substitution, a base deletion and / or a base insertion.

4. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation comprises a base substitution to A, T, G or C.

5. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is a deletion of at least one base pair, optionally a deletion of one base pair to about 100 consecutive base pairs.

6. The plant or part thereof according to any one of claims 1 to 5, wherein the at least one mutation is an insertion of at least one base pair.

7. The plant or part thereof of any one of the preceding claims, wherein the at least one mutation in the endogenous NAC7 gene is located in exon 3, exon 4 and / or in the non-coding region between exon 3 and exon 4, optionally in the region of the endogenous NAC7 gene located from about nucleotide 5094 to about nucleotide 5607 with reference to the nucleotide position numbering of SEQ ID NO:

72.

8. The plant or part thereof according to any one of the preceding claims, wherein the at least one mutation in the endogenous NAC7 gene results in a mutated NAC7 gene that produces a truncated NAC7 domain-containing transcription factor polypeptide.

9. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is an out-of-frame insertion or an out-of-frame deletion.

10. The plant or part thereof according to claim 9, wherein the out-of-frame insertion or out-of-frame deletion results in a premature stop codon, optionally resulting in a truncated NAC7 domain-containing transcription factor polypeptide.

11. The plant or part thereof of any one of claims 8 to 10, wherein the truncated NAC7 domain-containing transcription factor polypeptide comprises an intact NAC7 domain (eg, the truncation occurs in a region of the endogenous NAC7 gene 3' to the region comprising the NAC domain).

12. The plant or part thereof of claim 11, wherein the at least one mutation in the endogenous NAC7 gene results in a C-terminal truncation of the NAC7 domain-containing transcription factor polypeptide from one amino acid residue to about 198 consecutive amino acid residues, optionally a deletion of about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 191, 192, 193, 194, 195, 196, 197, 198 or more consecutive amino acid residues from the C-terminus of the encoded NAC7 domain-containing transcription factor polypeptide.

13. The plant or part thereof of claim 11, wherein the at least one mutation in the endogenous NAC7 gene results in a mutated NAC7 gene that produces a truncated polypeptide, optionally wherein the truncated polypeptide comprises the N-terminal amino acid residues from amino acid residue 1 to amino acid residue 27 of the NAC7 domain-containing transcription factor polypeptide (e.g., the first 27 contiguous amino acid residues of the amino acid sequence of SEQ ID NO: 74).

14. The plant or part thereof of any one of the preceding claims, wherein the endogenous NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs:75-98; (c) encodes a NAC7 domain-containing transcription factor polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:

103.

15. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation results in a deletion or insertion of one or more base pairs in a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-98.

16. The plant or part thereof as claimed in any one of the preceding claims, wherein the plant comprising the at least one mutation exhibits increased flower number, increased floral structure size and / or increased ear length compared to a control plant lacking the at least one mutation.

17. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation results in a mutated NAC7 gene comprising a nucleotide sequence having a mutation as described herein.

18. The plant or part thereof as claimed in any one of the preceding claims, wherein the plant is corn.

19. The plant or plant part thereof of claim 18, wherein the endogenous NAC7 gene has a gene identification number (gene ID) of GRMZM2G114850.

20. The plant or part thereof as claimed in any one of the preceding claims, wherein the at least one mutation is a non-natural mutation.

21. The plant or part thereof of any one of the preceding claims, wherein the at least one mutation results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

22. A plant cell, comprising an editing system, wherein the editing system comprises: (a) CRISPR-Cas effector proteins; and (b) a guide nucleic acid comprising a spacer sequence complementary to an endogenous target gene encoding a NAC7 domain-containing transcription factor polypeptide in the plant cell.

23. The plant cell of claim 21, wherein the editing system generates a mutation in the endogenous target gene encoding the NAC7 domain-containing transcription factor polypeptide.

24. A plant cell as described in claim 22 or claim 23, wherein the endogenous target gene: (a) comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NOs:75-98; (c) encodes a polypeptide having at least 80% sequence identity with SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity with the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:

103.

25. The plant cell of any one of claims 22 to 24, wherein the guide nucleic acid comprises any one of the nucleotide sequences of SEQ ID NOs: 99-101.

26. A plant regenerated from the plant part of any one of claims 1 to 21 or the plant cell of any one of claims 22 to 26.

27. The plant of claim 26, wherein the plant comprises a mutated NAC7 gene comprising a nucleotide sequence as described herein.

28. The plant of claim 26 or claim 27, wherein the plant has a phenotype of increased flower number, increased floral structure size and / or increased ear length.

29. A plant cell comprising at least one mutation within an endogenous NAC7 gene, wherein the at least one mutation is a base substitution, base insertion or base deletion introduced using an editing system comprising a nucleic acid binding domain that binds to a target site in the endogenous NAC7 gene.

30. The plant cell of claim 29, wherein the at least one mutation is a dominant negative mutation.

31. The plant cell of claim 29 or claim 30, wherein the target site is located within a region of the endogenous NAC7 gene that has at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-98, and / or encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO:

103.

32. The plant cell of any one of claims 29 to 31, wherein the editing system further comprises a nuclease, the nucleic acid binding domain binds to a target site in a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 72 or SEQ ID NO: 73 and / or a target site in a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-98, and the at least one mutation in the NAC7 gene is generated following cleavage by the nuclease.

33. The plant cell of any one of claims 29 to 32, wherein the mutation is a non-natural mutation.

34. The plant cell of claim 32, wherein the nuclease is a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an endonuclease (e.g., Fok1), or a CRISPR-Cas effector protein.

35. The plant cell of any one of claims 29 to 34, wherein the nucleic acid binding domain is a zinc finger, a transcription activator-like DNA binding domain (TAL), an argonaute, or a CRISPR-Cas effector nucleic acid binding domain.

36. The plant cell of any one of claims 29 to 35, wherein the at least one mutation within the NAC7 gene is an insertion and / or a deletion, optionally the at least one mutation is an out-of-frame insertion or an out-of-frame deletion.

37. The plant cell of any one of claims 29 to 35, wherein the at least one mutation within the NAC7 gene is an insertion and / or deletion resulting in a premature stop codon, optionally resulting in a NAC7 polypeptide with a C-terminal truncation.

38. The plant cell of any one of claims 29 to 37, wherein the at least one mutation within the NAC7 gene comprises a point mutation.

39. The plant cell of any one of claims 29 to 38, wherein the at least one mutation results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

40. A plant regenerated from the plant cell of any one of claims 29 to 39, said plant comprising said at least one mutation in said endogenous NAC7 gene.

41. The plant of claim 40, wherein the plant comprising the at least one mutation exhibits an increased ear size phenotype compared to a plant lacking the at least one mutation (e.g., an isogenic plant (e.g., a wild-type unedited plant or a null segregant).

42. A method for producing / growing a transgenic-free edited plant, the method comprising: Crossing the plant of any one of claims 1 to 21, 26 to 28, 40 or 41 with a plant without a transgene, thereby introducing the at least one mutation into the plant without a transgene; as well as Progeny plants that comprise the at least one mutation and are free of the transgene are selected, thereby producing transgene-free edited plants.

43. A method of providing a plurality of plants having a phenotype of increased flower number, increased floral structure size and / or increased ear length, the method comprising planting two or more plants of any one of claims 1 to 21, 26 to 28, 40 or 41 in a growing area, thereby providing the plurality of plants having a phenotype of increased flower number, increased floral structure size and / or increased ear length compared to a plurality of control plants lacking the at least one mutation.

44. A method for generating a mutation in an endogenous NAC7 gene of a plant, the method comprising: (a) targeting a gene editing system to a portion of the NAC1 gene, the portion comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; and (b) selecting a plant comprising a modification in a region of the NAC7 gene having at least 80% sequence identity to any one of SEQ ID NOs: 75-98.

45. A method for generating a mutation in the NAC7 gene, the method comprising: introducing an editing system into a plant cell, wherein the editing system targets a region of the NAC7 gene encoding a transcription factor polypeptide containing a NAC7 domain, and The region of the NAC7 gene is contacted with the editing system, thereby introducing mutations into the NAC7 gene and generating variations in the NAC7 gene in the plant cell.

46. ​​The method of claim 45, wherein the NAC7 gene: (a) comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprises a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encodes a region having at least 80% sequence identity to an amino acid sequence of SEQ ID NO:102 or SEQ ID NO:

103.

47. The method of claim 45 or claim 46, wherein the region of the NAC7 gene targeted has at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 75-98, and / or encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO:

103.

48. The method of any one of claims 45 to 47, wherein contacting the region of the endogenous NAC7 gene in the plant cell with the editing system produces a plant cell comprising the edited endogenous NAC7 gene in its genome, the method further comprising (a) regenerating a plant from the plant cell; (b) selfing the plant to produce a progeny plant (E1); (c) analyzing the progeny plant of (b) for increased flower number, increased floral structure size and / or increased ear length; and (d) selecting the progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length to produce selected progeny plants that exhibit increased flower number, increased floral structure size and / or increased ear length compared to a control plant.

49. The method of claim 48, further comprising (e) selfing the selected progeny plant of (d) to produce a progeny plant (E2); (f) analyzing the progeny plant of (e) for increased flower number, increased floral structure size and / or increased ear length; and (g) selecting the progeny plants exhibiting increased flower number, increased floral structure size and / or increased ear length to produce selected progeny plants exhibiting increased flower number, increased floral structure size and / or increased ear length compared to control plants, optionally repeating (e) to (g) one or more times.

50. A method for detecting a mutant NAC7 gene (mutation in an endogenous NAC7 gene) in a plant, the method comprising detecting a NAC7 gene in the genome of the plant, the NAC7 gene having at least one mutation in the region located from about nucleotide 5165 to about nucleotide 5607, numbered with reference to the nucleotide positions of SEQ ID NO:

72.

51. The method of claim 50, wherein the mutant NAC7 gene detected comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114, or 117.

52. A method for editing a specific site in the genome of a plant cell, the method comprising: cleaves a target site within an endogenous NAC7 gene in the plant cell in a site-specific manner, wherein the endogenous NAC7 gene: (a) comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region having at least 80% sequence identity to SEQ ID NOs:75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, thereby producing an edit in said endogenous NAC7 gene of said plant cell, and producing a plant cell comprising said edit in said endogenous NAC7 gene.

53. The method of claim 52, further comprising regenerating a plant from the plant cell comprising the edit in the endogenous NAC7 gene to produce a plant comprising the edit in its endogenous NAC7 gene.

54. The method of claim 52 or claim 53, wherein the editing results in a non-natural mutation.

55. The method of any one of claims 52 to 54, wherein the editing in the endogenous NAC7 gene is located in exon 3, exon 4 and / or the non-coding region between exon 3 and exon 4, optionally in the region of the endogenous NAC7 gene located between about nucleotide 5094 and about nucleotide 5607 with reference to the nucleotide position numbering of SEQ ID NO:

72.

56. The method of any one of claims 52 to 55, wherein said plant comprising said edit in its endogenous NAC7 gene exhibits a phenotype of increased flower number, increased floral structure size and / or increased ear length.

57. The method of any one of claims 52 to 56, wherein the endogenous NAC7 gene encodes a NAC7 domain-containing transcription factor polypeptide and the editing results in a truncated NAC7 domain-containing transcription factor polypeptide, optionally a C-terminal truncation of the NAC7 domain-containing transcription factor polypeptide, optionally wherein the C-terminal truncation results in a deletion of 1 amino acid residue to about 198 contiguous amino acid residues from the C-terminus of the NAC7 domain-containing transcription factor polypeptide.

58. The method of any one of claims 42 to 47, wherein the editing results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

59. A method for preparing a plant, the method comprising: (a) contacting a population of plant cells comprising an endogenous NAC7 gene with a nuclease linked to a nucleic acid binding domain (e.g., an editing system) that binds a sequence that (i) has at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73, (ii) comprises a region that has at least 80% identity to any one of SEQ ID NOs:75-98; (iii) encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO:74, (iv) and / or encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO:102 or SEQ ID NO:103; (b) selecting a plant cell from said population of plant cells in which the endogenous NAC7 gene has been mutated, thereby producing a plant cell comprising a mutation in said endogenous NAC7 gene; and (c) growing the selected plant cell into a plant comprising the mutation in the endogenous NAC7 gene.

60. A method for increasing the number of flowers, increasing the size of floral structures and / or increasing ear length in a plant, the method comprising: (a) contacting a plant cell comprising an endogenous NAC7 gene with a nuclease targeted to the endogenous NAC7 gene, wherein the nuclease is linked to a nucleic acid binding domain (e.g., an editing system) that binds to a target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (i) comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (ii) comprises a region that is at least 80% identical to any one of SEQ ID NOs: 75-98; (iii) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74, and / or (iv) encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO: 103 to produce a plant cell comprising a mutation in the endogenous NAC7 gene; and (b) growing said plant cell comprising the mutation in said endogenous NAC7 gene into a plant comprising said mutation in said endogenous NAC7 gene, thereby producing a plant having a mutated endogenous NAC7 gene and increased flower number, increased floral structure size and / or increased ear length.

61. A method for producing a plant or part thereof comprising at least one cell having a mutated endogenous NAC7 gene, the method comprising: contacting a target site in an endogenous NAC7 gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene (a) comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region that is at least 80% identical to any one of SEQ ID NOs: 75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, thereby producing said plant or part thereof comprising at least one cell having a mutation in said endogenous NAC7 gene.

62. A method for producing a plant or part thereof comprising a mutated endogenous NAC7 gene and exhibiting increased flower number, increased floral structure size and / or increased ear length, the method comprising contacting a target site in an endogenous NAC7 gene in the plant or plant part with a nuclease comprising a cleavage domain and a nucleic acid binding domain, wherein the nucleic acid binding domain binds to the target site in the endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region that is at least 80% identical to any one of SEQ ID NOs: 75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, thereby producing said plant or part thereof comprising an endogenous NAC7 gene having a mutation and exhibiting increased flower number, increased floral structure size and / or increased ear length.

63. The method of any one of claims 59 to 62, wherein the nuclease cleaves the endogenous NAC7 gene, thereby introducing the mutation into the endogenous NAC7 gene.

64. The method of any one of claims 59 to 63, wherein the mutation is a non-natural mutation.

65. The method of any one of claims 59 to 64, wherein the mutation is a substitution, insertion and / or deletion.

66. The method of any one of claims 59 to 65, wherein the mutation is a dominant negative mutation.

67. The method of any one of claims 59 to 66, wherein the mutation is a substitution, insertion and / or deletion.

68. The method of any one of claims 59 to 67, wherein the mutation comprises a point mutation.

69. The method of any one of claims 59 to 68, wherein the mutation is an insertion of about one base pair to about 100 base pairs.

70. The method of any one of claims 59 to 69, wherein the mutation is a deletion of one base pair to about 100 base pairs.

71. The method of any one of claims 59 to 70, wherein the mutation is an out-of-frame insertion or out-of-frame deletion resulting in a premature stop codon.

72. The method of any one of claims 59 to 71, wherein the mutation results in a mutated NAC7 gene producing a mutated NAC7 domain-containing transcription factor polypeptide, optionally wherein the mutated NAC7 domain-containing transcription factor polypeptide is truncated at its C-terminus.

73. The method of claim 72, wherein the mutated NAC7 domain-containing transcription factor polypeptide comprises a C-terminal truncation of from one amino acid residue to about 198 consecutive amino acid residues, optionally a C-terminal truncation of from about 25 consecutive amino acid residues to about 198 consecutive amino acid residues.

74. The method of claim 72 or claim 73, wherein the mutated NAC7 gene comprises a mutated nucleotide sequence as described herein.

75. The method of any one of claims 59 to 74, wherein the nuclease is a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an endonuclease, or a CRISPR-Cas effector protein.

76. The method of any one of claims 59 to 75, wherein the nucleic acid binding domain is a zinc finger, a transcription activator-like DNA binding domain (TAL), an argonaute, or a CRISPR-Cas effector DNA binding domain.

77. The method of any one of claims 59 to 76, wherein the mutation results in a mutated NAC7 gene having at least 90% sequence identity to any one of SEQ ID NOs: 105, 108, 110, 114 or 117, and / or encoding a mutated NAC7 polypeptide having at least 90% sequence identity to any one of SEQ ID NOs: 106, 109, 111, 115 or 118.

78. A plant produced by any one of the methods of claims 59 to 77.

79. A guide nucleic acid that binds to a target site in a NAC7 gene, wherein the target site is located within a region of the NAC7 gene that has at least 80% sequence identity to any one of SEQ ID NOs: 75-98, and / or encodes an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO:

103.

80. The guide nucleic acid of claim 79, wherein the guide nucleic acid comprises a spacer comprising the nucleotide sequence of any one of SEQ ID NOs: 99-101.

81. A system comprising the guide nucleic acid of claim 79 or claim 80 and a CRISPR-Cas effector protein associated with the guide nucleic acid.

82. The system of claim 81 , further comprising a tracr nucleic acid associated with the guide nucleic acid and a CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

83. A gene editing system comprising a CRISPR-Cas effector protein associated with a guide nucleic acid, wherein the guide nucleic acid comprises a spacer sequence that binds to an endogenous NAC7 gene.

84. The gene editing system of claim 83, wherein the NAC7 gene: (a) comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region that is at least 80% identical to any one of SEQ ID NOs: 75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:102 or SEQ ID NO:

103.

85. The gene editing system of claim 83 or 84, wherein the guide nucleic acid comprises a spacer sequence comprising a nucleotide sequence of any one of SEQ ID NOs: 98-101.

86. The gene editing system of any one of claims 83 to 85, further comprising a tracr nucleic acid associated with the guide nucleic acid and a CRISPR-Cas effector protein, optionally wherein the tracr nucleic acid and the guide nucleic acid are covalently linked.

87. A complex comprising a guide nucleic acid and a CRISPR-Cas effector protein comprising a cleavage domain, wherein the guide nucleic acid binds to a target site in an endogenous NAC7 gene, wherein the endogenous NAC7 gene: (a) comprising a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:72 or SEQ ID NO:73; (b) comprising a region that is at least 80% identical to any one of SEQ ID NOs: 75-98; (c) encodes an amino acid sequence having at least 80% sequence identity to SEQ ID NO:74; and / or (d) encoding a region having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, and the cleavage domain cleaves the target strand in the NAC7 gene.

88. An expression cassette comprising (a) a polynucleotide encoding a CRISPR-Cas effector protein comprising a cleavage domain and (b) a guide nucleic acid that binds to a target site in an endogenous NAC7 gene, wherein the guide nucleic acid comprises a spacer sequence that is complementary to and binds to: (i) a portion of a nucleic acid having at least 80% sequence identity to SEQ ID NO:72 or SEQ ID NO:73; (ii) a portion of a nucleic acid having at least 80% sequence identity to any one of SEQ ID NOs: 75-98; (iii) a portion of a nucleic acid encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 74, and / or (iv) a portion of a nucleic acid encoding an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 102 or SEQ ID NO:

103.

89. A corn plant or plant part thereof comprising at least one mutation in at least one endogenous NAC7 gene having a gene identification number (Gene ID) of GRMZM2G114850.

90. A guide nucleic acid that binds to a target nucleic acid in the NAC7 gene having a gene identification number (gene ID) of GRMZM2G114850.

91. A method of producing a plant comprising a mutation in an endogenous NAC7 gene and at least one polynucleotide of interest, the method comprising: hybridizing a first plant that is a plant of any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89 with a second plant comprising the at least one polynucleotide of interest to produce progeny plants; and Progeny plants are selected that comprise said mutation in said NAC7 gene and said at least one polynucleotide of interest, thereby producing said plant comprising a mutation in an endogenous NAC7 gene and at least one polynucleotide of interest.

92. A method of producing a plant comprising a mutation in an endogenous NAC7 gene and at least one polynucleotide of interest, the method comprising: Introducing at least one polynucleotide of interest into a plant as claimed in any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89, thereby producing a plant comprising a mutation in the NAC7 gene and at least one polynucleotide of interest.

93. A method of producing a plant comprising a mutation in an endogenous NAC7 gene and exhibiting a phenotype of improved yield traits, improved plant architecture and / or improved defense traits, the method comprising: Crossing a first plant that is a plant as claimed in any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89 with a second plant that exhibits a phenotype of improved yield traits, improved plant architecture and / or improved defense traits; and selecting progeny plants comprising said mutation in said NAC7 gene and having a phenotype of improved yield trait, improved plant architecture and / or improved defense trait, thereby producing said plants comprising a mutation in an endogenous NAC7 gene and exhibiting a phenotype of improved yield trait, improved plant architecture and / or improved defense trait compared to control plants.

94. A method of controlling weeds in a container (e.g., pots or seed trays, etc.), a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside, the method comprising: Applying a herbicide to one or more (a large number of) plants as described in any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89 growing in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn or a roadside, thereby controlling the weeds in the container, the growth chamber, the greenhouse, the field, the recreational area, the lawn or the roadside where the one or more plants are growing.

95. A method of reducing insect predation on a plant, the method comprising applying an insecticide to one or more plants of any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89, thereby reducing insect predation on the one or more plants.

96. A method of reducing fungal diseases on plants, the method comprising applying a fungicide to one or more plants of any one of claims 1 to 21, 26 to 28, 40 or 41, 78 or 89, thereby reducing fungal diseases on the one or more plants.

97. The method of claim 95 or claim 96, wherein the one or more plants are grown in a container, a growth chamber, a greenhouse, a field, a recreational area, a lawn, or a roadside.

98. The method of any one of claims 91 to 97, wherein the polynucleotide of interest is a polynucleotide that confers herbicide tolerance, insect resistance, disease resistance, increased yield, increased nutrient use efficiency, or abiotic stress resistance.

Images