Method for synthesizing dornase nanomaterials for treating tumors while maintaining fertility

By designing DNAzymes with APE1 control sites to form nanocomposites with hemoglobin and ferrous ions, and combining this with ultrasound-mediated synthesis, the problems of penetration and stability of DNAzymes in in vivo tumor therapy were solved, achieving the effects of targeted tumor therapy and fertility maintenance.

CN119280398BActive Publication Date: 2026-04-24GUANGXI MEDICAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411411370.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-10
Publication Date
2026-04-24
Estimated Expiration
2044-10-10

AI Technical Summary

Technical Problem

The application of DNAzymes in in vivo tumor therapy is limited by poor cell membrane penetration and biological environmental instability, as well as poor targeting, resulting in low treatment precision and difficulty in achieving effective targeted therapy for tumors, while also affecting fertility.

Method used

A DNAzyme with an APE1 control site was designed to form a nanocomposite with hemoglobin and ferrous ions. Through the dissociation of APE1 in cells with high expression, combined with ultrasound-mediated targeting, tumor-targeted therapy can be achieved, while remaining inactive in normal cells.

Benefits of technology

It achieves effective dissociation in tumor cells with high APE1 expression, enabling targeted therapy, protecting reproductive organs, realizing spatiotemporally controllable combined therapy, avoiding damage to reproductive organs, and improving the precision of tumor treatment and fertility maintenance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119280398B_ABST
    Figure CN119280398B_ABST
Patent Text Reader

Abstract

The present application relates to a DNAzyme nanomaterial synthesis method for treating tumors while maintaining fertility, which first synthesizes DNAzyme with an APE1 enzyme site, then mixes it with hemoglobin, a divalent iron solution and deionized water, forms a nanocomposite through vortexing, centrifuging and washing, and uses tannic acid to achieve encapsulation and preservation during synthesis. The novel nanocomposite synthesized by the present application can dissociate and play a role in tumor cells with high APE1 expression, but not in normal cells, achieving targeted treatment and effectively protecting reproductive organs; at the same time, the novel nanocomposite synthesized through ultrasonic and enzyme double control activation can achieve spatiotemporal controllable combined treatment of tumors, is used for tumor treatment while maintaining fertility, and avoids damage to reproductive organs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility. Background Technology

[0002] DNAzymes are short DNA oligomers that have become promising tools for gene regulation in disease treatment due to their high catalytic efficiency and specificity.

[0003] DNAzymes, photochemically integrated into DNA nanostructures via cleavage linkers, have been reported for optical control of gene regulatory activity. While these photoactivation strategies offer spatiotemporal control of DNAzyme activity, their in vivo application is hampered by the shallow tissue penetration of light. In contrast, endogenous enzymes exhibit promising triggering mechanisms due to their high catalytic efficiency, substrate selectivity, and spatial overexpression in many diseased cells. Recently, enzyme reaction elements have been incorporated into DNAzyme design to develop strategies for conditionally modulating their catalytic activity in response to specific enzyme triggering. Despite these advances, the application of enzyme-activated DNAzyme systems in in vivo tumor therapy remains challenging due to the lack of reliable engineering methods.

[0004] Sonodynamic therapy (SDT) is an emerging treatment method that uses low-intensity ultrasound (US) to activate a sonosensitive agent within cancerous areas, generating reactive oxygen species (ROS) to eradicate tumor cells, thus providing a highly controllable approach to cancer treatment. The advantages of US include minimal invasiveness, fewer side effects, and tissue penetration far exceeding that of light (>10 cm), making SDT a promising treatment method. Therefore, various sonosensitive agents, from organic molecules to inorganic nanoparticles, have been explored to improve sonodynamic efficiency.

[0005] Auracil-free / pyrimidine-free endonuclease 1 (APE1) plays a crucial role in the base excision repair pathway, responsible for cleaving basic (AP) sites to promote DNA damage repair. Current research has demonstrated that using APE1 as a trigger for designing enzymes to activate DNA systems enables selective molecular imaging and treatment of diseased cells.

[0006] Hemoglobin (Hb) is a natural biomolecule with four heme groups. Due to its superior acoustic efficiency, water solubility and biocompatibility, it surpasses traditional organic acoustic sensitizers and therefore has significant advantages as an acoustic sensitizer.

[0007] The therapeutic applications of DNAzymes are limited by poor cell membrane permeability and the instability of the biological environment, necessitating the use of nanocarriers for efficient intracellular delivery. Furthermore, target RNA molecules degraded by DNAzymes are often expressed in both cancer and normal cells, leading to targeted non-tumor effects and reduced therapeutic precision. To address this issue, researchers have attempted to develop stimulus-response strategies to achieve spatiotemporal control of DNAzyme activity, but their anti-tumor effects have fallen far short of expectations. Therefore, controlling the co-delivery of sonosensitive agents with other therapeutic agents is crucial for advancing next-generation SDT systems. Summary of the Invention

[0008] To address the aforementioned technical issues, this application designs a DNAzyme targeting survivin with an APE1 control site, which combines with hemoglobin and ferrous ions to form a nanocomplex. This enables the DNAzyme to release the AP site in cells with high APE1 expression, achieving targeted tumor therapy under ultrasound guidance without affecting fertility maintenance after tumor treatment.

[0009] To achieve the above objectives, this application aims to provide a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, the method comprising:

[0010] Step S1: Synthesize a DNAzyme (AP-DZ) containing the APE1 enzyme site;

[0011] Step S2: Mix AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube;

[0012] Step S3: Vortex the mixed solution obtained in step S1 and then place it in a metal constant temperature heater for reaction.

[0013] Step S4: Vortex the reacted solution again and then centrifuge it.

[0014] Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube;

[0015] Step S6: After adding deionized water to the collection tube, perform a third vortex treatment;

[0016] Step S7: After vortex treatment, FeCl3·6H2O is added to the tube for a fourth vortex treatment;

[0017] Step S8: After washing twice, the DNA nanomaterials are stored at 4°C for later use.

[0018] Furthermore, in step S2, the amount of each 100 μL of solution used is 15 μL of LAP-DZ (concentration of 100 μM), 10 μL of hemoglobin (concentration of 1 mg / ml), 3 μL of ferrous iron solution (concentration of 4 mg / ml), and 72 μL of deionized water.

[0019] Furthermore, in step S3, the vortex treatment time is 10 seconds, the metal constant temperature heater used needs to be preheated to 95°C, and the reaction time is 2 hours.

[0020] Furthermore, in step S4, the vortex treatment time is 5 seconds, the centrifugation conditions are 13,000 revolutions per minute, and the centrifugation treatment time is 10 minutes.

[0021] Furthermore, in step S6, the amount of deionized water used is 100 μL, the vortex time is 10 s, and 5 μL of TA (concentration of 4 mg / ml) is added under vortex conditions.

[0022] Furthermore, in step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the amount used is 5 μL, and the vortexing time is 30 s.

[0023] Furthermore, the washing process in step S8 includes the following steps:

[0024] Step S81: After centrifuging the solution, add deionized water;

[0025] Step S82: Perform vortex processing.

[0026] Furthermore, in step S81, the centrifugation conditions are 13,000 rpm, the centrifugation time is 3 min, the amount of deionized water used is 100 μL, and the vortexing time in step S82 is 10 s.

[0027] Furthermore, the hydrated size of the DNA nanomaterial is 143 nm to 163 nm.

[0028] Furthermore, the DNA nanomaterials are used in the preparation of drugs for tumor treatment.

[0029] Compared with existing technologies, the advantages and effects of this application are as follows:

[0030] 1. The present invention relates to a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility. The DNA nanomaterial ADH@TA can dissociate and function in tumor cells with high APE1 expression, but does not function in normal cells, thereby achieving targeted therapy and effectively protecting reproductive organs.

[0031] 2. The present invention provides a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, which enables spatiotemporally controllable combined treatment of tumors and is used for maintaining fertility during tumor treatment.

[0032] 3. The present invention provides a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, wherein tumor killing is further mediated by ultrasound, enabling ultrasound to be applied to the tumor site while avoiding damage to reproductive organs.

[0033] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the preferred embodiments of this application are described in detail below with reference to the accompanying drawings.

[0034] The above and other objects, advantages and features of this application will become more apparent to those skilled in the art from the following detailed description of specific embodiments in conjunction with the accompanying drawings. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0036] in:

[0037] Figure 1 (a) Design of enzyme-activated DNAzyme (En-Dz); (b) Schematic diagram of the synthesis of ADH@TA nanohybrids; (c) Working principle of spatiotemporally controllable ADH@TA combined with tumor therapy;

[0038] Figure 2 (a) Schematic diagram of the interaction between En-Dz and target mRNA; (b) Schematic diagram of ape1-induced En-Dz release of Dz; (c) Time-dependent fluorescence response of FRET to labeled En-Dz to APE1 (detection intensity at 675 nm); (d) PAGE analysis of ape1-mediated En-Dz activation; (e) Schematic diagram showing that ape1 can activate En-Dz to cleave mRNA; (f) Fluorescence intensity of FRET to labeled survivin mRNA for En-Dz and APE1 in the presence of Mg2+. Data are expressed as mean ± SD (n = 3).

[0039] Figure 3 En-Dz performed PAGE analysis on ape1-activated mRNA;

[0040] Figure 4 (a) Urea PAGE analysis; (b) The amount of ape1-activated mRNA cleaved by En-Dz under different concentrations of Mg²⁺ after 4 hours of incubation. Data are expressed as mean ± SD (n = 3).

[0041] Figure 5 (a) Urea PAGE analysis; (b) Lysis kinetics of ape1-activated mRNA at different incubation times with En-Dz at 1 mg / mL. Data are expressed as mean ± SD (n = 3).

[0042] Figure 6 (a) TEM image of ADH, scale bar 200; (b) TEM image of ADH, scale bar 100 nm; (c) EDS-mapped image of ADH, scale bar 100 nm; (d) TEM image of ADH@TA, scale bar 100 nm; (e) DLS analysis of ADH and ADH@TA; (f) Sonication of DPBF at different times (1 MHz, 50% duty cycle, 1 W cm⁻²); (g) Absorption intensity of DPBF at 416 nm after irradiation of ADH@TA or ADB@TA at different times. Data are expressed as mean ± SD (n = 3); (h) ESR spectrum of ROS generated by ADH@TA or ADB@TA after 10 min of sonication; (i) Fluorescence spectrum of released En-Dz in response to APE1 (labeled with FRET pairs); (j) Fluorescence spectrum of FRET-labeled mRNA in response to ADH@TA or ADH@TA+APE1.

[0043] Figure 7 (a) HAADF-STEM image; (b) EDS line scan analysis of the corresponding ADH, scale bar 100 nm;

[0044] Figure 8 (a) TEM images of ADH in HO2 after different incubation times; (b) TEM images of ADH in PBS after different incubation times; (c) TEM images of ADH@TA in PBS after different incubation times, scale bar 100 nm;

[0045] Figure 9 ADHZeta potential and ADH@TA. Data are expressed as mean ± sd (n = 3);

[0046] Figure 10(a) Iron release from ADH@TA in En-Dz; (b) Iron release from ADH@TA in PBS; Data are expressed as mean ± sd (n = 3);

[0047] Figure 11 (a) High-resolution 2p XPS spectrum of iron measured by XPS; (b) High-resolution 2p XPS spectrum of iron in ADH@TA;

[0048] Figure 12 Absorption intensity of DPBF at 416 nm in the presence of ADH@TA under ultrasound at different power levels. Data are expressed as mean ± sd (n = 3).

[0049] Figure 13 Detection of ROS generation in ADH@TA under ultrasound at different time points using green fluorescence spectroscopy with a singlet oxygen sensor;

[0050] Figure 14 FRET only responds to the fluorescence spectrum of APE1 for labeled mRNA;

[0051] Figure 15 Confocal fluorescence images of MCF-7 cells treated with Cy5- and Rodb-labeled ADH@TA, Cy5-labeled free En-Dz, or Rodb-labeled free Hb. Scale bar: 20 μm;

[0052] Figure 16 (a) Confocal fluorescence image; (b) Flow cytometry quantification of MCF-7 cells treated with FRET-paired labeled ADH@TA or nADH@TA, with or without sonication (1.0 MHz, 50% duty cycle, 0.4 W cm⁻², 5 min). Scale bar: 50 μm. Data are expressed as mean ± SD (n = 3); (c) Confocal fluorescence image; (d) Confocal fluorescence images of MCF-7 and L-02 cells after ADH@TA treatment (with or without sonication). Scale bar: 50 μm; (e) Flow cytometry analysis of MCF-7 cells incubated with dcfh-da and treated with the indicated method. Scale bar: 200 μm;

[0053] Figure 17 (a) Colocalization fluorescence images of MCF-7 cells treated with cy5-labeled ADH@TA and lysosomal trackers with and without ultrasound irradiation. Scale bar: 20 μm; (b) Western blot analysis; (c) Quantification of APE1 in the cytoplasm of MCF-7 cells under different treatments. Data are expressed as mean ± SD (n = 3). **P < 0.01, ***P < 0.001, ns, not significant;

[0054] Figure 18Flow cytometry analysis of MCF-7 with or without ultrasound irradiation using ADH@TA or nADH@TA;

[0055] Figure 19 Flow cytometry was used to quantify MCF-7 and L-02 cells with or without ADH@TA irradiation. Data are expressed as mean ± sd (n = 3). ***P < 0.001, ****P < 0.0001;

[0056] Figure 20 (a) Western blot analysis; (b) Quantitative analysis of APE1 in the cytoplasm of L-02, MCF-7, and PC-3 cells. Data are expressed as mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01;

[0057] Figure 21 MCF-7 cells were quantified by flow cytometry using DCFH-DA staining and treated with PBS, ADH@TA, or ADB@TA, with or without sonication. Data are expressed as mean ± SD (n = 3).

[0058] Figure 22 (a) RT-qPCR analysis of survivin mRNA in MCF-7 cells after different treatments. Data are expressed as mean ± SD (n = 3); (b) Western blot analysis of survivin protein levels in MCF-7 cells after different treatments; (c) Confocal fluorescence images of MCF-7 cells treated with JC-1 probe and ADH@TA, with or without ultrasound irradiation, scale bar 100 μm; (d) Cell viability of MCF-7 cells after different treatments, conditions: 1.0 MHz, 50% duty cycle, 1.5 W cm⁻², 5 min. Data are expressed as mean ± SD (n = 3); (e) Cell viability of MCF-7 and L-02 cells irradiated with different concentrations of ADH@TA. Data are expressed as mean ± SD (n = 3); (f) Flow cytometry analysis of Annexin V / PI staining in MCF-7 cells after different treatments; (g) Confocal fluorescence images of MCF-7 cells stained with Calcein-AM / PI after different treatments. The scale bar is 200 μm. ***P<0.05, P<0.01, ***P<0.001, ns not significant;

[0059] Figure 23 The fluorescence intensity ratio (green / red) of JC-1 monomers to aggregates in the corresponding confocal fluorescence images is expressed as mean ± sd (n = 50). ****P < 0.0001, ns, not significant;

[0060] Figure 24ATP content in MCF-7 cells under PBS, ADH@TA, or ADH@TA+US treatment conditions. Data are expressed as mean ± sd (n = 3). ****P < 0.0001, ns not significant;

[0061] Figure 25 Cell viability of MCF-7 cells treated with different concentrations of AcDH@TA. Data are expressed as mean ± sd (n = 3), Ns, not significant;

[0062] Figure 26 Flow cytometry analysis of L-02 cells and Annexin V / PI stained MCF-7 cells after ADH@TA+US treatment;

[0063] Figure 27 : Clone formation of MCF-7 cells under different treatments;

[0064] Figure 28 Pharmacokinetic studies of intravenous injection of free En-Dz and ADH@TA (En-Dz labeled with Cy5 only) in mice. Data are expressed as mean ± sd (n = 3).

[0065] Figure 29 (a) Fluorescence images of MCF-7 tumor-bearing mice at different time points after intratumoral injection of FRET-paired labeled ADH@TA or nADH@TA, with or without ultrasound irradiation (1.0 MHz, 50% duty cycle, 1.5 W cm⁻², 5 min); (b) Quantitative analysis of intratumoral fluorescence intensity as shown in Figure (a). Data are expressed as mean ± SD (n = 5); (c) Relative fluorescence intensity at the tumor site. Data are expressed as mean ± SD (n = 5); (d) Ex vivo fluorescence images; (e) Quantitative fluorescence analysis of tumors in different groups of mice. Data are expressed as mean ± SD (n = 5). ***P<0.05, P<0.01, ***P<0.001, ****P<0.0001, ns, not significant;

[0066] Figure 30 (a) Schematic diagram of in vivo treatment regimens; (b) Changes in tumor volume in MCF-7 (breast cancer) tumor-bearing mice after different treatments. Data are expressed as mean ± SD (n = 5); (c) Individual tumor growth curves during PBS treatment; (d) Individual tumor growth curves during US treatment; (e) Individual tumor growth curves during AcDH@TA treatment;

[0067] Figure 31(a) Individual tumor growth curves during ADH@TA treatment; (b) Individual tumor growth curves during nADH@TA+US treatment; (c) Individual tumor growth curves during AcDH@TA+US treatment; (d) Individual tumor growth curves during ADH@TA+US treatment (n=5). Ultrasound conditions: 1.0MHz, 50% duty cycle, 1.5Wcm⁻², 5min; (e) Mouse body weight curves under different treatments, data expressed as mean ± SD (n=5); (f) Tumor weight measurements;

[0068] Figure 32 (a) Photographs of tumors harvested from different treatment groups. Data are expressed as mean ± sd (n = 5); (b) H&E staining; (c) TUNEL staining of tumor sections treated with different combinations, scale bar 50 μm. ***P<0.05, P<0.01, ***P<0.001, ****P<0.0001, ns, not significant;

[0069] Figure 33 Immunohistochemical staining of Survivin protein in mouse tumor tissues after 14 days of different treatments, scale bar: 100 μm;

[0070] Figure 34 Biochemical parameters of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein (TP), albumin (ALB), alkaline phosphatase (ALP), glucose (GLU), blood urea nitrogen (BUN), cholesterol (CHOL), creatine kinase (CK), and globulin (GLOB) in the blood of mice treated with PSB and ADH@TA were measured. Data are expressed as mean ± SD (n = 3).

[0071] Figure 35 H&E staining of heart, liver, spleen, lung and kidney sections after PBS or ADH@TA treatment, scale bar 100 μm;

[0072] Figure 36 (a) RT-qPCR analysis of survivin mRNA in mouse hearts after treatment with PBS and ADH@TA; (b) RT-qPCR analysis of survivin mRNA in mouse livers after treatment with PBS and ADH@TA; (c) RT-qPCR analysis of survivin mRNA in mouse spleens after treatment with PBS and ADH@TA; (d) RT-qPCR analysis of survivin mRNA in mouse lungs after treatment with PBS and ADH@TA; (e) RT-qPCR analysis of survivin mRNA in mouse kidneys after treatment with PBS and ADH@TA. Data are expressed as mean ± SD (n = 3).

[0073] Figure 37 (a) Changes in tumor volume in PC-3 tumor-bearing mice after different treatments. Data are expressed as mean ± SD (n = 5); (b) Individual tumor growth curves during PBS treatment; (c) Individual tumor growth curves during US treatment; (d) Individual tumor growth curves during AcDH@TA treatment; (e) Individual tumor growth curves during ADH@TA treatment; (f)

[0074] Individual tumor growth curves during nADH@TA+US treatment;

[0075] Figure 38 (a) Individual tumor growth curves during AcDH@TA+US treatment; (b) Individual tumor growth curves during ADH@TA+US treatment. (n=5). Ultrasound conditions: 1.0MHz, 50% duty cycle, 1.5Wcm⁻², 5min; (c) Mouse body weight curves under different treatments. Data are expressed as mean ± SD (n=5); (d) Tumor weight measurements; (e) Corresponding photographs of tumors harvested from different treatment groups. Data are expressed as mean ± SD (n=5). ***P<0.001, ****P<0.0001, ns, not significant; Specific Implementation

[0076] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. In the following description, specific details such as specific configurations and components are provided merely to help fully understand the embodiments of this application. Therefore, those skilled in the art should understand that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of this application. In addition, for clarity and brevity, descriptions of known functions and structures are omitted in the embodiments.

[0077] It should be understood that the phrase "an embodiment" or "this embodiment" throughout the specification means that a specific feature, structure, or characteristic related to the embodiment is included in at least one embodiment of this application. Therefore, "an embodiment" or "this embodiment" appearing throughout the specification does not necessarily refer to the same embodiment. Furthermore, these specific features, structures, or characteristics can be combined in any suitable manner in one or more embodiments.

[0078] Furthermore, reference numerals and / or letters may be repeated in different examples within this application. Such repetition is for the purpose of simplification and clarity and does not in itself indicate a relationship between the various embodiments and / or settings discussed.

[0079] In this article, the term "and / or" is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, B exists alone, and A and B exist simultaneously. The term " / and" describes another type of relationship between related objects, indicating that two relationships can exist. For example, A / and B can mean: A exists alone, and A and B exist alone. In addition, the character " / " in this article generally indicates that the related objects before and after it have an "or" relationship.

[0080] In this article, the term "at least one" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, "at least one of A and B" can mean: A exists alone, A and B exist simultaneously, or B exists alone.

[0081] It should also be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion.

[0082] Example 1

[0083] This embodiment discloses a method for synthesizing DNA enzyme nanomaterials for tumor treatment and fertility maintenance. Please refer to [link to relevant documentation]. Figure 1 (b) The preparation method includes:

[0084] Step S1: Synthesize a DNAzyme (AP-DZ) containing the APE1 enzyme site;

[0085] Step S2: Mix AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube;

[0086] Step S3: Vortex the mixed solution obtained in step S1 and then place it in a metal constant temperature heater for reaction.

[0087] Step S4: Vortex the reacted solution again and then centrifuge it.

[0088] Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube;

[0089] Step S6: After adding deionized water to the collection tube, perform a third vortex treatment;

[0090] Step S7: After vortex treatment, FeCl3·6H2O is added to the tube for a fourth vortex treatment;

[0091] Step S8: After washing twice, the DNA nanomaterials are stored at 4°C for later use.

[0092] Furthermore, in step S2, the amount of each 100 μL of solution used is 15 μL of LAP-DZ (concentration of 100 μM), 10 μL of hemoglobin (concentration of 1 mg / ml), 3 μL of ferrous iron solution (concentration of 4 mg / ml), and 72 μL of deionized water.

[0093] Furthermore, in step S3, the vortex treatment time is 10 seconds, the metal constant temperature heater used needs to be preheated to 95°C, and the reaction time is 2 hours.

[0094] Furthermore, in step S4, the vortex treatment time is 5 seconds, the centrifugation conditions are 13,000 revolutions per minute, and the centrifugation treatment time is 10 minutes.

[0095] Furthermore, in step S6, the amount of deionized water used is 100 μL, the vortex time is 10 s, and 5 μL of TA (concentration of 4 mg / ml) is added under vortex conditions.

[0096] Furthermore, in step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the amount used is 5 μL, and the vortexing time is 30 s.

[0097] Furthermore, the washing process in step S8 includes the following steps:

[0098] Step S81: After centrifuging the solution, add deionized water;

[0099] Step S82: Perform vortex processing.

[0100] Furthermore, in step S81, the centrifugation conditions are 13,000 rpm, the centrifugation time is 3 min, the amount of deionized water used is 100 μL, and the vortexing time in step S82 is 10 s.

[0101] Furthermore, all the vortex processing operations involve placing the tube containing the mixed suspension on a vortex mixer for vortex mixing.

[0102] Furthermore, the hydrated size of the DNA nanomaterial is 143 nm to 163 nm.

[0103] Furthermore, the application of the aforementioned DNA nanomaterials in the preparation of drugs for tumor treatment.

[0104] The DNA nanomaterial ADH@TA synthesized in this embodiment can dissociate and exert its function in tumor cells with high APE1 expression, but has no function in normal cells, thus achieving targeted therapy and effectively protecting reproductive organs.

[0105] Example 2

[0106] Based on Example 1, this example introduces the design and evaluation of En-Dz. Please refer to Example 1. Figure 1 (a).

[0107] The En-Dz design includes:

[0108] The DNAzyme sequence was designed as (SEQ ID NO.1):

[0109] CCTCGGCCAGGCTAGCTACAACGACCGCTCCCGCCACATAAGGCGTGGAGCG.

[0110] APE1-activated DNAzyme (AP-DZ) design: 5'-C*C*T CGG CCA GGC TAG CTA CAA CGA CCGCTC CX CGCC ACA TAA GGCG T GGA GCG-3';

[0111] DNAzyme with Cy5 / BHQ2: 5'-C*C*T CGG CCA GGC TAG CTA CAA CGA CCG C / BHQ2 / TC C XCGCC ACA TAA GGCG T GGA GCG / Cy5 -3';

[0112] DNAzyme without AP site: 5'-C*C*T CGG CCA GGC TAG CTA CAA CGA CCGCTCCC CGCC ACA TAA GGCG T GGA GCG-3';

[0113] cDNAzyme: 5'-C*C*T CGG CCA GGC TAC CTA CAA CGA CCG CTC CX CGCC ACATAA GGCG T GGA GCG-3';

[0114] sruvivin mRNA substrate: 5'-CC CCG GAG CGG AU GGC CGA GGC UGG-3';

[0115] sruvivin mRNA substrate with Cy3 / BHQ2: 5'-CC CCG GAG / Cy3 / CGG AU GGCCGA GGC UGG / BHQ2 -3';

[0116] Notes: "X" represents the APE1 cleavage site, generally represented by X; Cy5: Cy5 modified fluorescence; DNAzyme without AP site: without APE1 site; cDNAzyme: DNAzyme of mutant strand, which does not play a cleavage role and is used for comparison.

[0117] This embodiment uses Cy5 fluorescence-based analysis to verify the enzyme-induced activation of En-Dz.

[0118] En-Dz uses a Cy5 fluorophore to label the middle of the DNAzyme strand and a BHQ2 quencher to label the 5' end of the blocking strand. Because... Resonant energy transfer (FRET) produces low background fluorescence. For example... Figure 2 As shown in Figure a, the addition of the survivin mRNA substrate did not increase fluorescence, indicating that the mRNA target could not disrupt the stable hairpin structure, thus confirming the successful construction of the inactivated En-Dz. After adding APE1, the fluorescence signal of En-Dz increased by approximately 7.0-fold (…). Figure 2 (As shown by the red line in b), indicating that Dz is released due to AP site cleavage. Time-dependent fluorescence spectroscopy shows a rapid response of FRET to labeled En-Dz to APE1 ( Figure 2 c) provides further evidence for effective enzyme activation.

[0119] Furthermore, polyacrylamide gel electrophoresis (PAGE) analysis confirmed the activation effect of APE1 on En-Dz. Figure 2 As shown in Figure d, En-Dz was cleaved into two strands in the presence of APE1, one of which was identified as Dz. In contrast, the control system (En-Dz), which had the same sequence as En-Dz but lacked the AP site, did not respond to APE1, further validating the enzyme activation mechanism. Next, we investigated the APE1-activated En-Dz RNA cleavage activity by labeling the survivin mRNA substrate with a Cy3 fluorophore and a BHQ2 quencher at the 5' end. Enhanced fluorophore signal was observed after DNAzyme-mediated cleavage. Figure 2 e). For example Figure 2 As shown in f, in the absence of APE1 activation, the fluorescence intensity did not increase significantly after the addition of En-Dz. Figure 2 The fluorescence (shown in orange) indicates that the catalytic gene cleavage activity of DNAzyme is inhibited. Conversely, the addition of APE1 and En-Dz significantly enhanced the fluorescence by approximately two times. Figure 2 (shown in green), indicating that APE1 activation successfully restored the RNA cleavage function of En-Dz. PAGE analysis further confirmed these findings. Figure 3 ).

[0120] Furthermore, En-Dz exhibited a Mg2+ concentration-dependent mRNA cleavage effect, with approximately 80% of the mRNA cleaved at 1 mM Mg after 24 hours of reaction. Figure 4 This indicates its potential for gene regulation. Time-dependent assessment showed that the observed rate constant (K) was 0.009 min⁻¹. Figure 5 ).

[0121] The En-Dz designed in this embodiment has strong potential for gene regulation.

[0122] Example 3

[0123] Based on Example 1, this example describes the synthesis and characterization of ADH@TA:

[0124] DNAzyme-Hb nanohybrids (ADH) are synthesized via a coordination-driven self-assembly method through coordination interactions between metal ions and phosphate groups, nitrogen atoms, and oxygen atoms on DNA and proteins. In a typical process, En-Dz, Hb, and Fe(II) are incubated at an appropriate temperature for 2 hours, followed by centrifugation to collect the final product. Transmission electron microscopy (TEM) images ( Figure 6 (a) and (6b) show that the obtained nanohybrids have a spherical morphology with a uniform size distribution. Energy dispersive X-ray spectroscopy (EDS) images ( Figure 6 c) and line scan analysis ( Figure 7 The uniform distribution of signals from iron, phosphorus (from DNA), and sulfur (from protein) indicates successful encapsulation of En-Dz and Hb within the nanosystem. The loading efficiencies of En-Dz and Hb were calculated to be 89% and 46%, respectively. The ADH nanohybrid remained stable in water for at least 48 hours but disintegrated within 2 hours in PBS, due to disruption of phosphate-mediated coordination interactions between Fe(II) and DNA. Figure 8 Since metallophenol networks have been widely used to improve the stability of nanoparticles, a metallophenol network shell was coated onto ADH through the coordination interaction between Fe(III) and tannic acid (TA). Figure 6 d). The hydrated size of the resulting ADH@TA nanohybrids increased from 112 nm to 153 nm. Figure 6 e), the ζ potential change is minimal ( Figure 9 This surface coating significantly improves the stability of the nanohybrid in PBS, leading to the sustained release of En-Dz and metal ions. Figure 10 Furthermore, the high-resolution X-ray photoelectron spectroscopy (XPS) of Fe2p shows two peaks at 711.4 eV and 725.1 eV. Figure 11), corresponding to Fe2p and Fe2p respectively. The estimated proportions of Fe(II) and Fe(III) in ADH@TA are 57% and 43% on 3 / 21 / 2.

[0125] To evaluate the acoustic and dynamic performance of ADH@TA, 1,3-diphenylisobenzofuran (DPBF) was used as an indicator for detecting ROS generation. Figure 6 As shown in f, after adding ADH@TA to the DPBF solution, the absorbance of DPBF decreased significantly with increasing irradiation time, confirming the generation of ROS and thus confirming the sonodynamic effect of ADH@TA. As a control, bovine serum albumin (BSA) was used instead of Hb to synthesize nanohybrids (ADB@TA). When ultrasound was applied to the mixture of ADB@TA and DPBF, only a slight decrease in DPBF absorbance was observed, similar to the blank control (DPBF+US). Figure 6 g). In contrast, the ROS generation efficiency of the ADH@TA+US group was much higher, indicating that the acoustic dynamic effect of ADH@TA was mainly due to the Hb load. Furthermore, the ROS generation capacity of ADH@TA gradually increased with increasing ultrasonic power. Figure 12 The SDT potential is also quantized by electron spin resonance spectroscopy (…). Figure 6 h) and green measurement of singlet oxygen sensor ( Figure 13 This was confirmed. We further investigated the response of En-Dz released by ADH@TA to ape1 triggering. Figure 6 As shown in i, after adding APE1, the fluorescence intensity of FRET-labeled En-Dz increased by approximately 3.5 times, while the fluorescence intensity decreased by approximately 2 times compared to pure En-Dz. Figure 2 b). After incubation in ADH@TA, the addition of APE1 significantly increased the fluorescence intensity of FRET against the labeled target mRNA, while minimal fluorescence change was observed in the absence of APE1, confirming the enzymatic activation of RNA cleavage reactivity by the released En-Dz. Figure 6 j). It is worth noting that APE1 itself has no effect on the cleavage of RNA targets ( Figure 14 ).

[0126] The hydrated size of the ADH@TA nanohybrid obtained in this embodiment is 143nm to 163nm, and it has strong stability in PBS and also exhibits acoustic dynamic effects.

[0127] Example 4

[0128] Based on Examples 1-3, this example describes the dual-controlled activation of ADH@TA reaction using ultrasound and enzymes:

[0129] To visualize cellular uptake, En-Dz and Hb were labeled with Cy5 and Rhodamine B (RodB) fluorophores, respectively, and their presence in MCF-7 cells was observed using confocal microscopy. After 3 hours of ADH@TA incubation, MCF-7 cells showed distinct red and green fluorescence signals from Cy5 and RodB, respectively. Figure 15 In contrast, cells treated with free En-Dz and free Hb showed minimal fluorescence signals, indicating that ADH@TA significantly enhanced intracellular delivery of the two biomolecules.

[0130] Next, nanohybrids prepared by FRET-labeled En-Dz or En-Dz were incubated with MCF-7 cells for 3 hours, followed by sonication exposure. Figure 16 As shown in Figure a, compared with cells treated with nADH@TA (assembled from En-Dz), the ADH@TA group exhibited stronger fluorescence intensity, confirming APE1-mediated Dz release. Notably, ultrasound significantly enhanced the fluorescence intensity of ADH@TA-treated cells, while the signal change in the nADH@TA group was negligible. This ultrasound-mediated enhancement of ADH@TA-treated cell fluorescence intensity may be due to SDT inducing APE1 translocation from the nucleus to the cytoplasm, thereby increasing cytoplasmic APE1 levels and leading to more FRET-labeled En-Dz cleavage. Flow cytometry analysis showed that the fluorescence intensity of the ADH@TA+US group was 2.1-fold and 1.3-fold higher than that of the nADH@TA+US group and the unultrasounded ADH@TA group, respectively. Figure 16 b and Figure 18 Furthermore, compared to L-02 cells (a normal cell line with relatively low cytoplasmic APE1 expression), higher fluorescence signals were observed in MCF-7 cells after ADH@TA treatment. Figure 16 d and Figure 19 This indicates high selectivity of cancer cells, which is consistent with the overexpression of APE1 in the cytoplasm of MCF-7 cells. Figure 20 ).

[0131] Triggered intracellular ROS generation in ADH@TA cells was investigated using the fluorescent indicator 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Figure 16 As shown in Figure c, among all groups, ADH@TA-incubated cells exhibited the brightest fluorescence after sonication, indicating that US-mediated ADH@TA generated highly efficient ROS within the cells. The fluorescence intensity of the ADH@TA+US group was 14.3 times higher than that of the ADH@TA group. Figure 16 e and Figure 21In contrast, ADB@TA did not show significant intracellular sonodynamic effects upon exposure to ultrasound, confirming the key role of Hb as a sonosensitizer. Subsequently, LysoTracker green co-staining of cells was used to detect the endosome escape performance of the nanohybrids. After ADH@TA treatment, the red fluorescence signal of cy5-labeled En-Dz partially overlapped with the green fluorescence signal of the endosomes, with a Manders correlation coefficient (MCC) of 0.67 ± 0.05, indicating that the nanohybrids were mainly localized to endolysosomes. Figure 17 a). However, after ultrasound irradiation, the overlap between the two signals was significantly reduced, with an MCC value of 0.09 ± 0.04, indicating that most of the nanohybrids had escaped from the endosomes. This improved endosome escape is attributed to ROS-induced instability and rupture of the endosome membrane, promoting the efficient release of the nanosystem. Notably, the attenuation of the LysoTracker green fluorescence signal in ultrasound-treated cells may be due to ROS-induced endosome damage. Western blot analysis of cytoplasmic APE1 expression was performed. Figure 17 As shown in b and 17c, the cytoplasmic APE1 level in ADH@TA-treated cells showed negligible changes compared to the control group. In contrast, irradiation led to a 1.5-fold increase in cytoplasmic APE1 levels, likely due to Ros-induced oxidative stress, which promotes APE1 transport from the nucleus to the cytoplasm. Therefore, the gene regulatory activity of this system can be co-controlled by ultrasound and APE1, enhancing spatiotemporal precision. These findings highlight the potential of ADH@TA in spatiotemporally controlled tumor therapy through a dual mechanism involving triggering ROS production and enzyme-activated gene regulation.

[0132] This embodiment demonstrates that dual-controlled activation of ADH@TA by ultrasound and enzymes can improve spatiotemporal precision, thus showcasing its potential in spatiotemporally controlled tumor therapy.

[0133] Example 5

[0134] Based on Examples 1-4, this example introduces the dual-control gene regulation and in vitro therapeutic effects:

[0135] We used real-time quantitative polymerase chain reaction (RT-qPCR) to assess the regulation of surviving mRNA genes by ADH@TA in MCF-7 cells. Figure 22As shown in figure a, ADH@TA-treated cells showed a 67% reduction in survivin mRNA expression after ultrasound irradiation, indicating that the system effectively knocked out the mRNA. In contrast, the nADH@TA+US group showed the least change in mRNA expression, highlighting the important role of enzymatic cleavage in dnazyme-mediated gene regulation. However, ADH@TA-treated cells not exposed to ultrasound showed only a slight downregulation of survivin mRNA, emphasizing the significantly enhanced effect of sonodynamics on gene regulation.

[0136] As a control, cells treated with AcDH@TA (in which the catalytic core sequence of the DNAzyme is mutated, leading to loss of catalytic activity) and ultrasonic irradiation showed no significant change in mRNA levels. Western blot analysis of survivin protein levels further validated the controlled gene regulation ability of ADH@TA. Figure 22 b). Subsequently, the mitochondrial membrane potential was measured using the JC-1 probe. Figure 22 As shown in Figure c, compared with the control group, after ultrasound irradiation, ADH@TA-treated cells showed an increase in the green signal corresponding to JC-1 monomers and a decrease in the red signal corresponding to JC-1 aggregates, suggesting that ROS induces mitochondrial membrane damage. The green and red signals in the ADH@TA+US group were 4.1 times higher than those in the unirradiated ADH@TA group, indicating that the mitochondrial membrane potential was significantly reduced due to ultrasound-mediated ROS generation. Figure 23 Furthermore, the intracellular ATP level in cells treated with ADH@TA+US decreased by 63%, while the intracellular ATP content in untreated cells showed no significant change, further demonstrating ROS-induced mitochondrial dysfunction. Figure 24 ).

[0137] The therapeutic effect of ADH@TAwas was then assessed using the Cell Counting Kit-8 (CCK-8). Results showed that ADH@TA-treated cells exhibited significant cytotoxicity under ultrasound irradiation, which was attributed to the combined effects of spatiotemporally controlled gene regulation and SDT (Solar Degradation Therapy). Figure 22 d). In contrast, the AcDH@TA irradiated group and the unirradiated ADH@TA group showed only moderate cytotoxicity, indicating that the efficacy of single SDT or gene silencing therapy for tumors is limited.

[0138] However, due to the action of SDT alone, cells treated with nADH@TA+US showed similar cell viability to cells treated with AcDH@TA+US. Ultrasound alone ( Figure 22 d) or AcDH@TA ( Figure 25No significant cytotoxicity was observed in cells treated with ADH@TA, confirming the good biocompatibility of low-dose ultrasound and the DNA scaffold. Furthermore, the normal cell line L-02 cells, after irradiation with different concentrations of ADH@TA and ultrasound, showed higher cell viability than MCF-7 cells, indicating that this nanosystem possesses high tumor-specific cytotoxicity. Figure 22 e). Cell death was assessed by flow cytometry using Annexin V / propidium iodide (PI) co-staining. The ADH@TA+US group showed the highest level of apoptosis among all groups. Figure 22 f). Notably, compared with MCF-7 cells under the same conditions, the apoptosis level of L-02 cells treated with ADH@TA+US was significantly reduced (f). Figure 26 The results were consistent with those of CCK-8. Furthermore, the results were obtained using a live / dead cell staining method (…). Figure 22 g) and coating plate method ( Figure 27 This study confirms the combined anticancer efficacy of ADH@TA.

[0139] This embodiment demonstrates that ADH@TA can achieve highly selective gene regulation of tumor cells and efficient SDT, providing promising therapeutic potential for spatiotemporal control of tumor therapy.

[0140] Example 6

[0141] Based on Examples 1-5, this example describes the antitumor efficacy of ADH@TA in vivo. Pharmacokinetic studies showed that ADH@TA has a longer circulation time (half-life of 30 minutes) compared to free En-Dz. Figure 28 This indicates that plasma stability has been improved.

[0142] The spatiotemporal control of DNAzyme activation was investigated in MCF-7 tumor-bearing BALB / c mice. Twenty mice were randomly divided into four groups (n=5). Intratumoral injection of Cy5 / bhq2-labeled ADH@TA or nADH@TA (DNAzyme dose 50 nmol / kg, Hb dose 0.2 mg / kg⁻¹) was performed, followed by ultrasound irradiation of the tumor site. Cy5 fluorescence was monitored at different time intervals after injection. Figure 29 As shown in a and 29b, the fluorescence signal in the tumor region of ADH@TA-treated mice was significantly enhanced, while the enhancement of fluorescence signal in the tumor of nADH@TA-treated mice was smaller. Twelve hours after injection, the fluorescence intensity in the tumor of the ADH@TA group was 2.2 times higher than that of the nADH@TA group, indicating that the overexpression of APE1 in the tumor activated the nanosystem (…). Figure 29c). Furthermore, compared to mice treated with nADH@TA and ultrasound, ultrasound treatment resulted in a 3.1-fold increase in intratumoral fluorescence in ADH@TA-injected mice, and a 1.4-fold increase compared to the untreated ADH@TA group, confirming the enhanced APE1 activation induced by the sonodynamic effect. Moreover, the difference in intratumoral fluorescence between the ultrasound-irradiated group and the untreated nADH@TA group was negligible, confirming that the fluorescence changes were indeed due to APE1 activation. Fluorescence images of ex vivo tumors further confirmed these results. Figure 29 d). Compared with the nADH@TA+US and ADH@TA groups, the fluorescence intensity of mouse tumors treated with ADH@TA+US was 2.0-fold and 1.3-fold higher, respectively. Figure 29 e).

[0143] Next, the antitumor effect of ADH@TA was evaluated in the MCF-7 tumor-bearing mouse model. (e.g., treatment regimens...) Figure 30 As shown in a), after tumor inoculation, mice were treated with different samples (DNAzyme dose of 100 nmol kg⁻¹, Hb dose of 0.4 mg kg⁻¹), and designated groups were subjected to ultrasound irradiation (1.0 MHz, 50% duty cycle, 1.5 W cm⁻², 5 min) 2 h after injection. Tumor volume measurements showed no significant changes among the PBS, US, and AcDH@TA groups, indicating that these treatments did not affect tumor growth. Figure 30 In contrast to the rapid tumor growth observed in the PBS group, ADH@TA monotherapy resulted in moderate tumor suppression due to its gene silencing ability. Figure 31 a). Notably, both nADH@TA+US and AcDH@TA+US treatments significantly inhibited tumor growth, which is attributed to the individual SDT ( Figure 31 b and 31c). The ADH@TA+US group showed the highest antitumor efficacy among all treatment groups. Figure 30 (b and 31d), indicating that the combined use of ultrasound-controlled SDT and enzyme-activated gene therapy is more effective than either method alone. These results confirm that the therapeutic effect of nanohybridization (ADH@TA) originates from SDT and activated gene silencing. Furthermore, the weight changes in mice were negligible in all treatment groups. Figure 31 e). Tumor weight measurement and photographs of tumor resection further validated the superior treatment efficacy of ADH@TA+US. Figure 31 f and 32a). Hematoxylin and eosin (H&E) staining of tumor sections showed the highest level of cell death in the ADH@TA+US treatment group (f and 32a). Figure 32b). Terminal deoxynucleotidyl transferase (dUTP) nickel-terminal labeling (TUNEL) staining showed the strongest green fluorescence in ADH@TA+US treated tumors, indicating the highest degree of apoptosis. Figure 32 c). Immunohistochemical (IHC) analysis of tumor tissue showed that ADH@TA treatment induced a significant downregulation of survivin protein, and the addition of ultrasound in the ADH@TA+US group further reduced survivin protein expression. Figure 33 This verified the enhanced gene regulation mediated by ultrasound. Blood biochemistry analysis ( Figure 34 ) and H&E staining of normal organs and tissues ( Figure 35 The results showed that ADH@TA had minimal side effects. Furthermore, RT-qPCR analysis revealed no change in survivin mRNA expression in major organs. Figure 36 Under the applied conditions, ultrasound treatment had no adverse effects on the health of the mice, which underscores the safety of the ultrasound treatment conditions used in this embodiment, consistent with the conditions used in other studies.

[0144] A PC-3 tumor-bearing mouse model was established to further investigate the antitumor effect of ADH@TA. Literature reports that PC-3 cells show higher APE1 expression in the cytoplasm compared to normal cells. This is consistent with existing techniques. PC-3 tumor-bearing mice were randomly divided into 7 groups (n=5), and subjected to different sample treatments and ultrasound irradiation. The results showed that the ADH@TA+US group had the highest antitumor effect, while the ADH@TA, nADH@TA+US, and AcDH@TA+US groups showed moderate tumor inhibition. Figure 37 and Figure 38 This study confirmed that combining ultrasound-induced SDT with enzyme-activated gene therapy can enhance therapeutic effects. These results indicate the universality of nanosystems in various cancers.

[0145] The above description is merely a preferred embodiment of the present invention and does not limit the scope of protection of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any changes, modifications, substitutions, integrations, and parameter alterations to these embodiments within the spirit and principles of the present invention, achieved through conventional substitutions or by achieving the same function without departing from the principles and spirit of the present invention, fall within the scope of protection of the present invention.

Claims

1. A method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, characterized in that, The synthesis method includes the following steps: Step S1: Synthesize the DNAzyme AP-DZ containing the APE1 enzyme site; Step S2: Mix AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube; Step S3: Vortex the mixed solution obtained in step S2 and then place it in a metal constant temperature heater for reaction. Step S4: Vortex the reacted solution again and then centrifuge it. Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube; Step S6: After adding deionized water to the collection tube, perform a third vortex treatment; the amount of deionized water is 100 μL, the vortex time is 10 s, and 5 μL of tannic acid with a concentration of 4 mg / ml is added under vortex conditions. Step S7: After vortex treatment, FeCl3·6H2O is added to the tube for a fourth vortex treatment; Step S8: After washing twice, the DNA nanomaterials are stored at 4°C for later use. The DNAzyme sequence is SEQ ID NO.1: CCTCGGCCAGGCTAGCTACAACGACCGCTCCCGCCACATAAGGCGTGGAGCG.

2. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S2, the amount of AP-DZ with a concentration of 100 μM is 15 μL, hemoglobin with a concentration of 1 mg / ml is 10 μL, ferrous iron solution with a concentration of 4 mg / ml is 3 μL, and deionized water is 72 μL per 100 μL.

3. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S3, the vortex treatment time is 10 seconds, the metal constant temperature heater used needs to be preheated to 95°C, and the reaction time is 2 hours.

4. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S4, the vortex treatment time is 5 seconds, the centrifugation conditions are 13,000 revolutions per minute, and the centrifugation treatment time is 10 minutes.

5. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the amount used is 5 μL, and the vortexing time is 30 s.

6. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 1, characterized in that: The washing process in step S8 includes the following steps: Step S81: After centrifuging the solution, add deionized water; Step S82: Perform vortex processing.

7. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility according to claim 6, characterized in that: In step S81, the centrifugation conditions are 13,000 rpm and the centrifugation time is 3 min. The amount of deionized water used is 100 μL. In step S82, the vortexing time is 10 s.

8. The DNA nanomaterial prepared by the synthesis method according to any one of claims 1 to 7, characterized in that, The hydrated size of the DNA nanomaterial is 143 nm to 163 nm.

9. The use of the DNA nanomaterial according to claim 8 in the preparation of drugs for tumor treatment.

Citation Information

Patent Citations

  • APE1 response type targeted drug delivery carrier as well as preparation method and application thereof

    CN115252812A

  • KR20230141306A