Herbicide mesotrione degradation detoxification enzyme protein as well as coding gene and application thereof

Abstract

The invention belongs to the field of agricultural biotechnology and environmental microbiological engineering, and discloses a herbicide mesotrione degradation detoxification enzyme protein, and a coding gene and application thereof. The nucleotide sequence of the gene is SEQ ID NO.1, the full length of the gene is 738bp, 245 amino acids are encoded, and the amino acid sequence of the gene is SEQ ID NO.2. The maximum homology of the Mdmnr and reported nitroreductase is only 48%, so that the Mdmnr is a new nitroreductase gene. The nitroreductase Mdmnr provided by the invention can catalyze nitro reduction of mesotrione, and the mesotrione is converted into a product AMBA without herbicidal activity, which indicates that the Mdmnr gene has huge application prospects in mesotrione-resistant transgenic engineering and biodegradation detoxification and repair of mesotrione residual pollution.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and relates to a herbicide mesotrione degradation and detoxification enzyme protein, a coding gene and uses thereof, and in particular to a nitroreductase capable of degrading and detoxifying mesotrione, a coding gene and uses thereof. Background Art

[0002] The application of herbicide-resistant transgenic engineering can effectively and cheaply control farmland weeds while ensuring the safety of crops, creating a new era of farmland weed control. Currently, most of the crops promoted for planting are glyphosate-resistant transgenic crops. However, the long-term use of glyphosate has brought about serious weed resistance problems, making it impossible to control weeds. One of the effective measures to solve this problem is to use herbicides with different weed-killing mechanisms and to construct corresponding herbicide-resistant transgenic crops. Therefore, it is necessary to widely explore resistance genes for various herbicides to provide genetic resources for the construction of transgenic crops resistant to various herbicides.

[0003] 4-Hydroxyphenylpyruvate dioxygenase (HPPDEC1.13.11.27) is a key enzyme involved in tyrosine metabolism in plants and some bacteria. Tyrosine generates 4-hydroxyphenylpyruvic acid (4-HPP) under the action of tyrosine aminotransferase (TAT), and then converts to homogentisic acid (HGA) under the catalysis of HPPD. Homodisic acid is a key precursor for the biosynthesis of plastoquinone and tocopherol in plants, while plastoquinone is a component of the photosynthetic electron transport chain, and tocopherol is an important antioxidant in plants. HPPD inhibitor herbicides competitively inhibit the activity of HPPD, hindering the synthesis of homogentisic acid (HGA), and thus failing to synthesize plastoquinone and tocopherol, resulting in albinism and death of plants. Therefore, this catalytic reaction also makes HPPD developed as an important herbicide target enzyme.

[0004] HPPD inhibitor herbicides are mainly divided into triketones, isoxazoles and phenylpyrazoles according to their chemical structures. Mesotrione, also known as mesotrione, is a triketone herbicide developed by Syngenta in 1984. It can control most broadleaf weeds and a few grass weeds. Since its launch in 2001, mesotrione has become the world's largest HPPD inhibitor herbicide, with global sales of US$650 million in 2016. Although mesotrione has the advantages of high efficiency, low toxicity, high crop safety and good environmental compatibility, weeds gradually develop resistance to this type of herbicide with long-term use. Therefore, obtaining new mesotrione degradation and detoxification / resistance genes with excellent performance and developing transgenic crops have very important theoretical and practical application value. Summary of the invention

[0005] The purpose of the present invention is to provide a new protein, a coding gene and use thereof, wherein the protein not only has mesotrione nitroreductase activity but also completely degrades mesotrione to lose its herbicidal activity.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The mesotrione nitroreductase Mdmnr of the present invention has an amino acid sequence of SEQ ID NO.2.

[0008] The gene mdmnr encoding the mesotrione nitroreductase preferably has a nucleotide sequence of SEQ ID NO.1.

[0009] A recombinant expression vector containing the mesotrione nitroreductase gene mdmnr.

[0010] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by homologous recombination of the mesotrione nitroreductase gene mdmnr with a linearized pET-28a(+) plasmid.

[0011] A genetically engineered strain containing the mesotrione nitroreductase gene mdmnr of the invention.

[0012] As a preferred embodiment of the present invention, the expression strain of the genetically engineered bacteria is Escherichia coli BL21 (DE3).

[0013] The invention discloses an application of the mesotrione nitroreductase Mdmnr in biodegradation, detoxification and restoration of mesotrione residue pollution.

[0014] The invention discloses an application of the coding gene mdmnr in the preparation of a mesotrione degradation preparation.

[0015] The invention discloses an application of the coding gene mdmnr in biodegradation, detoxification and restoration of mesotrione residue pollution.

[0016] Beneficial effects:

[0017] The present invention provides a new mesotrione nitroreductase Mdmnr, which can degrade mesotrione into 2-amino-4-methylsulfonylbenzoic acid (AMBA) and lose herbicidal activity. Mdmnr and its encoding gene have potential application value in cultivating mesotrione-resistant transgenic plants and bioremediation of mesotrione residue pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :Phylogenetic tree constructed by 16S rRNA gene of strain Md-42 and its closest related model strain

[0019] Figure 2 :HPLC detection of mesotrione degradation by strain Md-42

[0020] A, mesotrione standard sample h; B, AMBA standard sample; C, degradation 0h; D, degradation 72h

[0021] Figure 3 :Results of SDS-PAGE detection of exogenously expressed Mdmnr

[0022] M, Marker; 1, Mdmnr crude enzyme solution; 2, penetration solution; 3, protein eluted with 50mM imidazole; 4, purified Mdmnr (200mM imidazole)

[0023] Figure 4 :HPLC detection of mesotrione degradation by Mdmnr

[0024] A, reaction time 0h; B, reaction time 2h

[0025] Figure 5 :Inhibitory effects of different concentrations of nitrosulfuron and its Mdmnr degradation products on rice HPPD (OsHPPD)

[0026] Figure 6 :Effects of foliar spraying of mesotrione on the growth of transgenic mdmnr rice DETAILED DESCRIPTION

[0027] Example 1. Isolation of mesotrione-degrading strains and screening of their nitroreductase genes

[0028] 1.1 Enrichment, isolation and classification of mesotrione-degrading strains

[0029] Soil samples were collected from farmland where mesotrione was used for a long time. 10g of soil sample was added to 100mL of basal salt medium containing 50mg / L mesotrione. After 1 week of shaking culture at 30℃ and 150r / min, the soil sample was transferred to the same medium at a 10% inoculation rate and then shaken for another week. This was repeated 4 times. The enriched solution with degradation effect was diluted in a gradient manner. 1mL of 10 -4 , 10 -5 and 10 -6 , the dilution was coated on LB plates and cultured at 30°C for 3-4 days. Single colonies of different forms were picked on the plates, and further purified by streaking on the LB plates. The obtained pure bacteria were inoculated into a basic salt liquid medium with 100 mg / L mesotrione, and cultured at 30°C and 150 r / min for 5 days to verify whether each pure strain had the ability to degrade mesotrione.

[0030] The formula of basal salt medium (MSM): 1.5g K2HPO4·3H2O; 0.5g KH2PO4; 1.0g NH4NO3; 0.5g NaCl; 0.2g MgSO4·7H2O, add deionized water to make up to 1L, and add 20.0g agar per liter of solid culture medium.

[0031] LB medium formula: 5 g yeast extract; 10 g tryptone; 10 g sodium chloride; adjust the pH to 7.0 with 1 M NaOH solution.

[0032] A mesotrione-degrading bacterium was obtained by enrichment, acclimation, separation and screening, and named Md-42. After growing on solid culture medium for 4 days, the colony of strain Md-42 was milky white, moist, smooth, with rounded edges and a diameter of about 0.4 mm; the bacterial cells were rod-shaped (0.6-0.8×2.0-3.5μm), Gram-positive, with terminal spores and swollen spore capsules. Using the genomic DNA of strain Md-42 as a template, PCR amplification with universal primers for bacterial 16S rRNA gene sequences was performed to obtain a 1455bp 16S rRNA gene sequence. Blast analysis was performed in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and EZtaxon databases (http: / / eztaxon-e.ezbiocloud.net / ezt). The results showed that strain Md-42 was most closely related to strains of the genus Paenibacillus, with the highest homology to Paenibacillus terreus D33T being 97.1%. In the phylogenetic tree constructed with the 16S rRNA gene, strain Md-42 was also clustered in the genus Paenibacillus ( Figure 1), so the strain Md-42 was preliminarily identified as Paenibacillus.

[0033] 1.2 Degradation of mesotrione by strain Md-42

[0034] Study on degradation characteristics: Md-42 was inoculated into LB liquid medium and cultured at 30°C until mid-logarithmic phase. The cells were collected by low-speed centrifugation, washed twice with fresh, sterile basal salt medium, and resuspended in basal salt medium. The cell concentration was adjusted to about 1.0×10 9 cfu / mL, inoculated into 20 mL of basal salt medium containing 100 mg / L mesotrione at a 1% (v / v) inoculation amount, and cultured at 30°C for 72 hours. Samples were taken at regular intervals and the degradation of mesotrione by the strain was determined by HPLC.

[0035] The results showed that the bacteria almost completely degraded 100 mg / L mesotrione within 72 hours. Liquid phase analysis results showed that mesotrione had a characteristic absorption peak at 18.93 minutes ( Figure 2 A), while the 2-amino-4-methylsulfonylbenzoic acid (AMBA) standard has a characteristic absorption peak at 6.78 minutes ( Figure 2 B). After degradation, the characteristic absorption peak of mesotrione at 18.93 minutes ( Figure 2 C) almost completely disappeared, and a new peak appeared at 6.78 minutes, which was exactly the same as the peak time of the AMBA standard ( Figure 2 D), therefore, strain Md-42 converts mesotrione into the product AMBA by nitroreduction.

[0036] Example 2. Cloning and Functional Verification of Mesotrione Nitroreductase Gene

[0037] 2.1 Genome sequencing and nitroreductase search of strain Md-42

[0038] The genome of strain Md-42 was sequenced, and the draft genome obtained by sequencing was uploaded to the Rast website (https: / / rast.nmpdr.org / ) for annotation. The annotated amino acid sequence was downloaded, and a local protein database was constructed using the Bioedit software. After ORF analysis of the Md-42 genome data, the bacterial genome had a total of 6100 ORFs, one of which was a suspected nitroreductase gene, named mdmnr. The comparison results of the swissprot database of NCBI (https: / / blast.ncbi.nlm.nih.gov / ) showed that Mdmnr had the highest similarity with the reported nitroreductase (49.8%), and its nucleotide sequence was SEQ ID NO.1, with a size of 738bp, encoding a 245-amino acid protein (Mdmnr), as shown in SEQ ID NO.2 in the sequence table.

[0039] 2.2 Synthesis and amplification of mdmnr gene

[0040] The nucleotide sequence of the mdmnr gene (738 bp) shown in SEQ ID NO.1 was commissioned to be synthesized by a biological company, which encodes the Mdmnr protein (245 aa), as shown in SEQ ID NO.2 in the sequence table. The synthesized Mdmnr was cloned into the pUC57 vector, and the recombinant vector was named pUC-Mdmnr, and then transformed into Escherichia coli DH5α. The forward primer: 5'- TAAGAAGGAGATATACCATG AATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'- TGGTGGTGGTGGTGCTCGAG The Mdmnr gene fragment was amplified from the plasmid vector pUC-Mdmnr by PCR using primer CTTATATTTGAAACCCTGTTTGCGCAGT-3' (the underlined homology arm of pET-28a(+)).

[0041] PCR amplification system:

[0042]

[0043] PCR amplification procedure:

[0044] a. Denaturation at 95℃ for 30s;

[0045] b. Denaturation at 95°C for 10 s, annealing at 57°C for 10 s, and extension at 72°C for 30 s for 30 cycles;

[0046] c. Extend at 72°C for 10 min and hold at 4°C.

[0047] The PCR product was recovered using a gel purification kit. For specific methods, refer to the kit instructions.

[0048] 2.3 Reverse amplification of plasmid pET-28a(+)

[0049] The plasmid pET-28a(+) fragment was reversely amplified using the forward primer: 5'-CTCGAGCACCACCACCACCACCACT-3' and the reverse primer: 5'-CATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATT GTTATCCGCT-3'.

[0050] PCR amplification system:

[0051]

[0052] PCR amplification procedure:

[0053] a. Denaturation at 95℃ for 30s;

[0054] b. Denaturation at 95°C for 10 s, annealing at 63°C for 10 s, and extension at 72°C for 3 min for 30 cycles;

[0055] c. Extend at 72°C for 10 min and hold at 4°C.

[0056] The PCR product was recovered using a gel purification kit. For specific methods, refer to the kit instructions.

[0057] 2.4 Construction of expression vector pET-28a(+)-Mdmnr and screening of positive transformants

[0058] The amplified pET-28a(+) fragment and mdmnr gene fragment were cloned using the homologous recombination one-step cloning kit ( IIOne Step Cloning Kit) for homologous recombination. The homologous recombination system is as follows (20 μL):

[0059]

[0060] 37℃ for 30min

[0061] Take a tube of E.coli BL21 (DE3) competent cells (100 μL) from -70℃, wait for it to melt on ice, add 10 μL of homologous recombination product (the volume should not exceed 10% of the competent cells), gently rotate the tube to mix, and place it on ice for 30 minutes. Gently put the centrifuge tube into a 42℃ water bath for 60 seconds, and then put the centrifuge tube back on ice for 5 minutes. Add 500 μL LB medium, put the centrifuge tube into a 37℃ shaker, 150rpm, 60 minutes to recover, and express the antibiotic resistance gene encoded by the plasmid. Centrifuge the tube at 5,000 rpm for 2 min, discard part of the supernatant, retain about 200 μL, use a gun to blow to mix the bacteria, aspirate 100 μL of the mixture and evenly spread it on an LB plate containing 100 mg / L kanamycin, culture at 37°C overnight, pick out a single colony, and sequence to verify that the target gene mdmnr is connected to the vector and has 6 His-tags at the end, and save this transformant for later use.

[0062] 2.5 Expression and purification of Mdmnr

[0063] BL21 (pet-28a-Mdmnr) was cultured in 100 mL LB liquid medium at 37°C, 150 rpm shaking until OD600nm was between 0.4 and 0.6, then IPTG was added to a concentration of 0.05 mM and induced at 16°C for 8 hours. 100 mL of bacterial liquid was centrifuged to collect the cells, washed twice with PBS (50 mM, pH 7.4), resuspended with 10 mL PBS buffer, ultrasonically disrupted (Auto Science, UH-650Bultrasonic processor, 30% intensity) for 5-10 minutes, centrifuged at 12000 rpm for 30 minutes, and the supernatant was collected and precipitated with Co 2+ Mdmnr was purified by ion affinity chromatography, and the purified enzyme was subjected to protein electrophoresis. Figure 3 . Figure 3 The results showed that pure Mdmnr protein was successfully obtained through affinity chromatography.

[0064] 2.6 Detection of Mdmnr enzyme activity

[0065] Enzyme activity reaction system (3mL): 20mM Tris-HCl buffer (pH 7.5), 100μM mesotrione, 1mM NADH, reaction enzyme volume 100μL, reaction at 30℃ for 1h. Each reaction starts with the addition of the enzyme. After 1h, the reaction is terminated by placing it in boiling water for 1min. After the reaction solution is freeze-dried, 200uL of methanol is added to dissolve the lyophilized material, and the amount of substrate reduction is detected by HPLC. One enzyme activity unit (U) is defined as: the amount of enzyme required to catalyze the reduction of 1nM mesotrione per minute under pH 7.5 and temperature 30℃. The HPLC analysis results of mesotrione degradation by nitroreductase Mdmnr are shown in Figure 4 The graphical results show that after 2 hours of enzyme reaction, the absorption peak of nitrotrione at 18.88 minutes decreased significantly. At the same time, the characteristic absorption peak of AMBA appeared at 7.02 minutes, indicating that Mdmnr can reduce nitrotrione to AMBA and has nitroreductase activity. The specific enzyme activity for nitrotrione is 0.87U / mgprotein.

[0066] Example 3. Effect of Mdmnr on the degradation and detoxification of mesotrione

[0067] In a 100 mL enzyme reaction system, mesotrione was added to a final concentration of 4 μM, 8 μM and 12 μM, and then an appropriate amount of purified Mdmnr was added. The reaction was carried out at 30°C for 5-6 hours to completely degrade mesotrione, and then placed in boiling water for 1 minute to terminate the reaction. After the enzyme reaction solution was freeze-dried, 2 mL of methanol was added to dissolve the lyophilized material, and then the methanol solution was naturally evaporated, and the residue was dissolved in pure water to obtain the degradation product.

[0068] The recombinant strain E. coli (pet-29a-OsHPPD) was introduced with a rice HPPD (OsHPPD) that is sensitive to mesotrione. Therefore, it was used in this experiment to detect the inhibitory activity of the product of mesotrione degraded by Mdmnr on OsHPPD. The recombinant strain E. coli BL21 (pET-29a-OsHPPD) was inoculated in a 96-well plate containing TLB medium (LB containing 0.1% Tyr), and the inducer IPTG was added at the same time. Then 0μM, 4μM, 8μM and 12μM of mesotrione and degradation products were added respectively. After culturing for 36 hours, the color changes under different concentration treatments were observed. The results are shown in Figure 2. Figure 5 As shown, the control without mesotrione was red in color, indicating that OsHPPD was normally expressed and active; the treatment with 2 μM or higher concentration of mesotrione was light yellow, indicating that the activity of OsHPPD had been completely inhibited; and the products of mesotrione degradation by Mdmnr were all red in color, with no significant difference from the control without mesotrione, indicating that the degradation products had no inhibitory effect on OsHPPD.

[0069] Therefore, in summary, Mdmnr can completely convert mesotrione into products that have no inhibitory effect on OsHPPD, thereby achieving the degradation and detoxification of mesotrione.

[0070] Example 4: Construction of rice expression vector of nitroreductase gene mdmnr and Agrobacterium transformation

[0071] The rice transgenic vector pCUbi1390 was used to exogenously express the nitroreductase gene mdmnr. The pUC-Mdmnr plasmid in Example 2 was used as a template and primers (forward primer: 5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGAATGAAGTCATTCACACCCTA ACTGAAC-3' and reverse primer: 5'- GACTCCTCTTAGAATTCCCGGGGATCC TCACTTATATTTGAAACCCTGTTTG CGCA-3', underlined homology arms of pCUbi1390) amplified the nitroreductase gene mdmnr DNA sequence, and the amplification conditions were consistent with those in Example 2.2. The pCUbi1390 vector was linearized using endonuclease BamH I and ligated with the mdmnr fragment to construct the corresponding transgenic vector mdmnr-pCUbi1390, and the vector construction steps were consistent with those in Example 2.3. After the transformants were verified by sequencing, the plasmid was extracted for use.

[0072] Using the heat shock method, 1 μL of the above plasmid was added to 100 μL of slowly thawed competent cells of Agrobacterium strain EHA105 (Weidi Biotechnology, China), quickly frozen in liquid nitrogen for 5 minutes, placed in a 42°C water bath for 5 minutes, placed on ice for 5 minutes, added with 500 μL LB liquid culture medium, and cultured for 3 hours at 28°C with shaking. Centrifuged and part of the supernatant was removed. About 100 μL of culture medium was reserved to resuspend the bacteria, evenly spread on a solid LB culture medium plate containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and placed in an incubator at 28°C for inversion and culture for about 36 hours. In order to prevent the low infection activity of individual colonies, 3 single clones of each plasmid Agrobacterium were selected for Agrobacterium-mediated rice genetic transformation.

[0073] Example 5: Agrobacterium-mediated genetic transformation of rice and identification of transgenic positive plants

[0074] 5.1 Obtaining callus tissue: Select plump and healthy seeds of the rice variety Nipponbare and shell them; disinfect the surface in 70% ethanol for 1 minute, shaking continuously; then disinfect with 3% sodium hypochlorite containing 1 drop of Tween-20 for 30 minutes, shaking on a shaker; wash with sterilized distilled water 5 times, each time for about 2 minutes, shaking continuously; then use tweezers to pick out the washed seeds, place them in a culture dish covered with 5 layers of sterile filter paper, spread the seeds evenly on the filter paper, and then cover it with 5 layers of filter paper to dry the seeds; place 15 seeds on a callus induction solid medium (N6 salt, 4g; inositol, 0.1g; proline, 2.8g; hydrolyzed casein, 0.3g; sucrose, 30g; 2g / mL 2,4-D, 1mL; phytogel, 4g; add deionized water to 1L; autoclave) so that the endosperm is buried in the culture medium, the embryo is exposed to the surface of the culture medium, and the scutellum is just in contact with the culture medium; the culture dish is placed in a 28℃ culture room under long-day conditions (16h light / 8h dark) for about 4 weeks, until a large number of firm, tender yellow callus blocks grow.

[0075] 5.2 Preparation and co-cultivation of Agrobacterium: Use a sterile toothpick to pick up three single colonies of Agrobacterium containing the nitroreductase mdmnr expression vector, inoculate them into 20 mL of liquid LB medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and shake and culture for 36 h; centrifuge at 5000 rpm for 2 min, and resuspend the bacteria in 1 mL of liquid N6 medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; add 100 mM acetosyringone, 1 mL after cooling), determine the bacterial concentration using a UV spectrophotometer, and then dilute the Agrobacterium resuspension to OD with liquid N6 medium. 600 =0.08; use tweezers that have been sterilized at 300°C and then cooled to pick up rice callus tissue blocks, immerse them in the diluted Agrobacterium solution, and let them stand for 20 minutes; pour out the Agrobacterium solution, pick up rice callus blocks with sterile tweezers, place them in a culture dish covered with 5 layers of sterile filter paper, spread the callus, and then cover it with 5 layers of filter paper, and dry the callus for 2 hours; add 500 μL of liquid N6 culture medium to the co-culture plate, place a sterile filter paper with a diameter equivalent to that of the culture dish on the surface of the culture medium, let the liquid evenly infiltrate the filter paper, and then place the dried callus on the co-culture medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL) covered with filter paper. 2,4-D, 1 mL; plant gel, 4 g; add deionized water to 1 L; autoclave; add 100 mM acetosyringone, 1 mL) after cooling; seal the culture dish containing callus tissue with breathable tape (3M, USA), then wrap the culture medium with tin foil, and co-cultivate at 25°C in the dark for 3 days;

[0076] 5.3 Screening of positive callus: Use sterile tweezers to wash the co-cultured callus with sterile water for 5 times, and then wash it once with sterile distilled water containing 500 μg / mL carbenicillin sodium; place the callus in a culture dish covered with 5 layers of sterile filter paper, spread the callus, and then cover it with 5 layers of filter paper to dry it. Then transfer the dried callus to recovery medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1mL; add deionized water to 1L; autoclave; add 250mg / mL carbenicillin, 1mL after cooling), place in a 28℃ culture room, and culture under long-day conditions (16h light / 8h dark) for 3 days; use sterile tweezers to transfer the callus tissue after recovery culture to a screening medium containing 50μg / mL hygromycin (N6 salt, 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g / mL 2,4-D, 1mL; add deionized water to 1L; autoclave; add 200mg / mL carbenicillin sodium, 1mL after cooling; add 50mg / mL hygromycin B, 1mL), and culture under long-day conditions for 2 to 4 weeks until new hard and tender yellow callus tissue grows out;

[0077] 5.4 Regeneration and cultivation of transgenic plants: Use sterile tweezers to transfer the newly grown hygromycin-resistant callus on the screening medium to the regeneration medium (MS salt, 4.33 g; hydrolyzed casein, 2 g; sorbitol, 30 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; after cooling, add 200 mg / mL carbenicillin sodium, 1 mL; add 50 mg / mL hygromycin B, 1 mL; 1 mg / mL NAA, 20 μL; 1 mg / mL Kinetin, 2mL), cultured under long-day conditions (16h light / 8h dark) for 2-4 weeks until green seedlings grow out; the green seedlings are clipped out with sterile tweezers and placed on a solid 1 / 2MS medium containing 25μg / mL hygromycin until the seedlings grow to 5-8cm; the seedlings are taken out, washed and placed in clean water, and hardened in a 28℃ culture room under long-day conditions for 3-5 days; the transgenic seedlings are transplanted into soil and planted in a 32℃ greenhouse under long-day conditions; when the transgenic plants grow to 4-5 leaves, The DNA of the surviving transgenic seedlings was extracted using a plant DNA extraction kit (Kangwei Century, China), and PCR verification was performed using mdmnr gene-specific primers (forward primer: 5'-ATGAATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'-TCACTTATATTTGAAACCCTGTTTGCGCA-3') (amplification conditions were consistent with Example 2.2). The individual plants that could amplify the target band were transgenic positive plants.

[0078] Example 6: Herbicide treatment of transgenic plants expressing the nitroreductase gene mdmnr and wild-type rice

[0079] 10 to 15 transgenic positive individual plants of nitroreductase gene mdmnr transgenic rice were selected and planted in soil, and wild-type rice was planted at the same time. When the seedlings grew to the 3-leaf stage, DNA of each individual plant was extracted as a template, and amplified and verified with mdmnr gene-specific primers (forward primer: 5'-ATGAATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'-TCACTTATATTTGAAACCCTGTTTGCGCA-3') (amplification conditions were consistent with Example 2.2), and transgenic lines containing single copy insertion were selected according to the Mendelian segregation ratio of 1:3 (plants without the target band: plants with the target band), and retained and continued to be planted until the 4-5 leaf stage.

[0080] Transgenic rice and wild-type rice expressing the nitroreductase gene mdmnr were treated with 900 μM mesotrione. The rice was sprayed on the leaves using a pressure sprayer (GARDENA, Germany) to ensure that the droplets were evenly distributed on the leaf surface. After culturing for 2 weeks in a 28°C culture room under long-day conditions, the growth of the corresponding plants was observed, and representative individual plants of independent lines were selected for photographing and recording ( Figure 6 ). The results showed that the leaves of wild-type rice plants turned yellow after being sprayed with mesotrione, showing obvious phytotoxicity; while the transgenic plants with the nitroreductase gene mdmnr did not show obvious phytotoxicity. This result shows that the nitroreductase gene mdmnr can confer significant mesotrione resistance to transgenic rice.

[0081] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art. According to all the teachings disclosed, various modifications and replacements can be made to those details, which are all within the scope of protection of the present invention. The full scope of the present invention is given by the attached patent claims and any equivalents.

Claims

1. A mesotrione nitroreductase Mdmnr, characterized in that: The amino acid sequence is shown in SEQ ID NO.

2.

2. The gene mdmnr encoding the mesotrione nitroreductase Mdmnr according to claim 1.

3. The coding gene mdmnr according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

4. A recombinant expression vector containing the coding gene mdmnr according to claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that it is obtained by recombining the coding gene mdmnr according to claim 2 into the vector pET-29a(+).

6. A genetically engineered bacterium containing the mdmnr encoding gene according to claim 2 or 3.

7. The genetically engineered bacterium according to claim 6, characterized in that The expression strain of the genetically engineered bacteria is Escherichia coli BL21 (DE3).

8. Use of the mesotrione nitroreductase Mdmnr according to claim 1 in biodegradation, detoxification and remediation of mesotrione residue pollution.

9. Use of the coding gene mdmnr according to claim 2 in the preparation of a mesotrione-degrading preparation.

10. Use of the coding gene mdmnr according to claim 2 in biodegradation, detoxification and restoration of mesotrione residue pollution.

Images