A herbicide mesotrione degradation detoxification enzyme protein, its coding gene and use

Through mesotrione nitroreductase Mdmnr and its encoding gene mdmnr, the degradation of mesotrione and the resistance of transgenic plants were achieved, the problem of weed resistance to mesotrione was solved, and the degradation of mesotrione and pollution remediation were achieved.

CN119286807BActive Publication Date: 2025-10-10JIANGSU ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411531965.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-10-10
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

With long-term use, weeds gradually develop resistance to mesotrione herbicides, and existing technologies are difficult to effectively degrade and control them, making weed control difficult.

Method used

Provided are a mesotrione nitroreductase Mdmnr and its encoding gene mdmnr, which can achieve degradation and detoxification of mesotrione through a recombinant expression vector and a genetically engineered strain.

Benefits of technology

Mdmnr can completely degrade mesotrione into 2-amino-4-methylsulfonylbenzoic acid, which has no herbicidal activity, solving the problem of weed resistance, providing resistance in transgenic plants, and repairing mesotrione residual pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286807B_ABST
    Figure CN119286807B_ABST
Patent Text Reader

Abstract

The application belongs to the field of agricultural biotechnology and environmental microbial engineering, and discloses a herbicide mesotrione degradation detoxification enzyme protein, a coding gene thereof and application. The nucleotide sequence is SEQ ID NO. 1, the full length is 738 bp, and 245 amino acids are encoded, and the amino acid sequence is SEQ ID NO. 2. The homology of Mdmnr and the reported nitroreductase is only 48%, and therefore, Mdmnr is a new nitroreductase gene. The nitroreductase Mdmnr provided by the application can catalyze the nitroreduction of mesotrione, and convert mesotrione into a product AMBA without herbicidal activity, which indicates that the Mdmnr gene has great application prospect in anti-mesotrione transgenic engineering and mesotrione residue pollution biodegradation detoxification and repair.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology and relates to a herbicide mesotrione degradation and detoxification enzyme protein, a coding gene and uses thereof, and in particular to a nitroreductase capable of detoxifying mesotrione, a coding gene and uses thereof. Background Art

[0002] The application of herbicide-resistant genetic engineering (GM) has ushered in a new era of weed control, enabling efficient and cost-effective weed control while ensuring crop safety. Currently, the vast majority of crops being cultivated are glyphosate-resistant GM crops. However, long-term use of glyphosate has led to serious weed resistance, rendering weed control impossible. One effective solution to this problem is to use herbicides with different weed-killing mechanisms and develop corresponding herbicide-resistant GM crops. Therefore, extensive research is needed to identify resistance genes to various herbicides to provide genetic resources for developing GM crops resistant to various herbicides.

[0003] 4-Hydroxyphenylpyruvate dioxygenase (HPPDEC1.13.11.27) is a key enzyme involved in tyrosine metabolism in plants and some bacteria. Tyrosine is converted to 4-hydroxyphenylpyruvic acid (4-HPP) by tyrosine aminotransferase (TAT), which is then converted to homogentisic acid (HGA) catalyzed by HPPD. Homogentisic acid is a key precursor for the biosynthesis of plastoquinone and tocopherols in plants. Plastoquinone is a component of the photosynthetic electron transport chain, while tocopherols are important antioxidants in plants. HPPD inhibitors competitively inhibit the activity of HPPD, hindering the synthesis of homogentisic acid (HGA). Consequently, the synthesis of plastoquinone and tocopherols is impeded, leading to plant albinism and death. This catalytic reaction has led to the development of HPPD as a key target enzyme for herbicides.

[0004] HPPD inhibitor herbicides are primarily classified by chemical structure into triketides, isoxazoles, and phenylpyrazoles. Mesotrione, also known as mesotrione, is a triketone herbicide developed by Syngenta in 1984. It controls most broadleaf weeds and a few grass weeds. Since its launch in 2001, mesotrione has become the world's leading HPPD inhibitor herbicide, with global sales of $650 million in 2016. Although mesotrione boasts high efficacy, low toxicity, high crop safety, and good environmental compatibility, weed resistance to this herbicide gradually develops with prolonged use. Therefore, obtaining novel, high-performance mesotrione-degrading / resistance genes and developing transgenic crops are of great theoretical and practical value. Summary of the Invention

[0005] The purpose of the present invention is to provide a new protein, a gene encoding the protein and its use. The protein not only has mesotrione nitroreductase activity, but also completely degrades mesotrione to lose its herbicidal activity.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The mesotrione nitroreductase Mdmnr of the present invention has an amino acid sequence as SEQ ID NO.2.

[0008] The gene mdmnr encoding the mesotrione nitroreductase preferably has a nucleotide sequence of SEQ ID NO.1.

[0009] A recombinant expression vector containing the mesotrione nitroreductase gene mdmnr.

[0010] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by homologous recombination of the mesotrione nitroreductase gene mdmnr with a linearized pET-28a(+) plasmid.

[0011] A genetically engineered strain containing the mesotrione nitroreductase gene mdmnr of the present invention.

[0012] As a preferred embodiment of the present invention, the expression strain of the genetically engineered bacteria is Escherichia coli BL21 (DE3).

[0013] The invention discloses an application of the mesotrione nitroreductase Mdmnr in the biodegradation, detoxification and restoration of mesotrione residue pollution.

[0014] The invention discloses an application of the encoding gene mdmnr in the preparation of a mesotrione-degrading preparation.

[0015] The invention discloses an application of the coding gene mdmnr in the biodegradation, detoxification and restoration of mesotrione residue pollution.

[0016] Beneficial effects:

[0017] The present invention provides a novel mesotrione nitroreductase (Mdmnr), which can degrade mesotrione into 2-amino-4-methylsulfonylbenzoic acid (AMBA), thereby losing its herbicidal activity. Mdmnr and its encoding gene have potential applications in cultivating mesotrione-resistant transgenic plants and in bioremediation of mesotrione residue pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :Phylogenetic tree constructed based on 16S rRNA gene of strain Md-42 and its closest related model strain

[0019] Figure 2 : HPLC detection of mesotrione degradation by strain Md-42

[0020] A, mesotrione standard sample 1 hour; B, AMBA standard sample; C, degradation 0h; D, degradation 72h

[0021] Figure 3 :SDS-PAGE detection results of exogenously expressed Mdmnr

[0022] M, Marker; 1, Mdmnr crude enzyme solution; 2, Flowthrough; 3, Protein eluted with 50 mM imidazole; 4, Purified Mdmnr (200 mM imidazole)

[0023] Figure 4 :HPLC detection of mesotrione degradation by Mdmnr

[0024] A, reaction time 0h; B, reaction time 2h

[0025] Figure 5 :Inhibitory effects of different concentrations of nitrosulfuron and its Mdmnr degradation products on rice HPPD (OsHPPD)

[0026] Figure 6 Effects of foliar spraying of mesotrione on the growth of transgenic mdmnr rice DETAILED DESCRIPTION

[0027] Example 1. Isolation of mesotrione-degrading strains and screening of their nitroreductase genes

[0028] 1.1 Enrichment, isolation, classification and identification of mesotrione-degrading strains

[0029] Soil samples were collected from farmland where mesotrione had been used for a long time. 10g of soil sample was added to 100mL of basal salt medium containing 50mg / L mesotrione. After incubation at 30℃ and 150r / min for about 1 week, the sample was transferred to the same medium at a 10% inoculum size and incubated for another week. This inoculation process was repeated 4 times. The enriched solution with degradation effect was diluted in a gradient manner. 1mL of 10 was taken and 10 -4 , 10 -5 and 10 -6 The dilution was spread on LB plates and incubated at 30°C for 3-4 days. Single colonies of different morphologies were picked from the plates and further purified by streaking on LB plates. The resulting pure bacteria were inoculated into a basal salt liquid medium supplemented with 100 mg / L mesotrione and incubated at 30°C, 150 rpm, for 5 days to verify whether each pure strain had the ability to degrade mesotrione.

[0030] Basal salt medium (MSM) formula: 1.5g K2HPO4·3H2O; 0.5g KH2PO4; 1.0g NH4NO3; 0.5g NaCl; 0.2g MgSO4·7H2O, add deionized water to 1L, and add 20.0g agar per liter of solid medium.

[0031] LB medium formula: 5 g yeast extract; 10 g tryptone; 10 g sodium chloride; adjust the pH to 7.0 with 1 M NaOH solution.

[0032] A mesotrione-degrading strain, named Md-42, was isolated and screened through enrichment, acclimation, and isolation. After four days of growth on solid culture medium, strain Md-42 exhibited milky white, moist, smooth colonies with rounded edges and a diameter of approximately 0.4 mm. Its cells were rod-shaped (0.6-0.8 × 2.0-3.5 μm), Gram-positive, with terminal spores and swollen sporangia. Using genomic DNA from strain Md-42 as a template, PCR amplification using universal primers for bacterial 16S rRNA gene sequences yielded a 1455-bp 16S rRNA gene sequence. Blast analysis in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and EZtaxon databases (http: / / eztaxon-e.ezbiocloud.net / ezt) showed that strain Md-42 was most closely related to strains of the genus Paenibacillus, with the highest homology of 97.1% to Paenibacillus terreus D33T. In the phylogenetic tree constructed with the 16S rRNA gene, strain Md-42 was also clustered in the genus Paenibacillus ( Figure 1), so the strain Md-42 was preliminarily identified as Paenibacillus genus.

[0033] 1.2 Degradation of mesotrione by strain Md-42

[0034] Study on degradation characteristics: Md-42 was inoculated into LB liquid medium and cultured at 30°C until mid-logarithmic phase. The cells were collected by low-speed centrifugation, washed twice with fresh, sterile basal salt medium, and resuspended in basal salt medium to adjust the cell concentration to approximately 1.0×10 9 cfu / mL, inoculated at a 1% (v / v) inoculum into 20 mL of basal salt medium containing 100 mg / L mesotrione, and cultured at 30°C for 72 h. Samples were taken at regular intervals and the degradation of mesotrione by the strain was determined by HPLC.

[0035] The results showed that the bacteria could almost completely degrade 100 mg / L mesotrione within 72 hours. Liquid phase analysis results showed that mesotrione had a characteristic absorption peak at 18.93 minutes ( Figure 2 A), while the 2-amino-4-methylsulfonylbenzoic acid (AMBA) standard has a characteristic absorption peak at 6.78 minutes ( Figure 2 B). After degradation, the characteristic absorption peak of mesotrione at 18.93 minutes ( Figure 2 C) almost completely disappeared, and a new peak appeared at 6.78 minutes, which was exactly the same as the peak time of the AMBA standard ( Figure 2 D), therefore, strain Md-42 converts mesotrione to the product AMBA via nitroreduction.

[0036] Example 2. Cloning and functional verification of mesotrione nitroreductase gene

[0037] 2.1 Genome sequencing of strain Md-42 and nitroreductase search

[0038] The genome of strain Md-42 was sequenced, and the resulting draft genome was uploaded to the Rast website (https: / / rast.nmpdr.org / ) for annotation. The annotated amino acid sequence was downloaded, and a local protein database was constructed using Bioedit software. ORF analysis of the Md-42 genome revealed a total of 6,100 ORFs, one of which is a suspected nitroreductase gene, designated mdmnr. Comparison with the Swissprot database at NCBI (https: / / blast.ncbi.nlm.nih.gov / ) showed that Mdmnr had the highest similarity (49.8%) with previously reported nitroreductases. Its nucleotide sequence is SEQ ID NO. 1, which is 738 bp in length and encodes a 245-amino acid protein (Mdmnr), as shown in SEQ ID NO. 2 in the sequence listing.

[0039] 2.2 Synthesis and amplification of the mdmnr gene

[0040] The nucleotide sequence of the mdmnr gene (738 bp) shown in SEQ ID NO.1 was commissioned to a biotechnology company to synthesize the protein Mdmnr (245 aa), as shown in SEQ ID NO.2 in the sequence listing. The synthesized Mdmnr was cloned into the pUC57 vector, and the recombinant vector was named pUC-Mdmnr. The vector was then transformed into Escherichia coli DH5α. The forward primers were 5'- TAAGAAGGAGATATACCATG AATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'- TGGTGGTGGTGGTGCTCGAG The Mdmnr gene fragment was amplified from the plasmid vector pUC-Mdmnr by PCR using the primer CTTATATTTGAAACCCTGTTTGCGCAGT-3' (the underlined homology arm of pET-28a(+)).

[0041] PCR amplification system:

[0042]

[0043] PCR amplification procedure:

[0044] a. Denature at 95°C for 30 seconds;

[0045] b. Denaturation at 95°C for 10 s, annealing at 57°C for 10 s, and extension at 72°C for 30 s for 30 cycles;

[0046] c. Extend at 72°C for 10 min and hold at 4°C.

[0047] The PCR product was recovered using a gel purification kit. For specific methods, refer to the kit instructions.

[0048] 2.3 Reverse amplification of plasmid pET-28a(+)

[0049] The plasmid pET-28a(+) fragment was amplified using the forward primer: 5'-CTCGAGCACCACCACCACCACCACT-3' and the reverse primer: 5'-CATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATT GTTATCCGCT-3'.

[0050] PCR amplification system:

[0051]

[0052] PCR amplification procedure:

[0053] a. Denature at 95°C for 30 seconds;

[0054] b. Denaturation at 95°C for 10 s, annealing at 63°C for 10 s, and extension at 72°C for 3 min for 30 cycles;

[0055] c. Extend at 72°C for 10 min and hold at 4°C.

[0056] The PCR product was recovered using a gel purification kit. For specific methods, refer to the kit instructions.

[0057] 2.4 Construction of expression vector pET-28a(+)-Mdmnr and screening of positive transformants

[0058] The amplified pET-28a(+) fragment and mdmnr gene fragment were cloned using the homologous recombination one-step cloning kit ( Homologous recombination was performed according to the instructions of the II One Step Cloning Kit. The homologous recombination system was as follows (20 μL):

[0059]

[0060] Incubate at 37°C for 30 min

[0061] Thaw a tube of E. coli BL21 (DE3) competent cells (100 μL) at -70°C on ice. Add 10 μL of the homologous recombination product (no more than 10% of the volume of the competent cells) and gently swirl the tube to mix thoroughly. Place the tube on ice for 30 minutes. Gently heat shock the tube in a 42°C water bath for 60 seconds, then return the tube to ice for 5 minutes. Add 500 μL of LB medium and shake the tube at 37°C at 150 rpm for 60 minutes to thaw the cells. The cells will then express the antibiotic resistance gene encoded by the plasmid. Centrifuge the tube at 5,000 rpm for 2 min, discard part of the supernatant, and retain approximately 200 μL. Mix the cells by pipetting with a pipette. Pipette 100 μL of the mixture and spread it evenly onto an LB plate containing 100 mg / L kanamycin. Incubate at 37°C overnight. Pick a single colony that has grown. Confirm by sequencing that the target gene mdmnr is linked to the vector and that six His-tags are attached to the ends. Save this transformant for future use.

[0062] 2.5 Expression and purification of Mdmnr

[0063] BL21 (pet-28a-Mdmnr) was cultured in 100 mL of LB liquid medium at 37°C, 150 rpm, and shaken until the OD600nm was between 0.4 and 0.6. IPTG was then added to a concentration of 0.05 mM and induced at 16°C for 8 hours. 100 mL of the bacterial culture was collected by centrifugation, washed twice with 50 mM PBS (pH 7.4), resuspended in 10 mL of PBS buffer, and ultrasonically disrupted (Auto Science, UH-650B ultrasonic processor, 30% intensity) for 5-10 minutes. The supernatant was collected and precipitated with Co 2+ Mdmnr was purified by ion affinity chromatography column, and the purified enzyme was subjected to protein electrophoresis. Figure 3 . Figure 3 The results showed that pure Mdmnr protein was successfully obtained through affinity chromatography.

[0064] 2.6 Mdmnr enzyme activity detection

[0065] Enzyme activity reaction system (3mL): 20mM Tris-HCl buffer (pH 7.5), 100μM mesotrione, 1mM NADH, reaction enzyme volume 100μL, reaction at 30℃ for 1h. Each reaction starts with the addition of the enzyme. After 1h, the reaction is terminated by placing it in boiling water for 1min. After the reaction solution is freeze-dried, 200uL of methanol is added to dissolve the lyophilized material, and the amount of substrate reduction is detected by HPLC. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the reduction of 1nM mesotrione per minute at pH 7.5 and temperature 30℃. The HPLC analysis results of mesotrione degradation by nitroreductase Mdmnr are shown as follows: Figure 4 The results shown in the figure show that after 2 hours of enzyme reaction, the absorption peak of nitrotrione at 18.88 minutes decreased significantly. At the same time, the characteristic absorption peak of AMBA appeared at 7.02 minutes, indicating that Mdmnr can reduce nitrotrione to AMBA and has mesotrione nitroreductase activity. The specific enzyme activity for mesotrione is 0.87U / mgprotein.

[0066] Example 3. Detoxification effect of Mdmnr on mesotrione

[0067] In a 100mL enzyme reaction system, mesotrione was added to final concentrations of 4μM, 8μM, and 12μM, respectively. An appropriate amount of purified Mdmnr was then added. The reaction was incubated at 30°C for 5-6 hours to completely degrade the mesotrione. The reaction was terminated by placing the reaction mixture in boiling water for 1 minute. After freeze-drying the enzyme reaction mixture, 2mL of methanol was added to dissolve the lyophilized material. The methanol solution was then allowed to evaporate naturally, and the residue was dissolved in pure water to obtain the degradation product.

[0068] The recombinant strain E. coli (pet-29a-OsHPPD) was introduced with a rice HPPD (OsHPPD) that is sensitive to mesotrione. Therefore, in this experiment, it was used to detect the inhibitory activity of the product of mesotrione degradation by Mdmnr against OsHPPD. The recombinant strain E. coli BL21 (pET-29a-OsHPPD) was inoculated into a 96-well plate containing TLB medium (LB containing 0.1% Tyr), and the inducer IPTG was added at the same time. Then, 0μM, 4μM, 8μM and 12μM of mesotrione and degradation products were added respectively. After culturing for 36 hours, the color changes under different concentration treatments were observed. The results are shown in Figure 2. Figure 5 As shown, the control without mesotrione was red, indicating that OsHPPD was normally expressed and active; the treatment with 2 μM or higher concentration of mesotrione was light yellow, indicating that OsHPPD activity had been completely inhibited; and the products of mesotrione degradation by Mdmnr were all red, with no significant difference from the control without mesotrione, indicating that the degradation products had no inhibitory effect on OsHPPD.

[0069] Therefore, in summary, Mdmnr can completely convert mesotrione into products that have no inhibitory effect on OsHPPD, thereby achieving the degradation and detoxification of mesotrione.

[0070] Example 4: Construction of rice expression vector for the nitroreductase gene mdmnr and Agrobacterium transformation

[0071] The rice transgenic vector pCUbi1390 was used to exogenously express the nitroreductase gene mdmnr. The pUC-Mdmnr plasmid in Example 2 was used as a template and primers (forward primer: 5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGAATGAAGTCATTCACACCCTA ACTGAAC-3' and reverse primer: 5'- GACTCCTCTTAGAATTCCCGGGGATCC The nitroreductase gene mdmnr DNA sequence was amplified using the same conditions as in Example 2.2 (SEQ ID NO: TCACTTATATTTGAAACCCTGTTTG CGCA-3', with the homology arms of pCUbi1390 underlined). The pCUbi1390 vector was linearized with the endonuclease BamHI and ligated with the mdmnr fragment to construct the corresponding transgenic vector mdmnr-pCUbi1390. The vector construction steps were the same as in Example 2.3. After the transformants were verified by sequencing, the plasmid was extracted and used for later use.

[0072] Using the heat shock method, 1 μL of the above plasmid was added to 100 μL of slowly thawed competent cells of the Agrobacterium strain EHA105 (Weidi Biotechnology, China). The cells were quickly frozen in liquid nitrogen for 5 minutes, in a 42°C water bath for 5 minutes, and placed on ice for 5 minutes. 500 μL of LB liquid medium was added and the cells were recovered and incubated at 28°C with shaking for 3 hours. The cells were centrifuged and the supernatant was removed. Approximately 100 μL of the culture medium was retained to resuspend the cells, spread evenly on a solid LB medium plate containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and incubated inverted at 28°C for approximately 36 hours. To prevent individual colonies from having low infection activity, three single Agrobacterium clones from each plasmid were selected for Agrobacterium-mediated rice transformation.

[0073] Example 5: Agrobacterium-mediated genetic transformation of rice and identification of transgenic plants

[0074] 5.1 Obtaining callus tissue: Select plump and healthy seeds of the rice variety Nipponbare and shell them; surface sterilize them in 70% ethanol for 1 minute with continuous shaking; then sterilize them with 3% sodium hypochlorite containing 1 drop of Tween-20 for 30 minutes with shaking on a shaker; wash them with sterile distilled water 5 times, each time for about 2 minutes with continuous shaking; then use tweezers to pick out the washed seeds and place them in a culture dish covered with 5 layers of sterile filter paper, spread the seeds evenly on the filter paper, and then cover them with 5 layers of filter paper to dry the seeds; 15 seeds are placed on a callus induction solid medium (N6 salts, 4 g; inositol, 0.1 g; proline, 2.8 g; hydrolyzed casein, 0.3 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; phytogel, 4 g; add deionized water to 1 L; autoclave) so that the endosperm is buried in the culture medium, the embryo is exposed to the surface of the culture medium, and the scutellum is just in contact with the culture medium; the culture dish is placed in a 28°C culture room under long-day conditions (16 h light / 8 h dark) for about 4 weeks, until a large number of firm, tender yellow calli are grown.

[0075] 5.2 Agrobacterium preparation and co-cultivation: Three single Agrobacterium colonies containing the nitroreductase mdmnr expression vector were picked up with a sterile toothpick and inoculated into 20 mL of liquid LB medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin. The culture was shaken for 36 h, centrifuged at 5000 rpm for 2 min, and the cells were resuspended in 1 mL of liquid N6 medium (N6 salts, 4 g; inositol, 0.1 g; casein hydrolyzate, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water to 1 L; autoclaved; and after cooling, 100 mM acetosyringone, 1 mL) and the bacterial suspension concentration was determined using a UV spectrophotometer. The Agrobacterium suspension was then diluted with liquid N6 medium to an OD of 0. 600 =0.08; using tweezers that had been sterilized at 300°C and then cooled, pick up rice callus pieces and immerse them in the diluted Agrobacterium solution, leaving them to stand for 20 minutes; discarding the Agrobacterium solution, picking up rice callus pieces with sterile tweezers, placing them in a culture dish covered with 5 layers of sterile filter paper, spreading the callus, and then covering it with 5 layers of filter paper, and drying the callus for 2 hours; adding 500 μL of liquid N6 medium to the co-culture plate, placing a sterile filter paper with a diameter equivalent to that of the culture dish on the surface of the medium to evenly soak the filter paper with the liquid, and then placing the dried callus on the co-culture medium (N6 salt, 4 g; inositol, 0.1 g; casein hydrolyzate, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL) covered with filter paper. 2,4-D (1 mL); phytogenin (4 g); deionized water (1 L); autoclave; after cooling, add 100 mM acetosyringone (1 mL); seal the culture dish containing the callus with breathable tape (3M, USA), wrap the culture medium with tin foil, and culture at 25°C in the dark for 3 days.

[0076] 5.3 Screening of positive callus: Use sterile forceps to wash the co-cultivated callus five times with sterile water and once with sterile distilled water containing 500 μg / mL carbenicillin sodium. Place the callus in a culture dish covered with five layers of sterile filter paper, spread the callus, cover it with five layers of filter paper, and allow it to dry. Transfer the dried callus to recovery medium (N6 salts, 4 g; inositol, 0.1 g; casein hydrolyzate, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; add 250 mg / mL carbenicillin, 1 mL) and culture in a 28°C incubator under long-day conditions (16 h light / 8 h dark) for 3 days. Use sterile tweezers to transfer the recovered callus to a selection medium (N6 salts, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; add 200 mg / mL carbenicillin sodium, 1 mL; add 50 mg / mL hygromycin B, 1 mL) containing 50 μg / mL hygromycin and culture under long-day conditions for 2 to 4 weeks until new, firm, tender yellow callus emerges.

[0077] 5.4 Regeneration and Culture of Transgenic Plants: Use sterile forceps to transfer newly grown hygromycin-resistant calli on the screening medium to regeneration medium (MS salts, 4.33 g; hydrolyzed casein, 2 g; sorbitol, 30 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; after cooling, add 200 mg / mL carbenicillin sodium, 1 mL; add 50 mg / mL hygromycin B, 1 mL; 1 mg / mL NAA, 20 μL; 1 mg / mL Kinetin, 2 mL) and cultured under long-day conditions (16 h light / 8 h dark) for 2 to 4 weeks until green seedlings grew; the green seedlings were removed with sterile tweezers and placed on solid 1 / 2 MS medium containing 25 μg / mL hygromycin until the seedlings grew to 5 to 8 cm; the seedlings were removed, washed, placed in clean water, and hardened in a 28°C incubator under long-day conditions for 3 to 5 days; the transgenic seedlings were transplanted into soil and planted in a 32°C greenhouse under long-day conditions; when the transgenic plants grew to the 4-5 leaf stage, DNA from surviving transgenic seedlings was extracted using a plant DNA extraction kit (Kangwei Century, China), and PCR verification was performed using mdmnr gene-specific primers (forward primer: 5'-ATGAATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'-TCACTTATATTTGAAACCCTGTTTGCGCA-3') (amplification conditions were the same as in Example 2.2). Individual plants that could amplify the target band were transgenic-positive plants.

[0078] Example 6: Herbicide treatment of transgenic plants expressing the nitroreductase gene mdmnr and wild-type rice

[0079] Progeny of 10-15 transgenic rice plants expressing the mdmnr nitroreductase gene were selected and planted in soil alongside wild-type rice. DNA was extracted from each plant when the seedlings reached the three-leaf stage and used as a template for amplification using mdmnr gene-specific primers (forward primer: 5'-ATGAATGAAGTCATTCACACCCTAACTGAAC-3' and reverse primer: 5'-TCACTTATATTTGAAACCCTGTTTGCGCA-3') (amplification conditions were the same as in Example 2.2). Transgenic lines harboring a single insertion were selected based on a Mendelian segregation ratio of 1:3 (plants without the target band:plants with the target band) and retained for continued cultivation until the 4-5 leaf stage.

[0080] Transgenic rice expressing the nitroreductase gene mdmnr and wild-type rice were treated with 900 μM mesotrione. The rice plants were sprayed on the leaves using a pressure sprayer (GARDENA, Germany), ensuring that the droplets were evenly distributed on the leaf surface. After two weeks of cultivation at 28°C under long-day conditions, the growth of the corresponding plants was observed, and individual plants from representative independent lines were photographed and recorded. Figure 6 The results showed that wild-type rice plants exhibited significant phytotoxicity after being sprayed with mesotrione, withered and yellowed leaves. However, transgenic plants expressing the mdmnr nitroreductase gene showed no significant phytotoxicity. This suggests that the mdmnr nitroreductase gene can confer significant mesotrione resistance in transgenic rice.

[0081] Although specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and substitutions may be made to those details in light of all disclosed teachings, all of which fall within the scope of protection of the present invention. The full scope of the present invention is given by the appended patent claims and any equivalents thereof.

Claims

1. A mesotrione nitroreductase Mdmnr, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

2. The gene mdmnr encoding the mesotrione nitroreductase Mdmnr according to claim 1.

3. The coding gene mdmnr according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

4. A recombinant expression vector containing the mdmnr encoding gene according to claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that it is obtained by recombining the coding gene mdmnr according to claim 2 into the vector pET-29a(+).

6. A genetically engineered bacterium containing the mdmnr encoding gene according to claim 2 or 3.

7. The genetically engineered bacterium according to claim 6, characterized in that The expression strain of the genetically engineered bacteria is Escherichia coli BL21 (DE3).

8. Use of the mesotrione nitroreductase Mdmnr according to claim 1 in the biodegradation, detoxification and remediation of mesotrione residue pollution.

9. Use of the encoding gene mdmnr according to claim 2 in the preparation of a mesotrione-degrading preparation.

10. Use of the encoding gene mdmnr according to claim 2 in biodegradation, detoxification and remediation of mesotrione residue pollution.

Citation Information

Patent Citations

  • Mesotrione degrading bacterium Klebsiella pasteurii CM-1 and application thereof

    CN116064296A

  • Mesotrione nitroreductase as well as coding gene and application thereof

    CN118480520A