Mesotrione nitroreductase as well as coding gene and application thereof

Abstract

The invention discloses a novel mesotrione nitroreductase Wmnrs, a coding gene wmnrs of the novel mesotrione nitroreductase Wmnrs and application of the novel mesotrione nitroreductase Wmnrs and the coding gene wmnrs. The novel mesotrione nitroreductase Wmnrs can degrade mesotrione into 2-amino-4-methylsulfonyl benzoic acid (AMBA) to lose activity. After the gene is introduced into a plant, the plant with mesotrione-resistant transgene can be cultivated. The mesotrione nitroreductase Wmnrs and the coding gene of the mesotrione nitroreductase Wmnrs have potential application value in bioremediation of mesotrione residue pollution.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, and relates to a nitroreductase of nitrosulfonyl nitrate, its encoding gene, and its applications. Background Technology

[0002] Herbicide-resistant transgenic technology has enabled efficient and low-cost weed control in farmland while ensuring safe crop production, significantly changing traditional weed management models. As of 2023, the global planting area of ​​transgenic crops reached 206.3 million hectares, with glyphosate-resistant transgenic varieties dominating, covering approximately 185 million hectares, accounting for over 90% of the total transgenic crop planting area. However, the long-term, large-scale use of glyphosate has accelerated the evolution of weed resistance. More than 40 major farmland weeds have been reported to have developed resistance to glyphosate globally, seriously threatening its sustained control efficacy. Against this backdrop, developing and applying herbicides with different mechanisms of action, and simultaneously constructing corresponding herbicide-resistant transgenic crops, is considered an effective strategy to alleviate the weed resistance problem. Therefore, systematically exploring resistance gene resources for multiple herbicides is of great significance for constructing novel herbicide-resistant transgenic crops.

[0003] 4-hydroxyphenylpyruvate dioxygenase (HPPD, EC1.13.11.27) is a key enzyme in the tyrosine metabolic pathway in aerobic organisms. First, tyrosine is converted to 4-hydroxyphenylpyruvate (4-HPP) under the catalysis of tyrosine aminotransferase (TAT). Subsequently, 4-HPP is converted to homogentisic acid (HGA) under the catalysis of HPPD. Homogentisic acid is an important precursor for the biosynthesis of plastoquinone and tocopherol in plants. Plastoquinone is a cofactor of photosynthesis, promoting the synthesis of carotenoids, while tocopherol plays an important role in enhancing plant stress resistance. HPPD inhibitor herbicides competitively inhibit HPPD enzyme activity, leading to the blockage of normal tyrosine metabolism in plants. This results in a lack of carotenoids in plants, inducing weakened chlorophyll photo-oxidation, affecting plant photosynthesis, and ultimately causing chlorosis and death. Therefore, researchers' use of HPPD as a novel herbicide target enzyme has important guiding significance for the development of new herbicides.

[0004] Based on their chemical structure, HPPD inhibitor herbicides can be classified into triketones (such as mesotrione, sulfadiazine, and bicyclosulfadiazine), pyrazolones (such as benzoxazole, sulfadiazine, and pyrazosulfuron), and isoxazolones (such as isoxadiazon). Mesotrione, also known as methyl sulfadiazine, is a triketone herbicide developed by Syngenta in 1984. It has broad-spectrum herbicidal activity and can effectively control most broadleaf weeds and some grassy weeds. Although mesotrione has advantages such as high efficiency, low toxicity, good crop selectivity, and high environmental compatibility, with long-term and large-scale application, the resistance of weeds to this type of herbicide in the field has become increasingly prominent, posing a challenge to its continued effective application. Therefore, discovering and obtaining new genes related to nicosulfuron degradation, detoxification, or resistance, and developing transgenic crops based on these genes, is of great theoretical significance and practical application value for delaying resistance evolution, ensuring the safety of herbicide application, and promoting the sustainable development of modern agriculture. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is a nitroreductase Wmnrs that has the function of degrading nitroreductone.

[0006] Another technical problem to be solved by the present invention is to provide the encoding gene wmnrs for the nitroreductase Wmnrs.

[0007] Another technical problem that the present invention also addresses is to provide an expression cassette, recombinant vector, recombinant cell or recombinant bacterium containing the encoding gene wmnrs.

[0008] Another technical problem to be solved by the present invention is to provide the application of the aforementioned mesotrione nitroreductase Wmnrs, the aforementioned encoding gene wmnrs, the aforementioned expression cassette, recombinant vector, recombinant cell or recombinant bacteria in plant herbicide resistance.

[0009] Another technical problem to be solved by the present invention is to provide the application of the aforementioned nitroreductase Wmnrs, the aforementioned encoding gene wmnrs, the aforementioned expression cassette, recombinant vector, recombinant cells or recombinant bacteria in the degradation, detoxification and / or repair of nitroreductone.

[0010] Another technical problem that this invention aims to solve is to provide a method for obtaining herbicide-resistant plants.

[0011] The final technical problem solved by this invention is a method for identifying whether plants obtained by the method possess herbicide resistance.

[0012] Technical solution: To solve the above technical problems, the present invention provides a nitroreductase Wmnrs, the amino acid sequence of which is shown in SEQ ID NO.2.

[0013] The present invention also includes the encoding gene wmnrs of the nitroreductase Wmnrs, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0014] The present invention also includes expression cassettes, recombinant vectors, recombinant cells or recombinant bacteria containing the aforementioned coding gene wmnrs.

[0015] The recombinant vector is obtained by introducing the encoding gene wmnrs into a plasmid. The recombinant vector is obtained by homologous recombination of the nitroreductase gene wmnrs with a linearized pET-28a(+) plasmid.

[0016] The recombinant bacteria are obtained by introducing the recombinant vector into the host bacteria.

[0017] The host bacterium is *Escherichia coli* or *Agrobacterium*. The *Escherichia coli* includes *E. coli* BL21(DE3).

[0018] The present invention also includes the application of the aforementioned nitroreductase Wmnrs, the aforementioned encoding gene wmnrs, the aforementioned expression cassette, recombinant vector, recombinant cells or recombinant bacteria in plant herbicide resistance.

[0019] The present invention also includes the application of the aforementioned nicosulfuron nitroreductase Wmnrs, the aforementioned encoding gene wmnrs, the aforementioned expression cassette, recombinant vector, recombinant cells or recombinant bacteria in the biodegradation, detoxification and / or remediation of nicosulfuron residual pollution.

[0020] The present invention also includes a method for obtaining herbicide-resistant plants, comprising the following steps:

[0021] 1) To induce the expression of the aforementioned nitroreductase Wmnrs in plants; or

[0022] 2) To make the plant contain the aforementioned encoding gene wmnrs; preferably, the method of obtaining it includes transgenic, hybridization, backcrossing or asexual reproduction steps.

[0023] The present invention also includes a method for identifying the plant obtained by the method, comprising the following steps:

[0024] 1) Identify whether the plant expresses the nitroreductase Wmnrs; or

[0025] 2) Identify whether the plant contains the encoding gene wmnrs.

[0026] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention provides a novel nicosulfuron nitroreductase Wmnrs and its encoding gene wmnrs. This enzyme can degrade nicosulfuron into 2-amino-4-methanesulfonylbenzoic acid (AMBA), rendering it inactive. When this gene is introduced into plants, plants resistant to nicosulfuron can be cultivated. The nicosulfuron nitroreductase Wmnrs and its encoding gene of this invention have potential application value in the bioremediation of nicosulfuron residue pollution. Attached Figure Description

[0027] Figure 1 A phylogenetic tree of 16S rRNA genes constructed for strain B05 and the closest related type strain;

[0028] Figure 2 Figure 1 shows the HPLC detection results of nicosulfuron-methyl degradation by strain B05; Figure 2 shows the detection results of nicosulfuron-methyl standard sample at a wavelength of 270 nm; Figure 3 shows the detection results of 2-amino-4-methanesulfonylbenzoic acid (AMBA) standard sample at a wavelength of 355 nm; Figure 4 shows the detection results of nicosulfuron-methyl degradation by strain B05 at a wavelength of 270 nm after 0 h; Figure 5 shows the detection results of nicosulfuron-methyl degradation by strain B05 at a wavelength of 355 nm after 0 h; Figure 6 shows the detection results of nicosulfuron-methyl degradation by strain B05 at a wavelength of 270 nm; Figure 7 shows the detection results of nicosulfuron-methyl degradation by strain B05 at a wavelength of 355 nm after 24 h.

[0029] Figure 3 SDS-PAGE results of exogenous Wmnrs expression; Lane M: Marker; Lane 1: Crude enzyme solution after Wmnrs disruption; Lane 2: Supernatant obtained by centrifugation after disruption; Lane 3: Bacterial cells obtained by centrifugation after disruption; Lane 4: Purified Wmnrs (300 mM imidazole);

[0030] Figure 4 Figure 1 shows the HPLC detection results of Wmnrs degradation of nicosulfuron; Figure 2 shows the detection results of Wmnrs degradation of nicosulfuron at 270 nm after 0 h; Figure 3 shows the detection results of Wmnrs degradation of nicosulfuron at 355 nm after 0 h; Figure 4 shows the detection results of Wmnrs degradation of nicosulfuron at 270 nm after 1 h; Figure 5 shows the detection results of Wmnrs degradation of nicosulfuron at 355 nm after 1 h.

[0031] Figure 5 The inhibitory effects of different concentrations of nicosulfuron and its Wmnrs degradation products on rice HPPD (OsHPPD) are shown in the figure.

[0032] Figure 6 The effect of foliar application of nicosulfuron on the growth of transgenic WMNRS rice. Detailed Implementation

[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0034] The culture medium used in the embodiments of this invention:

[0035] The basic salt medium (MSM) formula for nicosulfuron is as follows: 1.5 g K2HPO4•3H2O; 0.5 g KH2PO4; 1.0 g NH4NO3; 0.5 g NaCl; 0.2 g MgSO4•7H2O. Add deionized water to a final volume of 1 L to obtain the liquid medium. For the solid medium, add 20.0 g agar per liter.

[0036] LB medium formulation: 5 g yeast extract; 10 g trypsin; 10 g sodium chloride; adjust pH to 7.0 with 1M NaOH solution.

[0037] Example 1: Isolation of nicosulfuron-degrading strains and screening of their nitroreductase genes

[0038] 1. Enrichment, isolation, and classification identification of nicosulfuron-degrading strains

[0039] Soil samples were collected from paddy fields that had been treated with nicosulfuron for a long period. 10 g of soil sample was added to 90 mL of basal salt medium containing 50 mg / L nicosulfuron and incubated at 30°C with shaking at 150 r / min for 6 days. Then, a 10% inoculum (v / v) was transferred to nicosulfuron basal salt medium and incubated at 30°C with shaking at 180 r / min for 6 days. This process was repeated 5 times. The degradation capacity of the enriched solution was then measured using a UV spectrophotometer. Compared to the control (no bacterial addition), the enriched solution showing degradation (OD value decreasing trend) was serially diluted. Specifically, 1 mL of the enriched solution was added to 9 mL of basal salt medium, and then serially diluted in increments of 10 mL. -3 10 -4 and 10 -5 The solution was diluted and then spread onto LB agar plates. The plates were incubated at 30°C for approximately 3 days. Single colonies of different shapes, colors, and sizes were picked from the plates and further purified by streaking on LB agar plates. The resulting pure cultures were inoculated into liquid medium containing 100 mg / L nicosulfuron-methyl salt and incubated at 30°C and 180 r / min for 6 days to verify whether each pure strain had the function of degrading nicosulfuron-methyl.

[0040] A strain capable of degrading nicosulfuron was obtained through enrichment, domestication, isolation, and screening, and named B05. After 2 days of growth on solid medium, strain B05 colonies were milky white, smooth, opaque, with irregular edges, and approximately 1.5 mm in diameter; the bacterial cells were spherical (0.8–1.0 × 1.0–1.5 µm), Gram-positive, and showed no spore formation. Using the genomic DNA of strain B05 as a template, PCR amplification was performed using universal primers for bacterial 16S rRNA gene sequencing, yielding a 1407 bp 16S rRNA gene sequence. The sequence was then analyzed in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and EZtaxon databases (…). http: / / eztaxon-e.ezbiocloud.net / ezt Blast analysis was performed, and the results showed that strain B05 was most closely related to strains of the genus *Staphylococcus*, and specifically to *Staphylococcus saprophyticus* ATCC 15305. T The homology was as high as 99%. In the phylogenetic tree constructed from the 16S rRNA gene, strain B05 also clustered in the genus *Staphylococcus*. Figure 1 Therefore, strain B05 was preliminarily identified as belonging to the genus Staphylococcus.

[0041] 2. Study on the degradation characteristics of mesotrione by strain B05

[0042] Single colonies of strain B05 were picked and cultured in 20 mL of LB broth at 30°C and 180 r / min in a shaker until the logarithmic growth phase. The cells were then collected by centrifugation at 4°C and 8000 rpm for 5 min. The cells were washed three times with sterile basal salt medium and resuspended in basal salt medium, adjusting the bacterial concentration to approximately 1.0 × 10⁻⁶. 9 The strain was inoculated at a concentration of cfu / mL, at a 1% (v / v) inoculum into 20 mL of basal salt medium containing 100 mg / L nicosulfuron, and cultured at 30°C and 180 r / min for 24 h. Samples were taken periodically and the degradation of nicosulfuron by the strain was determined by HPLC. Figure 2 The results showed that strain B05 could almost completely degrade 100 mg / L of nicosulfuron within 24 h. Specifically, liquid chromatography analysis showed that the retention time of the nicosulfuron standard was 15.768 min. Figure 2 A and Figure 2 The C32-amino-4-methanesulfonylbenzoic acid (AMBA) standard has a characteristic absorption peak at 5.573 min. Figure 2 (B in the text). After treatment with strain B05, nicosulfuron showed a characteristic absorption peak at 15.768 min ( ). Figure 2The peak (E) almost completely disappeared, and a new peak appeared at 5.573 minutes, which corresponds perfectly to the peak time of the AMBA standard. Figure 2 (F in the formula), therefore strain B05 converts nicosulfuron into product AMBA through nitro reduction.

[0043] Example 2 Cloning and Functional Verification of the Nitroreductase Gene of Nitrosulfanilamide

[0044] 1. Genome sequencing and nitroreductase identification of strain B05

[0045] Genome sequencing was performed on strain B05 (Wuhan Bena Technology Co., Ltd., China). The obtained genome draft was uploaded to the Rast website (https: / / rast.nmpdr.org / ) for annotation. The annotated amino acid sequences were downloaded, and a local protein database was constructed using Bioedit software. ORF analysis of the B05 genome data revealed 2845 ORFs, one of which was a suspected nitroreductase gene, named wmnrs. Alignment with the Swissprot database on NCBI (https: / / blast.ncbi.nlm.nih.gov / ) showed that Wmnrs had the highest similarity (46%) to previously reported nitroreductases. Its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing, with a nucleotide sequence of 753 bp, encoding a 251-amino acid protein (Wmnrs), the amino acid sequence of which is shown in SEQ ID NO.2.

[0046] 2. Synthesis and amplification of the wmnrs gene

[0047] The nucleotide sequence (753 bp) of the wmnrs gene shown in SEQ ID NO.1 was synthesized by Beijing Qingke Biotechnology Co., Ltd., encoding the Wmnrs protein (251 aa) shown in SEQ ID NO.2 of the sequence listing. The synthesized wmnrs gene was cloned into the pUC57 vector digested with BamHI and EcoRI, and the recombinant vector was named pUC-wmnrs, which was then transformed into E. coli DH5α. Using the forward primer: 5'-TAAGAAGGAGATATACCATGtctgaacacgtttacaacctactg-3' and the reverse primer: 5'-TGGTGGTGGTGGTGCTCGAGtttttttataaatcctgatttatttaactgttctaacat-3' (homologous arms of pET-28a(+)) as primers, the wmnrs gene fragment was amplified from the plasmid vector pUC-wmnrs by PCR.

[0048] The PCR amplification system is shown in Table 1:

[0049] Table 1 PCR amplification system

[0050] The PCR amplification program was as follows: a. Denaturation at 95℃ for 30 s; b. Denaturation at 95℃ for 10 s, annealing at 55℃ for 10 s, extension at 72℃ for 30 s, for 35 cycles; c. Extension at 72℃ for 10 min, and hold at 4℃.

[0051] PCR products were purified and recovered using a gel purification kit (FastPure® Gel DNA Extraction Mini Kit, DC301-01, Novizan). For specific methods, please refer to the kit instructions.

[0052] 3. Reverse amplification of plasmid pET-28a(+)

[0053] Using the forward primer: 5'-CTCGAGCACCACCACCACCACCACT-3' and the reverse primer: 5'-CATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGTTATCCGCT-3' as the primer pair, the pET-28a(+) fragment of plasmid (Qingke, China) was reverse amplified.

[0054] The PCR amplification system is shown in Table 2.

[0055] Table 2 PCR amplification system

[0056] PCR amplification program: a. Denaturation at 95℃ for 30 s; b. Denaturation at 95℃ for 10 s, annealing at 63℃ for 10 s, extension at 72℃ for 3 min, for 30 cycles; c. Extension at 72℃ for 10 min, hold at 4℃.

[0057] PCR products were purified and recovered using a gel purification kit. For specific methods, please refer to the kit instructions.

[0058] 4. Construction of expression vector pET-28a(+)-wmnrs and screening of positive transformants

[0059] The pET-28a(+) fragment amplified in step 3 and the wmnrs gene fragment recovered from the gel in step 2 were subjected to homologous recombination according to the instructions of the ClonExpress® II One Step Cloning Kit (C112-01, Novizan). The homologous recombination system is shown in Table 3. The reaction volume was 10 μL, and the ligation was carried out at 37℃ for 30 min to obtain the homologous recombination product.

[0060] Table 3 Homologous Recombination System

[0061] Take one tube of E. coli BL21(DE3) competent cells (100 µL) from -80℃, thaw it in ice, add 10 µL of homologous recombinant product, gently tap the tube with your finger to mix it evenly, then let it stand on ice for 30 min, heat shock it in a 42℃ water bath for 60 s, then immediately reinsert the centrifuge tube into ice, add 300 µL of LB medium 2 min later, place the centrifuge tube in a 37℃ shaker at 180 rpm for 1 h to recover. Then, centrifuge at 5,000 rpm for 3 min, discard 300 µL of supernatant, leaving about 100 µL. Mix the bacterial cells with a pipette, and evenly spread 100 μL of the bacterial solution onto an LB agar plate containing 100 mg / L kanamycin. Incubate overnight at 37°C. Pick single colonies that have grown, and sequence them to verify that the target gene wmnrs is ligated into the vector and has 6 His-tags at the end. Store this transformant BL21(pET-28a-wmnrs) for later use.

[0062] 5. Expression and purification of Wmnrs

[0063] BL21 (pET-28a-wmnrs) was cultured in 100 mL LB liquid medium at 37°C and 150 rpm on a shaker until the OD600 nm reached between 0.4 and 0.6. IPTG was then added to a concentration of 0.05 mM, and the culture was induced at 16°C for 15 h. The bacterial cells were collected by centrifugation of 100 mL of the culture, washed twice with PBS (50 mM, pH 7.4), resuspended in 10 mL of PBS buffer, and sonicated (Auto Science, UH-650B ultrasonic processor, 35% intensity) for 8 min. The cells were then centrifuged at 12000 rpm for 30 min, and the supernatant was collected. 2+ Wmnrs was purified using an ion affinity chromatography column, and the purified enzyme was then subjected to protein electrophoresis. (See attached image.) Figure 3 . Figure 3 The results showed that Wmnrs purified protein was successfully obtained by affinity chromatography.

[0064] 6. Enzyme activity detection of Wmnrs

[0065] Enzyme reaction system (1 mL): 50 mM PBS buffer (pH 7.4), 5 mM dithiothreitol, 100 μM nicosulfuron, 1 mM NAD(P)H, 50 μL of purified Wmnrs protein prepared in step 5, reacted at 30℃ for 1 h. Timing for each reaction began with enzyme addition, and the reaction was terminated by standing in boiling water for 1 min after 1 h. After freeze-drying, the reaction solution was dissolved in 200 μL of methanol, and the lyophilized material was dissolved in a vortex mixer. The reduction in nicosulfuron substrate was then detected by HPLC. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the reduction of 1 μM nicosulfuron per minute at pH 7.4 and 30℃. The HPLC analysis results of the degradation of nicosulfuron by the nitroreductase Wmnrs are as follows: Figure 4 , Figure 4 The results of C in the study showed that after 1 h of enzyme reaction, the absorption peak of nitrosulfuron at 15.768 min decreased significantly, and simultaneously, from Figure 4 As can be seen from D, the characteristic absorption peak of AMBA appeared at 5.573 min, indicating that Wmnrs can reduce nitrosulfonyl to AMBA and has nitrosulfonyl reductase activity, with a specific enzyme activity of 84.3 U / mg protein for nitrosulfonyl.

[0066] Example 3: Effect of Wmnrs on the degradation and detoxification of nicosulfuron.

[0067] In a 20 mL enzyme reaction system (the same as the enzyme reaction system in Example 2), nicosulfuron was added to achieve final concentrations of 4 μM, 8 μM, and 12 μM, respectively. Then, an appropriate amount of purified Wmnrs was added, and the reaction was carried out at 30°C for 5–6 h to allow complete degradation of nicosulfuron. The reaction was terminated by placing the mixture in boiling water for 1 min. After freeze-drying the enzyme reaction solution, 2 mL of methanol was added to dissolve the freeze-dried product. The methanol solution was then allowed to evaporate naturally, and the residue was dissolved in pure water to obtain the degradation product.

[0068] Using the same method as in Example 2, the OsHPPD gene (genbank accession number: NM_001409339) was ligated with the pET-28a vector digested with restriction enzymes BamHI and EcoRI to construct the plasmid pET-28a-OsHPPD. The plasmid pET-28a-OsHPPD was introduced into the strain E. coli BL21 to obtain the recombinant strain E. coli BL21 (pET-28a-OsHPPD).

[0069] The recombinant strain *E. coli* BL21 (pET-28a-OsHPPD) was introduced into a rice HPPD strain (OsHPPD) sensitive to nicosulfuron and its degradation products. Therefore, it was used in this experiment to detect the inhibitory activity of the nicosulfuron degradation products by *Wmnrs* on OsHPPD. The recombinant strain *E. coli* BL21 (pET-28a-OsHPPD) was inoculated into 96-well plates containing TLB medium (LB medium supplemented with 0.1% tyrosine) (E. coli BL21 competent cells were purchased from Qingke, China), and IPTG was added as an inducer. Then, nicosulfuron and its degradation products were added at final concentrations of 0 μM, 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 40 μM, and 50 μM, respectively. After culturing for 36 h, the color changes under different concentration treatments were observed. The results are as follows: Figure 5 As shown, the control group without nicosulfuron was red, indicating that OsHPPD was normally expressed and active; the treatment with 5 μM or higher concentrations of nicosulfuron was pale yellow, indicating that OsHPPD activity was completely inhibited; and the treatment with Wmnrs' nicosulfuron degradation products was red, with no significant difference from the control group without nicosulfuron, indicating that the degradation products had no inhibitory effect on OsHPPD.

[0070] In summary, Wmnrs can completely convert nicosulfuron into a product that has no inhibitory effect on OsHPPD, thereby achieving the degradation and detoxification of nicosulfuron.

[0071] Example 4: Construction of rice expression vector for nitroreductase gene wmnrs and Agrobacterium transformation

[0072] The rice transgenic vector pCUbi1390 (A rapid and efficient method for constructing plant expression vectors, Han Kai, Weng Jianfeng, Hao Zhuanfang, Li Xinhai, Li Mingshun, Zhang Degui, Bai Li, Zhang Shihuang, Xue Jiquan, Xie Chuanxiao, 2012, Maize Science) was used for exogenous expression of the nitroreductase gene wmnrs. Using the pUC-wmnrs plasmid from Example 2 as a template, primers (forward primer: 5'-) were used. ACTAGGTACCTGCAGGTCGACGGATCC ATGTCTGAACACGTTTACAACCTACTG-3' and reverse primer: 5'- GACTCCTCTTAGAATTCCCGGGGATCCThe DNA fragment of the nitroreductase gene wmnrs was amplified (the underlined part is the homologous arm of pCUbi1390), and the amplification conditions were the same as in step 2 of Example 2. The pCUbi1390 vector was linearized using the restriction enzyme BamHI and ligated with the wmnrs fragment to construct the corresponding transgenic vector wmnrs-pCUbi1390. The vector construction steps were the same as in step 4 of Example 2. After the transformants were sequenced and verified, the plasmid was extracted for later use.

[0073] Using a heat shock method, 1 μL of the above plasmid was added to 100 μL of slowly thawed Agrobacterium strain EHA105 competent cells (Weidi Bio, China). The cells were flash-frozen in liquid nitrogen for 5 min, incubated in a 42℃ water bath for 5 min, placed on ice for 5 min, and then 500 μL of LB broth was added. The cells were incubated at 28℃ with shaking for 3 h. After centrifugation, some supernatant was removed. Approximately 100 μL of the culture medium was retained to resuspend the cells, and the suspension was evenly spread onto solid LB agar plates containing 50 μg / mL rifampin and 50 μg / mL kanamycin. The plates were then incubated upside down at 28℃ for approximately 36 h. To prevent individual colonies from infecting low-activity organisms, three single colonies from each plasmid were selected for Agrobacterium-mediated transformation of rice.

[0074] Example 5: Agrobacterium-mediated genetic transformation of rice and identification of transgenic positive plants

[0075] 1. Acquisition of callus tissue

[0076] Select plump and healthy seeds of the Nipponbare rice variety and remove the husks; surface sterilize in 70% ethanol for 1 min, shaking continuously in the petri dish; then sterilize with 3% sodium hypochlorite containing 1 drop of Tween-20 for 30 minutes, shaking on a shaker at 120 r / min; wash 5 times with sterile distilled water, about 2 minutes each time, shaking continuously; then use tweezers to remove the washed seeds and place them in a petri dish lined with 5 layers of sterile filter paper, spreading the seeds evenly on the filter paper, and then covering them with 5 more layers of filter paper to dry the seeds; place 15 seeds in callus induction solid medium (N6 salt, 4 g; inositol, 0.1 g; proline, 2.8 g; hydrolyzed casein, 0.3 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; plant gel (Beijing Solarbio Science & Technology Co., Ltd., catalog number P8170), 4 g; add deionized water to 1 On the L; autoclave), the endosperm is buried in the culture medium, the embryo is exposed on the surface of the culture medium, and the scutellum is just in contact with the culture medium; the culture dish is placed in a 28°C culture room and cultured under long-day conditions (16h light / 8h darkness) for about 4 weeks until a large number of firm, light yellow callus masses grow.

[0077] 2. Preparation and co-culture of Agrobacterium

[0078] Using sterile toothpicks, three single colonies of Agrobacterium containing the nitroreductase wmnrs expression vector, obtained in Example 4, were collected and inoculated into 20 mL of liquid LB medium containing 50 μg / mL rifampin and 50 μg / mL kanamycin. The cultures were incubated at 30°C with shaking at 180 r / min for 36 h. After centrifugation at 5000 rpm for 2 min, the bacterial cells were resuspended in 1 mL of liquid N6 medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water added to 1 L; autoclaved; cooled and then 1 mL of 100 mM acetylsylphenone added). The bacterial concentration was measured using a UV spectrophotometer. The Agrobacterium resuspension was then diluted to OD using liquid N6 medium. 600 = 0.08; After sterilization at 300℃ and cooling, use tweezers to pick up rice callus tissue blocks and immerse them in diluted Agrobacterium solution for 20 min; Discard the Agrobacterium solution, use sterile tweezers to pick up rice callus blocks and place them in a petri dish lined with 5 layers of sterile filter paper, spread the callus out, and then cover it with 5 more layers of filter paper. Dry the callus for 2 h; Add 500 μL of liquid N6 medium to the co-culture plate, place a piece of sterile filter paper with a diameter similar to that of the petri dish on the surface of the medium, and make sure the liquid evenly wets the filter paper. Then place the dried callus on the co-culture medium lined with filter paper (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; plant gel, 4 g; add deionized water to 1 L; autoclave; after cooling, add 100 mM acetylsyl syringone, 1 (mL); Seal the culture dish containing the callus tissue with breathable tape (3M, USA), then wrap the culture medium with aluminum foil, and co-culture at 25°C in the dark for 3 days;

[0079] 3. Screening of positive callus tissue

[0080] Using sterile forceps, the co-cultured callus was washed five times with sterile water, and then once with sterile distilled water containing 500 μg / mL carbenicillin sodium. The callus was placed in a petri dish lined with five layers of sterile filter paper, spread out, and then covered with another five layers of filter paper to allow it to dry. The dried callus was then transferred to recovery medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water to 1 L; autoclaving; cooling, then adding 250 mg / mL carbenicillin, 1 mL) and incubated at 28°C under long-day conditions (16 h light / 8 h dark) for 3 days. Using sterile forceps, the recovered callus was transferred to selection medium containing 50 μg / mL hygromycin (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water to 1 L; autoclaving; cooling, then adding 250 mg / mL carbenicillin, 1 mL) and incubated in a 28°C incubator for 3 days under long-day conditions (16 h light / 8 h dark). g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; after cooling, add 200 mg / mL carbenicillin sodium, 1 mL; add 50 mg / mL hygromycin B, 1 mL) and culture under long-day conditions for 2-4 weeks until new, firm, light yellow callus tissue grows out.

[0081] 4. Regeneration and culture of transgenic plants

[0082] Using sterile forceps, newly grown hygromycin-resistant callus from the selection medium was transferred to regeneration medium (MS salt, 4.33 g; hydrolyzed casein, 2 g; sorbitol, 30 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water to 1 L; autoclaving; after cooling, 200 mg / mL carbenicillin sodium, 1 mL; 50 mg / mL hygromycin B, 1 mL; 1 mg / mL NAA, 20 μL; 1 mg / mL Kinetin, 2 mL). The callus was cultured under long-day conditions (16 h light / 8 h dark) for 2–4 weeks until green seedlings emerged. The green seedlings were then removed using sterile forceps and placed in solid 1 / 2 MS medium containing 25 μg / mL hygromycin until the seedlings reached 5–8 cm in height. cm; Take out the seedlings, wash them, and place them in clean water. In a 28℃ incubator, harden them off under long-day conditions for 3-5 days; Transplant the transgenic seedlings into soil and plant them in a 32℃ greenhouse under long-day conditions; When the transgenic plants grow to the 4-5 leaf stage, use a plant DNA extraction kit (Kangwei Century, China) to extract the DNA from the surviving transgenic seedlings, and use wmnrs gene-specific primers (forward primer: 5'-ATGTCTGAACACGTTTACAACCTACTG-3' and reverse primer: 5'-TTTTTTATAAATCCTGATTTATTTAACTGTTCTAACAT-3') for PCR verification (amplification conditions are the same as step 2 of Example 2). The single plant that can amplify the target band is the transgenic positive plant.

[0083] Example 6: Herbicide treatment of transgenic plants expressing the nitroreductase gene wmnrs and wild-type rice

[0084] Ten to fifteen transgenic positive single plants of the nitroreductase gene wmnrs transgenic rice from Example 5 were selected and planted in soil, along with wild-type rice Nipponbare. When the seedlings reached the 3-leaf stage, DNA was extracted from each single plant as a template. Amplification and verification were performed using wmnrs gene-specific primers (forward primer: 5'-ATGTCTGAACACGTTTACAACCTACTG-3' and reverse primer: 5'-TTTTTTATAAATCCTGATTTATTTAACTGTTCTAACAT-3') (amplification conditions were consistent with step 2 of Example 2). Based on a Mendelian segregation ratio of 1:3 (plants without the target band: plants containing the target band), transgenic lines containing a single copy insertion were selected and retained for further cultivation until the 4-5 leaf stage.

[0085] Transgenic rice and wild-type rice containing the nitroreductase gene *wmnrs* were treated with 1000 μM nicosulfuron. Foliar spraying (150 g ai / ha) was applied to the rice using a pneumatic sprayer (GARDENA, Germany), ensuring even distribution of droplets on the leaf surface. After two weeks of cultivation in a 28℃ long-day environment, the growth of the plants was observed, and representative individual plants from independent lines were photographed and recorded. Figure 6 The results showed that wild-type rice plants exhibited significant phytotoxicity after being sprayed with nitrosulfuron-methyl, with leaves turning yellow and withering; however, transgenic plants with the nitroreductase gene wmnrs did not show obvious phytotoxicity. This indicates that the nitroreductase gene wmnrs can confer significant nitrosulfuron-methyl resistance to transgenic rice.

Claims

1. A nitroreductase Wmnrs, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

2. The encoding gene wmnrs for nicosulfuron nitroreductase according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

3. An expression cassette, a recombinant vector, a recombinant cell, or a recombinant bacterium, characterized in that, It contains the gene wmnrs as described in claim 2.

4. The recombinant vector according to claim 3, characterized in that, The recombinant vector is obtained by introducing the encoding gene wmnrs as described in claim 2 into a plasmid.

5. The recombinant bacteria according to claim 3, characterized in that, The recombinant bacteria are obtained by introducing the recombinant vector described in claim 3 or 4 into the host bacteria.

6. The recombinant bacteria according to claim 5, characterized in that, The host bacteria are Escherichia coli or Agrobacterium.

7. The application of the nitroreductase Wmnrs of claim 1, the encoding gene wmnrs of claim 2, the expression cassette, recombinant vector, recombinant cell or recombinant bacterium of claim 3, the recombinant vector of claim 4, and the recombinant bacterium of claim 5 or 6 in plant herbicide resistance.

8. The application of the nicosulfuron nitroreductase Wmnrs of claim 1, the encoding gene wmnrs of claim 2, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria of claim 3, the recombinant vector of claim 4, and the recombinant bacteria of claim 5 or 6 in the biodegradation, detoxification and / or remediation of nicosulfuron residual pollution.

9. A method for obtaining herbicide-resistant plants, characterized in that, Includes the following steps: 1) To induce the expression of the nitroreductase Wmnrs of nicosulfuron as described in claim 1 in plants; or 2) To make the plant contain the encoding gene wmnrs as described in claim 2; preferably, the method of obtaining it includes transgenic, hybridization, backcrossing or asexual reproduction steps.

10. A method for determining whether a plant obtained by the method of claim 9 possesses herbicide resistance, characterized in that, Includes the following steps: 1) To identify whether the plant expresses the nitroreductase Wmnrs described in claim 1; or 2) To identify whether the plant contains the encoding gene wmnrs as described in claim 2.

Images