C-terminal motif of rice D3 protein and application of biological material of C-terminal motif in regulation and control of rice tillering

Abstract

The invention discloses a C-terminal motif of rice D3 protein and application of a biological material of the C-terminal motif in regulation and control of rice tillering, and belongs to the technical field of biology. The application comprises the application of the CTH motif of the rice D3 protein in regulation and control of the rice tiller number or preparation of a product for regulating and controlling the rice tiller number or / and rice breeding. The invention shows that the CTH motif of D3 is very important for interaction of D3 and D14 in rice, and the tillering number of rice can be increased by deleting the CTH motif by using a CRISPR genome editing technology. The application also has the advantages that the CTH motif of the over-expressed D3 can finely adjust the signal feeling of strigolactones of the rice, the tillering number of the rice is moderately increased, and the CTH motif has a certain yield increasing potential.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of a C-terminal motif of rice D3 protein and biological materials thereof in regulating rice tillering. Background Art

[0002] Rice is one of the most important crops. The increasing world population has put forward higher and higher requirements for the improvement of rice yield. After decades of efforts by breeders, rice yield has been greatly improved, but it still cannot meet people's demand for total food. Rice plant type is a key factor in determining yield, which is mainly determined by plant height, tiller number, angle and panicle type.

[0003] Tillering is one of the important agronomic traits of rice. The number of tillers per plant is a key element of plant structure and greatly affects crop yield. In production practice, it is necessary to take appropriate cultivation and management measures according to the formation and development rules of tillers to promote effective tillers while inhibiting ineffective tillers. Therefore, studying the regulatory mechanism of rice tiller growth and development has important guiding significance for agricultural production.

[0004] Strigolactone is a hormone synthesized in the roots that inhibits plant branch formation. Strigolactone has a wide range of effects in plants. With the physiological and genetic studies of a series of dwarf multi-tillering mutants, some important members of the strigolactone synthesis and signaling pathways have been cloned in various model plants. The common characteristics of these member mutants are the loss of apical dominance and the release of lateral bud growth and development, resulting in a dwarf multi-branching phenotype. However, to date, people's understanding of the biosynthesis process and signal transduction pathway of strigolactone is still very limited, and its function in the growth and development of plants needs to be further explored.

[0005] The OsD3 gene comes from rice and is a signal component of the strigolactone pathway. Its main function is to control the rice plant type, including the number of rice tillers and plant height. Using the OsD3 gene to create a rice strigolactone receptor functional mutant to regulate the number of rice tillers, improve the plant type, and thus increase rice yield will have broad application prospects. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a polypeptide in the OsD3 gene that regulates the number of rice tillers. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned herein through the following description.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] The present invention provides the application of a CTH motif of a rice D3 protein in regulating the tillering number of rice or preparing a product for regulating the tillering number of rice or / and in rice breeding.

[0009] In the above application, the CTH motif is any one of the following;

[0010] A1) the amino acid sequence is a polypeptide at positions 693 to 720 of SEQ ID No. 2;

[0011] A2) a polypeptide having more than 80% identity with the protein represented by A1) and having the same function as the protein represented by A1) obtained by substitution and / or deletion and / or addition of amino acid residues;

[0012] A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid shown in any one of A1) or A2).

[0013] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0014] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0015] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0016] In the above application, the regulation is to upregulate, enhance or increase the expression of the gene encoding the aforementioned polypeptide or the content or activity of the polypeptide.

[0017] In the above application, the regulation is to down-regulate or inhibit or reduce the expression of the gene encoding the aforementioned protein or the content or activity of the protein.

[0018] In the above application, the substance is a biological material, and the biological material is any one of the following:

[0019] B1), RNA molecules that inhibit, reduce or down-regulate the expression of the gene encoding the aforementioned protein or RNA molecules that inhibit, reduce or down-regulate the activity or content of the protein;

[0020] B2), expressing the coding gene of the RNA molecule described in B1);

[0021] B3), an expression cassette containing the gene described in B2);

[0022] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);

[0023] B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4);

[0024] B6), a transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4);

[0025] B7), transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4);

[0026] B8), a transgenic plant organ containing the gene described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4);

[0027] B9), a nucleic acid molecule encoding the aforementioned protein;

[0028] B10), an expression cassette containing the nucleic acid molecule described in B9);

[0029] B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B3);

[0030] B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10);

[0031] B14), transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10);

[0032] B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10).

[0033] In the above application, B1) the RNA molecule targets the gene encoding the protein.

[0034] In the above application, the protein encoding gene is the wild-type genomic sequence of the OsD3 gene, and B1) the RNA molecule targets nucleotides 2158-2177 of the wild-type genomic sequence of the OsD3 gene, targets nucleotides 2209-2228 of the wild-type genomic sequence of the OsD3 gene, or targets nucleotides 2233-2252 of the wild-type genomic sequence of the OsD3 gene.

[0035] In the above application, the coding sequence of the nucleic acid molecule described in B9) is SEQ ID No.2.

[0036] The present invention also provides a method for regulating the tiller number of rice, comprising the following steps: regulating the expression of the coding gene of the above protein in the target plant or regulating the activity and / or content of the protein to change the tiller number of the target plant.

[0037] The present invention also provides a method for increasing the tiller number of rice, comprising the following steps: down-regulating or inhibiting or reducing the expression of the coding gene of the aforementioned protein in the recipient rice or down-regulating or inhibiting or reducing the activity and / or content of the protein, so as to increase the tiller number of the recipient rice; the recipient rice contains the coding gene.

[0038] In the above method, the recipient rice may specifically be Nipponbare.

[0039] In the above method, the recipient plant may or may not contain the gene encoding the protein.

[0040] In the above application or the above substance, the expression cassette containing nucleic acid molecules described in B3) refers to the DNA capable of expressing the RNA molecules described above in the host cell. The expression cassette containing nucleic acid molecules described in B10) refers to the DNA capable of expressing the protein described above in the host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule of all regulatory sequences necessary for expressing the nucleic acid molecules of any of the above proteins or the DNA of the RNA molecules. The regulatory sequence can guide the coding sequence to express any of the above proteins or the DNA of the RNA molecules in a suitable host cell under its compatible conditions. The regulatory sequence includes, but is not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence and a transcription terminator. At a minimum, the regulatory sequence should include a promoter and termination signals for transcription and translation. In order to introduce specific restriction enzyme sites into the vector so as to connect the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule, a regulatory sequence with a joint can be provided. The regulatory sequence can be a suitable promoter sequence, that is, a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of the DNA of the protein or the RNA molecule. The promoter can be any nucleic acid sequence that has transcriptional activity in the selected host cell, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence can be operably connected to the 3' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any terminator that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, i.e., an mRNA non-translated region that is very important for the translation of the host cell. The leader sequence can be operably connected to the 5' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any leader sequence that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence connected to the amino terminus of the protein, which can guide the DNA encoding the protein or the RNA molecule into the cell secretion pathway. Signal peptide coding regions that can direct the expressed protein or the DNA of the RNA molecule into the secretory pathway of the host cell used can be used in the present invention. It may also be necessary to add regulatory sequences that can regulate the expression of the DNA of the protein or RNA molecule according to the growth of the host cell. Examples of regulatory sequences are those systems that can respond to chemical or physical stimuli (including in the presence of regulatory compounds) to open or close gene expression. Other examples of regulatory sequences are those that can enable gene amplification.

[0041] In the above substances, the vector can be a plasmid, a cosmid, a phage or a virus vector.

[0042] In the above substances, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0043] In the above substances, the transgenic plant cell lines do not include propagation materials.

[0044] The plant mentioned above is any one of the following:

[0045] G1) Monocots;

[0046] G2) Gramineae;

[0047] G3) Oryza plants;

[0048] G4) Rice plants;

[0049] G5) Rice.

[0050] The aforementioned protein or a substance that regulates the expression of the gene encoding the protein or a substance that regulates the activity and / or content of the protein also falls within the scope of protection of the present invention.

[0051] The advantage of the present invention is that the present invention shows that the CTH motif of D3 is very important for the interaction between D3 and D14 in rice, and the deletion of the CTH motif using CRISPR genome editing technology can increase the number of rice tillers. More importantly, overexpression of the CTH motif of D3 can fine-tune the perception of rice strigolactone signals, moderately increase the number of rice tillers, and has a certain yield-increasing potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 For D3 CTH The influence of the D14 and D3 amino acid sites on the interaction between D14 and D3 in the D14–GR24 complex interaction interface. (A) The D14 and D3 sites used in this study are marked with red and blue arrows on the D3 CTH –D14–GR24 complex (PDB: 6BRT). (B) Effects of mutations in key amino acid sites in the D14-D3-CTH interaction interface on the interaction between D3 and D14 in yeast, where D14ΔN indicates a 50-amino acid deletion at the N-terminus of rice D14. H183A The 183rd amino acid of the full-length rice D14 was mutated from histidine to alanine and 50 amino acids were deleted at the N-terminus. S274A The 274th amino acid of the full-length rice D14 was mutated from serine to alanine and 50 amino acids were deleted at the N-terminus. S274E The 274th amino acid of the rice full-length D14 was mutated from histidine to glutamic acid, and 50 amino acids were deleted at the N-terminus. A276Vindicates that the 276th amino acid of the full-length rice D14 is mutated from alanine to valine and 50 amino acids are deleted at the N-terminus. OsSKP1-D3 indicates the fusion protein of rice OsSKP1 and D3. OsSKP1-D3 E700A Indicates that the 700th position of D3 in the fusion protein of OsSKP1 and D3 is mutated from glutamic acid to alanine, OsSKP1-D3 L707A It indicates that the 707th position of D3 in the fusion protein of OsSKP1 and D3 is mutated from leucine to alanine.

[0053] Figure 2 For D14 S274E The mutation enhances the ability of rice to sense strigolactone signals. (A) Immunoprecipitation in rice protoplasts revealed D14 S274E –FLAG and D3–GFP interaction in vivo. (B) Rice d14, d14-GFP / d14 and D14 S274E Ubiquitination of D53-HA protein in rice Act:D14-GFP / D14 and Act:D14 S274E -GFP / D14 callus degradation of endogenous D53 protein. (D) Wild-type Nipponbare rice (WT), d14 mutant, Act:d14-GFP / d14 and Act:D14 S274E (E) Wild-type Nipponbare rice (WT), rice t20 mutant, Act:D14-GFP / t20 and Act:D14 S274A -GFP / t20 line phenotype and tillering statistics. Scale bar, 20 cm. Data are mean ± SD.

[0054] Figure 3 Overexpression of the CTH motif of D3 negatively regulates rice tillering development. (A) Act: D3 CTH -Schematic diagram of GFP vector structure. (B) Wild-type Nipponbare (NP) and Act:D3 CTH -GFP transgenic plants at maturity stage morphology and tiller number. Scale bar, 20 cm. Data are mean ± SD. (C) Wild-type Nipponbare (NP) and Act:D3 CTH Protein levels of endogenous D53 in the stem base of 2-week-old seedlings of -GFP transgenic plants. Data are mean ± SD. (D) Protein levels of endogenous D53 in wild type (NP) and Act:D3 CTH -Degradation of endogenous D53 in GFP / NP calli after treatment with 1 μM rac-GR24. Data are mean ± SD, n = 3.

[0055] Figure 4Creation of CTH motif knockout mutants of OsD3 protein in rice. (A) Information of rice d3ΔCTH mutants. On the left are gDNA sequences in wild type and mutants d3ΔCTH-1 and d3ΔCTH-2. The blue line highlights the C-terminal domain (CTH) of D3, and the gray and red fonts show the deleted sequence and the inserted base pairs, respectively. On the left are amino acid sequences in wild type and mutants d3ΔCTH-1 and d3ΔCTH-2. The blue line highlights the CTH amino acid sequence, and the green and orange fonts show the truncated CTH and the mutated CTH, respectively. (B) Morphology and tiller number of wild type (NP), d3ΔCTH-1 and d3ΔCTH-2 plants at maturity. Scale bar, 20 cm. (C) Endogenous D53 protein levels in the stem base of seedlings of wild type (NP), d3ΔCTH-1 and d3ΔCTH-2 plants. (D) OsTB1 transcript levels in the stem base of wild-type (NP), d3ΔCTH-1 and d3ΔCTH-2 seedlings. Data are mean ± SD. (E) Yeast two-hybrid analysis of the interaction between truncated D3 in d3ΔCTH-1 and d3ΔCTH-2 and D14ΔN. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0057] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0058] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0059] rac-GR24, a strigolactone analogue, was purchased from Chiralix with the catalog number CX2388.

[0060] Y2HGold yeast strain was purchased from Clontech with catalog number 630498.

[0061] MG132 (Proteasome inhibitor) was purchased from Sigma-Aldrich, Cat#474790.

[0062] GR24 4DORecorded in the non-patent document "Wang, L., Wang, B., Yu, H., Guo, H., Lin, T., Kou, L., Wang, A., Shao, N., Ma, H., Xiong, G., et al. (2020). Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 583, 277-281.". The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0063] The preparation of AHLG vector, pBI221 vector, rice d14 mutant and D53 rabbit polyclonal antibody is described in the non-patent literature "Jiang, L., Liu, X., Xiong, G., Liu, H., Chen, F., Wang, L., Meng, X., Liu, G., Yu, H., Yuan, Y., et al. (2013). DWARF 53 acts as a repressor of strigolactone signaling in rice. Nature 504, 401-405.". The public can obtain them from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological materials are only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0064] 35S:GFP plasmid, 35S:D14-Flag and 35S:D3-GFP are described in the non-patent literature "Hu, Q., He, Y., Wang, L., Liu, S., Meng, X., Liu, G., Jing, Y., Chen, M., Song, X., Jiang, L. et al. (2017). DWARF14, a receptor covalently linked with the active form of strigolactones, undergoes strigolactone-dependent degradation in rice. Front. Plant Sci. 8, 1935.". The public can obtain them from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0065] t20 mutant rice: recorded in the non-patent literature "Liu, X., Hu, Q., Yan, J., Sun, K., Liang, Y., Jia, M., Meng, X., Fang, S., Wang, Y., Jing, Y., et al. (2020). ζ-carotene isomerase suppresses tillering in rice through the coordinated biosynthesis of strigolactone and abscisic acid. Mol. Plant 13, 1784-1801.". The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0066] The following examples used GraphPad Prism 8 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Two-tailed Student's t-test was used, P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), ns (not significant) or One-way ANOVA test was used, P < 0.05 (*) indicated a significant difference.

[0067] Example 1: D3 in Rice CTH – Biological functions of the D14–GR24 complex

[0068] 1. D3 CTH –The influence of amino acid positions of D14 and D3 on the interaction between D14 and D3 in the D14–GR24 complex interaction interface

[0069] 1. Analysis of D3 using PyMol software CTH -D14 and D3 amino acid sites in the D14-GR24 complex interaction interface

[0070] The results are as follows Figure 1 As shown in A, the H183, S274 and A276 amino acid sites of D14 and the E700 and L707 amino acid sites of D3 are located on the interaction interface between CTH and D14.

[0071] 2. Analysis of D3 by yeast two-hybrid assay CTH -The influence of amino acid positions of D14 and D3 on the interaction between D14 and D3 in the D14-GR24 complex interaction interface

[0072] The plasmid transformation of yeast is based on the experimental process in the DUAL membrane starter kits. The specific operation process is as follows: (1) Streak the Y2HGold yeast strain on YPDA solid medium and incubate at 30°C for 2-3 days until single colonies appear. (2) Pick 3-4 single colonies and place them in 3mL YPDA liquid medium. Incubate at 250rpm at 30°C for 12-14h. (3) Transfer 3mL of bacterial liquid to 30mL YPDA liquid medium and continue to incubate at 250rpm at 30°C for 3-5h. When OD 600 When the pH reaches 0.6-0.8, centrifuge at 700g for 5 minutes at room temperature. (4) After discarding the supernatant, resuspend the precipitate in 30mL sterile water and centrifuge again at 700g for 5 minutes. (5) After discarding the supernatant, determine the volume of sterile medium to be added to resuspend the yeast cells according to the number of experimental reactions, place the resuspended yeast competent cells on ice and wait for transformation. (6) When preparing yeast competent cells, denature the salmon sperm single-stranded ssDNA, first boil it at 100℃ for 5 minutes and then place it on ice for 5 minutes, repeat 2-3 times. (7) Determine the configuration of the PEG / LiOAc reaction mixture according to the number of experimental reactions. Each reaction contains 240μL 50% PEG, 36μL LiOAc and 25μL salmon sperm single-stranded ssDNA. (8) Add the corresponding vector (200-300 ng each), 300 μL PEG / LiOAc reaction mixture and 100 μL yeast competent cells to a sterilized 1.7 mL centrifuge tube, mix well and incubate at 42°C for 45 min. (9) Collect the cells by centrifugation at 700 g for 5 min at room temperature, discard the supernatant and resuspend in 200 μL 0.9% NaCl solution, spread evenly on SD-Leu / -Trp solid yeast defective medium, and invert and culture at 30°C for 3-4 days until colonies appear. (10) Pick about 10 single clones from the SD-Leu / -Trp solid yeast defective medium and place them in 100 μL 0.9% NaCl solution, and prepare 10-fold and 100-fold dilution yeast solutions at the same time. (11) Take 6 μL of yeast suspension and spot it on SD-Leu / -Trp, SD-Leu / -Trp / -His / -Ade containing acetone, and SD-Leu / -Trp / -His / -Ade solid yeast defective medium containing 10 μM rac-GR24, and culture it upside down at 30°C for 3-7 days before taking photos and analyzing them.

[0073] YPAD liquid medium: 10g / L Bacto-yeast extract, 20g / L Bacto-peptone, 20g / L Dextrose, 100mg Adenine sulfate.

[0074] YPAD solid medium: Add 15 g / L Agar to the above YPAD liquid medium.

[0075] Yeast amino acid deficiency medium: 1.39-1.92g / L yeast synthetic drop-out medium supplement, 6.7g / L yeast nitrogen base without amino acids. Add ddH2O to dissolve and dilute to 960mL, sterilize at 121℃ for 15min, add 40mL of 50% (w / v) glucose solution sterilized by 0.22μm filter after sterilization. Solid medium is supplemented with 20% (w / v) agar on the basis of the above ingredients and stored at 4℃.

[0076] Yeast transformation reagent: 50% (m / v) PEG, 50 g, PEG 3350 (Sigma), dissolved in 100 mL ddH2O and sterilized by filtration through a 0.22 μm filter.

[0077] 1M LiOAc: 10.2 g LiOAc·2H2O (Sigma) in 100 mL ddH2O and sterilized by filtration through a 0.22 μm filter.

[0078] Single-stranded carrier DNA: 200 mg salmon sperm DNA type III sodium salt (Sigma) was dissolved in 100 mL ddH2O. Stir for 2-3 hours to completely dissolve the DNA. Aliquot and heat at 100°C for 5 min and 4°C for 5 min alternately 2-3 times before each use.

[0079] The results showed that the key site D14 on the interaction interface between CTH and D14 H183E 、D14 S274A 、D14 S274E and D14 A276V The mutation did not inhibit the strigolactone-induced interaction between D14 and D3 ( Figure 1 (A and B) Key site D3 on the interaction interface L707A The mutation also did not affect the interaction between D14 and D3, while D3 E700A The mutation partially inhibited the interaction between D14 and D3 ( Figure 1 The data in yeast suggest that the D14-D3-CTH interaction interface is not required for direct interaction of D14 with D3.

[0080] 3. Detection of the effect of the S274E mutation of D14 on the interaction between D14 and D3 in a protoplast system

[0081] The 35S:D14-GFP plasmid is a recombinant expression plasmid obtained by inserting the CDS nucleotide sequence of the OsD14 gene into 35S:GFP. S274E -GFP plasmid is D14 S274E The sequence was inserted into 35S:GFP to obtain the recombinant expression plasmid. S274E The 274th amino acid position of the amino acid sequence of D14 was mutated from S to E.

[0082] Protoplasts of rice seedlings were prepared with reference to the literature "Bart, R., Chern, M., Park, CJ, Bartley, L., and Ronald, PC (2006). A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts. Plant Methods 2, 13.", and the plasmid 35S:D14-FLAG plasmid and 35S:D14 S274E -FLAG plasmid was co-transformed with 35S:D3-GFP plasmid into the aforementioned rice protoplasts.

[0083] The rice protoplast immunoprecipitation method was as follows: 10 reactions (10 2 mL centrifuge tubes) for each combination were cultured at 28 °C in the dark for 14 h, and then centrifuged at 150 g for 3 min to collect the protoplasts; 0.2 mL of W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES, pH 5.7) was added to each 2 mL centrifuge tube to resuspend the previously transformed 35S:D14-FLAG plasmid + 35S:D3-GFP or transformed 35S:D14 S274E -FLAG+35S:D3-GFP plasmid, 10 reactions in each combination were first combined into a 5 mL centrifuge tube, and then equally divided into two new 2 mL centrifuge tubes; 1 μL 50 mM rac-GR24 or 1 μL acetone was added to the protoplasts, and after culturing at 28°C in the dark for 1 hour, the protoplasts were collected by centrifugation at 150 g for 3 minutes; 1 mL IP protein extraction solution (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 0.5% Nonidet P-40, 1x Roche cOmplete TMProtoplasts were lysed with 1 μL of 50 mM rac-GR24 or 1 μL of acetone and 25 μL of GFP-Trap beads (ChromoTek, Cat# Gta-200) at 4°C, and the mixture was incubated with an IP protein cleaning solution (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 0.1% Nonidet P-40, 1x Roche cOmplete TM The samples were rinsed 3 times with Protease Inhibitor Cocktail, and 25 μL SDS loading was added and vortexed to mix. The samples were denatured at 100°C for 5 min, and then subjected to Western-blot experiments. The FLAG antibody was a mouse monoclonal antibody (Sigma-Aldrich, Cat#F1804) at a dilution ratio of 1:3,000, and the GFP antibody was a mouse monoclonal antibody (Roche, Cat#11814460001) at a dilution ratio of 1:3,000.

[0084] The results showed that rac-GR24 could significantly induce D14 S274E -FLAG interacted with D3-GFP, and the interaction intensity was significantly stronger than that of the control group D14-FLAG and D3-GFP ( Figure 2 The results show that although previous studies have found that D14 S274E Mutations inhibit the direct interaction between D14 and the CTH motif, but Figure 2 From A, we can see that D14 S274E It will enhance the interaction between D14 and D3 in rice protoplasts.

[0085] 2. Expression of D14 or D14 S274E Obtaining callus tissue and positive plants

[0086] 1. D14 overexpression vector and D14 S274E Construction of overexpression vector

[0087] The above-mentioned 35S:D14-GFP and 35S:D14 S274E -GFP plasmid as a template, and AHLG-D14-F and AHLG-D14-R were used to amplify the D14 gene and D14 S274E Gene.

[0088] AHLG-D14-F: 5'- ACGATAAGCTTGGGCCC ATGCTGCGATCGACGCATC-3′;

[0089] AHLG-D14-R: 5'- ATGGCGGCCGCTCTAGA GTACCGGGCGAGAGCGC-3'.

[0090] Among the above primers, the ununderlined sequences are for amplifying D14 or D14 S274E The primers with underlined sequences are used for homologous recombination with the AHLG vector.

[0091] The D14 overexpression vector is a recombinant expression vector AHLG-Act:D14-GFP obtained by replacing the small fragment between the two enzyme recognition sites ApaI and XbaI of the AHLG vector with the OsD14 gene CDS nucleotide sequence and keeping the other nucleotide sequences of the AHLG vector unchanged. The recombinant expression vector expresses the fusion protein D14-GFP.

[0092] D14 S274E The overexpression vector is based on the mutant D14 S274E The nucleotide sequence of the protein replaces the small fragment between the two enzyme recognition sites of ApaI and XbaI of the AHLG vector, and the other nucleotide sequences of the AHLG vector remain unchanged to obtain the recombinant expression vector AHLG-Act:D14 S274E -GFP, the recombinant expression vector expresses the fusion protein D14 S274E -GFP. Mutated D14 S274E The protein is obtained by mutating the 274th amino acid position of the amino acid sequence of D14 from S to E.

[0093] 2. Containing recombinant vector Act:D14-GFP or Act:D14 S274E -GFP callus induction

[0094] (1) Induction and subculture of rice callus

[0095] NB solid medium composition: KNO3, 2830mg / L, (NH4)2SO4 463mg / L, KH2PO4 400mg / L, MgSO4·7H2O 185mg / L, CaCl2·2H2O 166mg / L, FeSO4·7H2O 27.8mg / L, Na2EDTA 37.5mg / L, MnSO4·4H2O 10mg / L, H3BO3 3mg / L, ZnSO4·7H2O 2mg / L, Na2MoO4·2H2O 0.25mg / L, CuSO4·5H2O0.025mg / L, CoCl2·6H2O 0.025mg / L, KI 0.75mg / L, Vitamin B1 10mg / L, Vitamin B6 1mg / L, Nicotinic acid 1mg / L, Myo-inositol 100mg / L, Casein hydrolysate 300mg / L, Glutamine 500mg / L, Glycine 2mg / L, Proline 1000mg / L, 2,4-D 2mg / L, and the balance is water.

[0096] Using t20 mutant or d14 mutant as rice receptor, the seeds of t20 mutant (or d14 mutant) to be transformed are shelled, surface disinfected with 70% (v / v) ethanol for 1 min, then rotated and washed with 2.5% (w / v) sodium hypochlorite for 45 min, washed three times with sterile water, and then sown on NB solid medium and cultured at 28°C in the dark for two weeks. After callus tissue grows at the mature embryo scutellum, the callus tissue is cut off and subcultured on a new NB solid medium, and transferred to a new NB solid medium every 7 days. After 3-4 times, Agrobacterium infection can be carried out.

[0097] (2) Cultivation of Agrobacterium tumefaciens EHA105

[0098] 1L LB solid medium composition: Tryptone 10g, Yeast Extract 5g, NaCl 10g, agar 15g.

[0099] 1L LB liquid culture medium composition: Tryptone 10g, Yeast Extract 5g, NaCl 10g.

[0100] Composition of rice transformation solution: Add the following reagents to NB basic medium: Inositol 2g / L, Glutamine 2g / L, Casein hydrolysate 500mg / L, 10% Synperonic PE 10ml / L, Acetosyringone 100μM.

[0101] When the rice callus tissue is growing well, the plant transgenic overexpression vector (AHLG-Act:D14-GFP vector or AHLG-Act:D14 S274E -GFP vector) were transformed into Agrobacterium EHA105 strain by high voltage electroporation and spread on LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin for 2-3 days. 4-5 single clones were selected for each transformation and inoculated into 7 mL LB liquid medium containing kanamycin and 25 mg / L rifampicin, and then cultured overnight at 250 rpm under the condition of parameter setting at 28°C. The bacteria were centrifuged at 3,000 rpm for 5 min at room temperature and resuspended in rice transformation solution for transformation of rice callus.

[0102] (3) Agrobacterium EHA105 infection of rice callus

[0103] The callus tissue in good condition obtained in step (2) was collected, and an appropriate amount of transformation solution was added until the bacterial solution completely submerged the callus tissue, and the callus tissue was placed at room temperature for 20 minutes, with occasional shaking during the period. Then, the transformed callus tissue was taken out, and the excess bacterial solution was absorbed with sterile filter paper. The callus tissue was placed in a 23°C incubator in the dark for 2-3 days to obtain the recombinant vector AHLG-Act:D14-GFP or AHLG-Act:D14 S274E -GFP callus Act:D14-GFP / d14 rice callus, Act:D14 S274E -GFP / d14 rice callus, Act:D14-GFP / t20 rice callus and Act:D14 S274E -GFP / t20 rice callus.

[0104] 3. Overexpression of D14 or D14 S274E Obtaining transgenic rice

[0105] The specific method is as follows: the recombinant vector AHLG-Act:D14-GFP or AHLG-Act:D14 S274E -GFP callus Act:D14-GFP / d14 rice callus, Act:D14 S274E -GFP / d14 rice callus, Act:D14-GFP / t20 rice callus and Act:D14 S274E-GFP / t20 rice callus were transferred to NB solid screening medium containing hygromycin, cultured at 28℃ in the dark for 7-10 days, then subcultured to new NB solid screening medium containing hygromycin, and 3-4 rounds of hygromycin screening medium were performed. The callus with good growth status was propagated to differentiation medium for differentiation and regeneration. After about one month of light culture at 28℃, the grown seedlings were transferred to rooting medium and cultured for about 4 weeks for rooting and seedling strengthening. They were transplanted to the greenhouse for about one month and then moved to the field.

[0106] 4. Identification of positive plants

[0107] The specific methods are as follows: (1) for "3, overexpression of D14 or D14 S274E The leaves of rice were taken from each plant, and the rice genomic DNA was extracted by CTAB method. The extracted DNA was used as a template, and PCR amplification was performed with AHLG-F and D14-570-R identification primers respectively. The PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing. After the sequencing results were obtained, the sequences were compared. The ones that matched the expected sequence were T0 generation positive plants. 16 T0 generation positive plants transformed with AHLG-Act:D14-GFP vector (named Act:D14-GFP / d14 plants) were obtained, and 10 T0 positive plants transformed with AHLG-Act:D14 were obtained. S274E -GFP vector T0 generation positive individual (named Act:D14 S274E -GFP / d14 plants), 8 T0 positive plants transformed with AHLG-Act:D14-GFP vector (named Act:D14-GFP / t20 plants) were obtained, and 9 plants transformed with AHLG-Act:D14 S274E -GFP vector T0 generation positive individual (named Act:D14 S274E -GFP / t20 plants). (2) Randomly select 8 Act:D14-GFP / d14 plants and 8 Act:D14 S274E -GFP / d14 plants, 8 Act:D14-GFP / t20 plants, 8 Act:D14 S274E-GFP / t20 plants were propagated and 8 T1 generation strains were planted. Six plants were randomly collected from each T1 generation strain, which can be used to screen homozygous positive plants. (3) The harvested T1 generation seeds were germinated, and 40 germinated seeds were placed on a 0.5% Agar solid culture medium containing 50 μg / mL hygromycin (Hyg). After 2-3 days, the root growth of the plants was observed. Plants with normal root growth were positive plants, otherwise they were isolated pseudo-singles. If all seeds of each plant can grow roots normally, they are homozygous positive strains. (4) 6 Act:D14-GFP / d14 homozygous positive plants were obtained, 7 Act:d14ΔN-GFP / d14 homozygous positive plants were obtained, 7 Act:D14-GFP / t20 homozygous positive plants were obtained, and 8 Act:d14ΔN-GFP / t20 homozygous positive plants were obtained. The Act:D14-GFP / d14 homozygous positive individual (T2 generation), Act:d14ΔN-GFP / d14 homozygous positive individual (T2 generation), Act:D14-GFP / t20 homozygous positive individual (T2 generation), and Act:d14ΔN-GFP / t20 homozygous positive individual (T2 generation) used in subsequent experiments were named Act:D14-GFP / d14#1, Act:D14-GFP / d14#2, Act:D14 S274E -GFP / d14#1, Act:D14 S274E -GFP / d14#2, Act:D14-GFP / t20#1, Act:D14-GFP / t20#2, Act:D14 S274E -GFP / t20#1 and Act:D14 S274E -GFP / t20#2.

[0108] Primers for identification of transgenic positive seedlings:

[0109] AHLG-F:5'-TCAGCATTGTTCATCGGTAG-3';

[0110] D14-570-R:5'-CTGCTGTATCCTCCTCCAGCTC-3'.

[0111] PCR reaction system: 1 μL DNA template, 2 μL 10 μM Primer F, 2 μL 10 μM Primer R and 45

[0112] μL Gold Mix. Reaction procedure: 98℃ pre-denaturation for 3 min; 35 cycles of 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 15 s; 72℃ extension for 5 min.

[0113] 5. Detection of D14 S274E-GFP induced ubiquitination and degradation of D53-HA in rice

[0114] 1) Vector construction

[0115] The D53-HA overexpression vector pCAMBIA2301-D53-HA is a recombinant expression vector 2301-Act:D53-HA obtained by replacing the small fragment between the two restriction sites XbaI and PstI of the pCAMBIA2301 vector with the OsD53 gene CDS nucleotide sequence, while keeping the other nucleotide sequences of the pCAMBIA2301 vector unchanged. The recombinant expression vector expresses the fusion protein D53-HA. The primers for construction are as follows:

[0116] OsD53-XbaI-2301-F:5'- CCGGGGATCCTCTAGAATGCCCACTCCGGTGGCCGCC -3';

[0117] OsD53-PstI-2301-3HA-R:5'- CCTGGCATGCCTGCAG TCAAGCGTAATCTGGAACGTCGTAAGGGTAGCCGGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTAAGGGTAGCCCGCC ACAA TCTAGAATTATTCTTG -3'.

[0118] The double underline is the recombination linker sequence of the vector, the underline is the gene primer sequence of OsD53, and the black bold is the reverse complementary nucleotide sequence of 3-HA.

[0119] 2) Preparation of callus tissue

[0120] According to "2, containing recombinant vector Act:D14-GFP or Act:D14 S274E -GFP callus induction (1) Rice callus induction and subculture" method, to prepare the aforementioned plants Act:D14-GFP / d14#2 and D14 S274E -GFP / d14#2 callus, and select Act:D14-GFP / d14#2 and D14 that have strong growth, light yellow color, smooth appearance, and compact shape. S274E-GFP / d14#2 callus was used as the receptor, and the D53-HA overexpression vector pCAMBIA2301-D53-HA was then transferred into it. The obtained rice callus was transferred to a new NB solid screening medium containing antibiotics and cultured in the dark at 28°C for one week. These callus were subcultured to a new NB solid screening medium containing antibiotics for one week, and repeated three times. The callus with good growth status (light yellow color, smooth appearance, and compact shape) was then transferred to NB liquid culture medium, and cultured in the dark at 50rpm at 28°C for 1-2 hours to obtain D53-HA / D14 transfected callus and D53-HA / D14 transfected callus. S274E of callus tissue.

[0121] 3) Ubiquitination detection of D53-HA

[0122] In order to determine the ubiquitination of D53-HA, the above D53-HA / D14 transfected callus and D53-HA / D14 transfected callus were S274E The calli were pretreated with 50 μM MG132 (Sigma-Aldrich, Cat. No. 474790) for 1 hour. For the ubiquitination of D53-HA, the calli were treated with or without 2 μM GR24 4DO Treat for 5 minutes and then freeze in liquid nitrogen. Total protein was extracted in IP protein extraction buffer. Then, 25 μL HA agarose beads (Sigma) were added to 1 mL of supernatant and incubated at 4°C for 2 hours with gentle rotation. The beads were washed 3-5 times with IP wash buffer, and then HA agarose-bound beads or GFP agarose-bound beads were eluted with 50 μL SDS-PAGE buffer. SDS-PAGE and Western-blot detection were performed.

[0123] To determine the degradation of D53, transgenic calli were treated with or without 1 μM rac-GR24 for 5 min, 10 min, and 20 min and then frozen in liquid nitrogen. The cells were lysed using RIPA protein extraction buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 1.0% (v / v) Nonidet P-40, 10 mM NaF, 2 mM EDTA, 0.1% SDS sodium orthovanadate, 1x Roche cOmplete TM Protease Inhibitor Cocktail, 1mM PMSF and 50μM MG132) were used to extract total proteins for SDS-PAGE and Western-blot detection.

[0124] For SDS-PAGE and Western-blot experiments, the specific process is as follows: (1) Prepare a 10% concentration 12-well or 15-well SDS-PAGE protein gel or use a 4-15% 10-well protein precast gel purchased from Bio-Rad. The amount of protein sample loaded depends on the experimental requirements. Set the voltage to 80-120V for about 1-2h. (2) Use the semi-dry transfer method to transfer the protein to the PVDF or NC membrane, the voltage is 15-20V, and the transfer time is 30-60min. (3) During the transfer, prepare 4% skim milk powder in TBST solution. After the transfer is completed, place the PVDF or NC membrane in 4% skim milk powder and incubate it at room temperature for 60min on a shaker at 70rpm. (4) Pour out the skim milk powder, rinse with TBST, add new 4% skim milk powder, add the protein antibody to be detected, and incubate for 1-2h or overnight at 4℃. (5) After incubation with the primary antibody, wash the PVDF or NC membrane three times with TBST, each time at room temperature for 5 minutes on a shaker at 70 rpm, then add 4% skim milk containing the secondary antibody and incubate at room temperature for 60 minutes on a shaker at 60 rpm. (6) After incubation with the secondary antibody, wash the membrane three times with TBST, each time at room temperature for 5 minutes on a shaker at 70 rpm. Add the color developing solution and use a photographic film or a protein developing instrument to develop the protein. Mouse monoclonal antibody α-Ubi ​​(Cell Signaling Technology), α-K48 specific polyubiquitin rabbit monoclonal antibody (Cell Signeling Technology) and α-K63 specific polyubiquitin rabbit monoclonal antibody (CellSignalling Technology) were used at a dilution of 1:1000, and mouse monoclonal antibody α-HA (Abmart) was used at a dilution of 1:3000.

[0125] The results showed that D14 S274E -GFP enhances the ubiquitination and degradation of D53 in rice ( Figure 2 B and C), indicating that D14 S274E The mutation promotes rice's perception of strigolactones.

[0126] 6. Count the number of tillers of homozygous positive plants

[0127] The experimental method is as follows: the wild-type rice Nipponbare NP, d14 mutant, t20 mutant, the above homozygous plants Act:D14-GFP / d14#1, Act:D14-GFP / d14#2, Act:d14ΔN-GFP / d14#1 and Act:d14ΔN-GFP / d14#2, Act:D14-GFP / t20#1, Act:D14-GFP / t20#2, Act:d14ΔN-GFP / t20#1 and Act:d14ΔN-GFP / t20#2 were planted in the field at the experimental base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Changping District, Beijing. Each line was planted with 24 plants with a plant spacing and row spacing of 17 cm, and the growth time was from May to November each year. The field phenotypic survey of rice materials was conducted from September 20 to October 7 each year. The number of tillers counted was the number of effective tillers at maturity (i.e. the number of tillers that grew ears), and the plant height was the distance between the highest ear of rice and the ground. Based on the average number of tillers of each material, representative single plants were selected and transplanted into pots for photography.

[0128] The results showed that D14 S274E Overexpression of -GFP completely rescued the tiller number at d14, and some lines even formed fewer tillers than the wild type ( Figure 2 Further, D14 S274E Overexpression of -GFP significantly reduced the tillering number of the t20 mutant (a mutant with reduced strigolactone content). Figure 2 Middle E), indicating D14 S274E The mutation enhances rice's ability to sense strigolactone signals.

[0129] These results suggest that although previous studies have shown that S274E in D14 is a CTH The key amino acid sites in the –D14–GR24 complex are crucial for the direct interaction between D14 and the D3-CTH motif (Shabek, N., Ticchiarelli, F., Mao, H., Hinds, TR, Leyser, O., and Zheng, N. (2018). Structural plasticity of D3-D14 ubiquitin ligase in strigolactone signalling. Nature 563, 652-656.). However, the yeast data in this study indicate that D14 S274E The mutation did not inhibit the interaction of D14 with full-length D3. More interestingly, D14 S274E The mutation enhanced the interaction of D14 with full-length D3 in protoplasts and enhanced the plant's ability to perceive strigolactones.S274E The mutations are important for direct interaction of D14 with the D3-CTH motif and for D14 S274E The mutant protein enhances the plant's ability to sense strigolactones, so it is speculated that D3 CTH The –D14–GR24 complex may regulate the perception of rice strigolactones, and the D3-CTH motif may regulate rice tillering by regulating the perception of strigolactone signals.

[0130] Example 2: Identification and biological function analysis of the CTH motif of OsD3 protein in rice

[0131] To analyze D3 CTH The function of the D3-CTH motif in the –D14–GR24 complex in rice was investigated, and transgenic materials overexpressing D3-CTH were further constructed in the wild type.

[0132] 1. Preparation of plants overexpressing CTH-GFP

[0133] Overexpression mutant primers

[0134] AHLG-D3 CTH -F: ACGATAAGCTTGGGCCC ATGGCGGAAGAGGAGGAGGTGG;

[0135] AHLG-D3 CTH -R: ATGGCGGCCGCTCTAGA ATCATCAATTTGCCGGCTGTTC.

[0136] The bold part is the primer sequence of CTH, and the underlined part is the linker sequence used by the vector for recombination with AHLG.

[0137] The vector for overexpressing CTH-GFP is a recombinant overexpression vector AHLG-Act:D3 obtained by replacing the small fragment between the two enzyme recognition sites of ApaI and XbaI of the AHLG vector with the nucleotides 2077-2163 of SEQ ID No.2, while keeping the other nucleotide sequences of the AHLG vector unchanged. CTH -GFP, the recombinant expression vector expresses protein D3 whose amino acid sequence is the 693rd to 720th position of SEQ ID No.1 CTH .

[0138] Replace the recombinant expression vector AHLG-Act:D14-GFP or AHLG-Act:D14 with a vector that overexpresses CTH-GFP S274E -GFP, and the wild-type Nipponbare rice was used to replace the t20 mutant or the d14 mutant. The rest of the operations were the same as those in Example 1, "II. Expression of D14 or D14 S274EAccording to the 2nd, 3rd and 4th parts of "Obtaining callus tissue and positive plants", positive plants were obtained and named Act:D3 CTH -GFP / NP#1 and Act:D3 CTH -GFP / NP#2.

[0139] Refer to "II. Expression of D14 or D14" in Example 1 S274E "Act: D3" of ... CTH -GFP / NP#1 and Act:D3 CTH -Tiller number of GFP / NP#2.

[0140] 2. Detection of Act:D3 CTH -Relative expression of D53 protein in GFP / NP

[0141] Rice seedlings were grown in a rice incubator (MLR-351H, SANYO, Japan) at 28°C for 16 h of light and 25°C for 8 h of darkness, with a light intensity of 150-200 μM m-2s-1 and a humidity of 70%. After culturing in Kimura B nutrient solution for 2 weeks, 1 cm of tissue at the base of the stems of seedlings of different materials were collected.

[0142] Act:D3 CTH -GFP / NP#1 and Act:D3 CTH -GFP / NP#2 replaces Act:D14-GFP / d14#2 and D14 S274E -GFP / d14#2, and the rest of the operations are the same as those in Example 1, "5. Detection of D14 S274E -GFP affects the ubiquitination and degradation of D53-HA in rice”, examining the effect of the CTH motif of D3 on the degradation of D53 treated with rac-GR24.

[0143] The results showed that overexpression of CTH-GFP( Figure 3 Middle A), CTH-GFP positively regulates rice tillering and D53 protein levels ( Figure 3 B and C), degradation of D53 treated with rac-GR24 ( Figure 3 Middle D), indicating that overexpression of the CTH motif of D3 negatively regulates rice tillering development and D53 degradation.

[0144] Example 3: Creation of CTH motif knockout mutant of OsD3 protein in rice

[0145] 1. Construction of knockout vector

[0146] The pYLCRISPR / Cas9Pubi-H, pYLgRNA-OsU3 and pYLgRNA-OsU6a vectors in the above embodiments have been recorded in the document "Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., et al. (2015). A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 8, 1274-1284.", and the biological material can be obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0147] The CTH motif of rice OsD3 was edited using the CRIPSR / Cas9 system. The specific steps are as follows:

[0148] (1) Selection of target sequences

[0149] Target site T1: 5′-GAACATCAGATCATTCTCTG-3′, located at nucleotides 2158-2177 of the wild-type genomic sequence of the OsD3 gene.

[0150] Target site T2: 5′-TTGAGGTGCAACTGAACAGC-3′, located at nucleotides 2209-2228 of the wild-type genomic sequence of the OsD3 gene.

[0151] Target site T3: 5'-AAATTGATGATTAGTTATGT-3', located at nucleotides 2233-2252 of the wild-type genomic sequence of the OsD3 gene.

[0152] (2) Obtaining gRNA gene expression cassettes targeting gene targets

[0153] The above three target sequences were constructed into the pYLCRISPR / Cas9 vector according to the following method to obtain an expression cassette for targeting TI and T2 or an expression cassette for targeting TI and T3. The construction method is as follows:

[0154] ① Preparation of target adapter: Dissolve adapter primer TE into 100μM stock solution, take 1μl of each and add to 98μl H20 to dilute to 1μM. Heat at about 90℃ for 30S, then cool to room temperature to complete annealing.

[0155] Table 1 Target adapter primer sequences

[0156]

[0157] ② Prepare 10 μl 1x BsaI digestion and ligation reaction solution: 1. Dilute the T1 target linker, T2 target linker, and T3 target linker with Bsa I-HF (NEB, trade name Bsal- v2, catalog number #R3733), pYLsgRNA vector, and T4 ligase were mixed to obtain gRNA gene expression cassette gRNA-U3-D3-T1 containing the target T1 driven by the OsU3 promoter, gRNA gene expression cassette gRNA-U6a-D3-T2 containing the target T2 driven by the OsU6a promoter, and gRNA gene expression cassette gRNA-U6a-D3-T3 containing the target T2 driven by the OsU6a promoter.

[0158] (3) gRNA-U3-D3-T1, gRNA-U6a-D3-T2 and gRNA-U6a-D3-T3 were respectively subjected to two rounds of PCR amplification to obtain the sgRNA expression cassette PCR fragment that can be constructed into the pYLCRISPR / Cas9 final vector.

[0159] First, the first round of PCR. The first round of PCR product obtained with gRNA-U3-D3-T1 as template was named gU3-D3-T1. The first round of PCR product obtained with gRNA-U6a-D3-T2 as template was named gU6a-D3-T2. The first round of PCR product obtained with gRNA-U6a-D3-T3 as template was named gU6a-D3-T3.

[0160] First round amplification primers:

[0161] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0162] gR-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0163] The first round PCR products were diluted 10 times with H20. The second round PCR product obtained by amplification with gU3-D3-T1 as template and Uctcg-B1' and gRctga-B2 as primers was named U3-D3-T1. The second round primer was U6a-D3-T2 obtained by amplification with gU6a-D3-T2 as template and Uctga-B2' and gRcggt-BL. The second round primer was U6a-D3-T3 obtained by amplification with gU6a-D3-T3 as template and Uctga-B2' and gRcggt-BL.

[0164] Uctcg-B1′: 5′-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3′ (U3 upstream primer);

[0165] gRctga-B2: 5′-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3′ (RNA downstream primer);

[0166] Uctga-B2′: 5′-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3′ (U6a upstream primer);

[0167] gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3' (complementary to the right side of the vector (BL')).

[0168] (4) Assemble the sgRNA expression cassette into the pYLCRISPR / Cas9 vector using the cutting and ligation method. The system is as follows:

[0169] Table 2 10 μL 1x BsaI digestion ligation reaction solution

[0170] Reagents Addition volume (μl) Final concentration 10×CutSmart Buffer 1.5 1× 10mM ATP 1.5 1mM pYLCRISPR / Cas9Pubi-H 60-80ng 4-6 ng / μl Mix the sgRNA expression cassette PCR fragments from the previous round 10-15ng per expression cassette / Bsa I-HF 10U 0.1-0.2U / μl T4 DNA ligase 35U 2-3U / μl <![CDATA[H20]]> Final volume 15 μl

[0171] Note: In the above table, mixing the sgRNA expression cassette PCR fragments from the previous round refers to mixing U3-D3-T1 and U6a-D3-T2 or mixing U3-D3-T1 and U6a-D3-T3.

[0172] The PCR instrument was set up with the following program: 37°C for 5 min; 10°C for 5 min, 20°C for 5 min, 10-15 cycles, and finally 37°C for 5 min.

[0173] (5) Positive clones can also be obtained by chemical heat shock transformation. Plasmids are extracted and the sgRNA expression box connection fragments are detected by Mlu I or Asc I restriction electrophoresis. The fragments are sent to the company for sequencing. The CRISPR plasmid containing T1 and T2 dual targets is named pYLCRISPR / Cas9Pubi-H-D3-CTH-N1 plasmid, and the CRISPR plasmid containing T1 and T3 dual targets is named pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid.

[0174] 2. Obtaining transgenic rice with knockout of D3 CTH motif

[0175] The wild type Nipponbare rice was used to replace the recombinant vector Act:D14-GFP or Act:D14 in Example 1. S274E-GFP callus induction" in Example 1, the t20 mutant or d14 mutant was replaced with pYLCRISPR / Cas9Pubi-H-D3-CTH-N1 or pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid containing the recombinant vector Act:D14-GFP or Act:D14 S274E -GFP induction of callus tissue”, and the rest of the operations were the same as those in Example 1 “Induction of callus tissue containing recombinant vector Act:D14-GFP or Act:D14 S274E -GFP callus induction” to obtain callus tissue, and the aforementioned callus tissue was treated according to the “overexpression of D14 or D14 S274E The transgenic rice was obtained by culturing the transgenic plants according to the method shown in "Obtaining transgenic rice".

[0176] 3. Identification of positive plants

[0177] The specific method is as follows: Select the normally growing plants with hygromycin resistance in step 2 for identification of mutation sites. The specific methods of extracting total plant DNA and PCR identification are as described above. The amplified PCR products are purified and sent to the company for sequencing. The sequencing results are compared with the wild-type plant Nipponbare sequence. If there is only one PCR amplification product of the regenerated plant, and it is consistent with the nucleotide sequence of the PCR amplification product of the wild-type Nipponbare rice, the regenerated plant is wild type. If there are two PCR amplification products of the regenerated plant, one is consistent with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare, and the other is mutated compared with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (mutation includes one or more nucleotide deletions, insertions or substitutions), the regenerated plant is heterozygous. If there are two PCR amplification products of the regenerated plant, both of which are mutated compared with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (mutation includes one or more nucleotide deletions, insertions or substitutions), the regenerated plant is a biallelic mutant. If the PCR amplification product of the regenerated plant is one, and a mutation occurs compared to the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (the mutation includes the deletion, insertion or substitution of one or more nucleotides), the regenerated plant is a homozygous mutant. If the PCR amplification product of the regenerated plant is three or more, the regenerated plant is a mosaic. Heterozygous, biallelic mutant, homozygous mutant, and mosaic plants are collectively referred to as edited plants.

[0178] The results showed that among the 45 gene-edited candidate plants, two homozygous plants were obtained and named d3CTH-1 and d3CTH-2. The mutant forms are shown in Figure 4 A. d3CTH-1 are homozygous plants obtained by transformation with pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid.

[0179] Compared with wild-type rice, the D14 gene in the genome of the homozygous mutant d3CTH-1 rice underwent the following mutations: an A base was inserted between nucleotides 2161-2162 of the wild-type genomic sequence of the OsD3 gene, and a G was inserted between nucleotides 2249-2250 of the wild-type genomic sequence of the OsD3 gene.

[0180] Compared with wild-type rice, the D14 gene in the genome of the homozygous mutant d3CTH-2 rice and the homozygous mutant d3CTH-1 rice underwent the following mutations: the nucleotide 2161 of the wild-type genome sequence of the OsD3 gene was deleted, the nucleotides 2163-2169 were deleted, and the nucleotides 2247-2252 were deleted.

[0181] 4. Count the tillering number of positive plants

[0182] The experimental method is as follows: the wild-type rice Nipponbare and the above-mentioned homozygous plants d14ΔN-1 and d14ΔN-2 are used to replace the wild-type rice Nipponbare, d14 mutant, t20 mutant and other plants in the "Counting the number of tillers of homozygous positive plants" in Example 1, and other operations are the same as those in "Counting the number of tillers of homozygous positive plants" in Example 1.

[0183] The results showed that compared with the wild type, the tiller numbers of both d3CTH-1 and d3CTH-2 lines increased ( Figure 4 (B).

[0184] 5. Detection of D53 protein levels in positive plants

[0185] The experimental method is as follows: (1) Prepare a 10% concentration 12-well or 15-well SDS-PAGE protein gel. The amount of protein sample loaded depends on the experimental requirements. Set the voltage to 80-120V for about 1-2h. (2) Use the semi-dry transfer method to transfer the protein to the PVDF or NC membrane, the voltage is 15-20V, and the transfer time is 30-60min. (3) During the transfer, prepare 4% skimmed milk powder in TBST solution. After the transfer is completed, place the PVDF or NC membrane in 4% skimmed milk powder and incubate it at room temperature at 70rpm on a shaker for 60min. (4) Pour out the skimmed milk powder, rinse with TBST, add new 4% skimmed milk powder, add the protein antibody to be detected, and incubate for 1-2h or overnight at 4℃. (5) After incubation with the primary antibody, wash the PVDF or NC membrane three times with TBST, each time at 70 rpm for 5 minutes at room temperature, then add 4% skim milk containing the secondary antibody and incubate at room temperature for 60 minutes on a 60 rpm shaker. (6) After incubation with the secondary antibody, wash the membrane three times with TBST, each time at 70 rpm for 5 minutes at room temperature. Add the color developing solution and use a photosensitive film or a protein developing instrument for protein development. The internal reference protein is Actin, purchased from Abmart, Cat#M20009L.

[0186] The results showed that compared with the wild type, the D53 protein in d3ΔCTH-1 and d3ΔCTH-2 increased ( Figure 4 Middle C).

[0187] 6. Detection of the transcription level of rice tillering inhibitory gene OsTB1 at the stem base of transgenic rice seedlings

[0188] The experimental method is as follows: d3ΔCTH-1 and d3ΔCTH-2 rice seedlings were grown in a rice incubator (MLR-351H, SANYO, Japan) at 28°C for 16 h of light and 25°C for 8 h of darkness. The light intensity (150–200 μM m -2 s -1 ), humidity was 70%. After culturing in Kimura culture medium for 2 weeks, stem base tissues (1 cm) of seedlings of different materials were collected and total RNA was extracted. Fluorescence quantitative PCR was used to detect the transcription level of the rice tillering inhibitory gene OsTB1 in transgenic rice, and the specific method was as follows:

[0189] Extraction using TURBO DNA-free TMThe kit removes residual DNA from total RNA. For detailed steps, see the instructions. Each reaction system is set to 20 μL, total RNA is 12.5 μg, incubate at 37°C for 30 min, add 2 μL DNase inactivation reagent and mix thoroughly at room temperature for 5 min, centrifuge at 12,000g for 5 min, and use 4 μL supernatant for reverse transcription experiments. III First-Strand Synthesis System reverse transcription kit to synthesize the first strand of cDNA. For detailed steps, see the instructions. Finally, add 180 μL of nuclease-free double-distilled water to dissolve the reverse transcription product and mix thoroughly before use.

[0190] Fluorescence quantitative PCR was used to detect the transcription level of SL-biosynthesis gene D10 in the roots of transgenic rice seedlings. Each reaction system in fluorescence quantitative PCR was 10μL, including 5μL SsoFast EvaGreen supermix, 0.5μL upstream primer (5μM), 0.5μL downstream primer (5μM), 2.0μL pure cDNA and 2μL ddH2O. The instrument used for fluorescence quantitative PCR was BIO-RAD's real-time fluorescence quantitative PCR instrument (model: CFX96). The PCR running program parameter setting information was: 98℃, 30s; (98℃, 5s→60℃, 5s→information collection), 40cycles; 60-95℃, 0.5℃ / 5s, information collection / 5s. After the program was completed, the data was processed by BIO-RAD CFX Manager software.

[0191] Fluorescence quantitative PCR primers for detecting OsTB1 gene expression:

[0192] OsTB1-F:5'-CGACAGCGGCAGCTACTAC-3';

[0193] OsTB1-R:5'-GCGAATTGGCGTAGACGA-3';

[0194] qUbiquitin-F:5'-AACCAGCTGAGGCCCAAGA-3';

[0195] qUbiquitin-R:5'-ACGATTGATTTAACCAGTCCATGA-3'.

[0196] The results showed that compared with the wild type, the expression of tillering inhibitory gene OsTB1 in d3CTH-1 and d3CTH-2 lines was reduced ( Figure 4 (middle D).

[0197] 7. Double yeast hybrid experiment

[0198] The experimental method refers to the "yeast two-hybrid assay" method in Example 1 above.

[0199] The results showed that the interaction between the mutant d3ΔCTH-1 and d3ΔCTH-2 proteins and D14ΔN in yeast was almost undetectable ( Figure 4 Middle E), indicating that CTH plays an important role in the interaction between D14 and D3.

[0200] In summary, the CTH motif of D3 is important for direct interaction with D14, and the negative regulatory role of the CTH motif may be due to a dominant negative effect of competitive interference on the formation of the D3-D14-D53 complex and / or the displaced CTH may put D14 in a "sluggish" state, thereby weakening SL perception and inhibiting D53 ubiquitination and degradation.

[0201] The above examples involve the following sequences:

[0202] Rice tillering-related protein encoded by OsD3 gene (SEQ ID No.1)

[0203] MAEEEEVEEGRSSSSAILDLPEPLLLHILSFLTDVRSRHRAALACGRMRAAERATRSELSLRGDPRSPGFLFLSHAFRFPALEHLDLSLVSPWGHPLLSSVPPCGGGGGGAPSASSSSGMNVYHPEAISEQNAFIAARLAGCFPAVTSLAVYCRDPTTLANLTPHWQASLRRVKLVRWHQRPPTLPDGADLEPLLETCAALRELDLSEFYCWTEDVVRALTTHPSATAALTHLDLGLAAATDGFKSSELGPIAASCPNLRKLVAPCLFNPRFSDCVGDDALLSLATSCPRLTVLRLSEPFEAAANIQREEAAITVAGLVAFFAALPALEDFTMDLQHNVLEAAPAMEALARRCPRIKFLTLGSFQGLCKASWLHLDGVAVCGGLESLYMKNCQDLTDASLAAIGRGCRRLAKFGIHGCDLVTSAGIRRLAFTLRPTLKEVTVLHCRLLHTAECLTALSPIRDRIESLEINCVWNTTEQPCSVANGTTTECDPEDDELGEVYESAAKKCRYMEFDDLGSWEMLRSLSLWFSAGQLLSPLISAGLDSCPVLEEISIKVEGDCRTCPRPAPRTIFGLSDLAGFPVLAKMKLDLSEAVGYALTAPTGQMDLSLWERFYLHGIESLQTLYELDYWPPQDKDVHHRSLTLPAVGLIQRCVGLRKLFIHGTTHEHFMTFFLSIPNLRDMQLREDYYPAPENDLMFTEMRAESWLRFEVQLNSRQIDD*。

[0204] CDS nucleotide sequence of OsD3 gene (SEQ ID No.2)

[0205]

[0206] OsD14 gene CDS nucleotide sequence

[0207] 5'-ATGCTGCGATCGACGCATCCGCCGCCCAGTAGCCCGAGCAGCAGCAGCAGCGGCGGCGGCGGGGGCGGGGGGTCGTCGGCGTCGTCGAGCTCGGAGAAGACGATGGTGGGCGGCGGGGGAGGAGGGGGAGGAGGGAGCGGGTCGGCGGCGCCGAGCGGGGCGAAGCTGCTGCAGATCCTGAACGTGCGGGTGGTGGGGAGCGGCGAGCGGGTGGTGGTGCTGTCGCATGGCTTCGGGACGGACCAGTCGGCGTGGAGCCGCGTGCTGCCGTACCTCACCCGCGACCACCGCGTCGTGCTCTACGACCTCGTCTGCGCCGGCAGCGTCAACCCGGACCACTTCGACTTCCGCCGCTACGACAACCTCGACGCCTACGTCGACGACCTGCTCGCCATCCTCGACGCGCTCCGCATCCCGCGCTGCGCCTTCGTCGGCCACTCCGTCTCCGCCATGATCGGCATCCTCGCCTCCATCCGACGACCTGACCTCTTCGCCAAGCTTGTCCTCATCGGCGCCTCTCCCCGGTTCTTGAACGACAGCGACTACCACGGCGGGTTCGAGCTGGAGGAGATACAGCAGGTGTTCGACGCGATGGGGGCGAACTACTCGGCGTGGGCGACGGGGTACGCGCCTCTGGCGGTGGGCGCCGACGTGCCGGCGGCGGTGCAGGAGTTCAGCCGCACCCTCTTCAACATGCGCCCGGACATCTCCCTCCACGTCTGCCAGACCGTCTTCAAGACCGACCTCCGCGGCGTGCTCGGCATGGTCCGCGCCCCCTGCGTCGTCGTCCAGACCACCCGCGACGTCTCCGTCCCGGCCTCCGTCGCCGCCTACCTCAAGGCCCACCTCGGCGGCCGCACCACCGTCGAGTTCCTCCAGACCGAGGGTCACCTCCCCCACCTCAGCGCCCCCAGCCTCCTCGCCCAGGTGCTCCGCCGCGCTCTCGCCCGGTACTAA-3'。

[0208] OsD53 gene CDS nucleotide sequence

[0209]

[0210] Wild-type genomic sequence of the OsD3 gene

[0211]

[0212] GAGCGATTTTATTTGCATGGTATCGAATCACTGCAGACTTTGTATGAATTGGACTACTGGCCGCCCCAAGACAAGGATGT

[0213] GCACCACCGGAGCCTGACATTGCCAGCCGTGGGATTGATCCAACGCTGCGTTGGACTCAGGAAGCTTTTCATCCATGGCA

[0214] CCACACATGAGCACTTCCATGACCTTCTTCCTTTCAATTCCAAACTTGCGGGACATGCAGTTGCGGGAGGACTATTATCCA

[0215] GCCCCAGAGAATGATCTGATGTTCACAGAGATGCGGGCTGAATCTTGGCTTAGGTTTGAGGTGCAACTGAACAGCCGGCA

[0216] AATTGATGATTAGTTATGTGGGCACAAAATGGTTTGAAGCTGAATACAGAGATTTATCTGGATGGTGCCATTGCTCCACT

[0217] GTGCAATGGCAGGGATTCCTGGTGAGTTGGTTATGATTATGGGTGGAGTCGTGTGTATTGCTGCATGCCATTGAGGAG

[0218] AGTAGTATACTGGCAGCACTTGGATCTGTCAGCAAAGTAACCTTCTCCAGTTGCTTTTTTACCCCTTTTTTGATGTAATA

[0219] AGAGAGTTGGGTCGGAAATGAGATATTTGCAGGAGATAAGATTATAAATTAGGCTTCATGGAAATTTTCCAAGAAAAAA

[0220] AAACATTTTGTTTTTAAGATGGTCTGAGTTGTGAACACCGCAAGAGTAATTGGCAAATTGGCATGGTTCTAGCGGTTTG

[0221] TAACATTTGAACTCTGTAAACAAAAGAAAAACGCCACTCGCTTTTCTTATGCCCTTTGCTTCATGGGTGAAAGTGGCTCA

[0222] TCTAATATTGGTCAGTGTTTTACTGTTTTCAATGGATGGGCAACGGAGTTCAGTACTACTGCGATAGGAAACTATTTTGA

[0223] TGTGTACATAACAGCTCTATTAATCCAAAATTATGTGCCTTTGCTCTTTGAGTTTATTTCTGTCCCTTTCCTTTTCCATT

[0224] TCATGCACAGGCTTGGTGACAAATGGGATGGCGTGTGCAGATGTGCAAGCCAGTTTTGCATGTCATTATCGGGCATGTTG

[0225] AGTTGCAACACCGGCTACAACAAGGTTTACTTTAATACACAGCAGTAAGGATTTAATCTGATAGAATGTTGAAAGGTTTT

[0226] CTCTTTTTTATGCAGGATTGAAAGCTGCTTTAGTTTCCAAGGAACAACCAATCAGTTCCATCAGAACTGACTACCACCAT

[0227] TTGCTGATTCGTTCTCTGCAGTGATCCCCAATGGAGACCTGGCCTTTGCTTCATCTCATCCTCAAACTGTAGCATGACAA

[0228] GAAAGACGTGCGGAACAAGATCAGCATCAGAACATGACAAAAAGATTTTCGCACTAGAAGCCGGTTTATCCAATTCCTCT

[0229] GCTTGCCTCTTCCATTCAGCTAGTTAAGATAATGCGAGATCACTGGTTTTGTCAAAGCAAATCCAGACGATTCTTGGTGC

[0230] CATGGAAAAAGAAGTCGTCCATGAGTGAGAGAGCTCTCTTGTCCTAATCCATCAGCAAGGGCAATAATGCTTTTTTGATT

[0231] AAGCAGCTGGAGGCCTCACAAAATAATGCTTAAGCAAGTACTACTACAGGATTAAAAGCTGGCCTCTAGAAGGAGTAGAT

[0232] TAGGTAGAGGAGAAGCTTCTCCTTTCCTCTTTTGCCACGTTGAGGCTTATTGCTCACATGATTGTCAATCAACCACGTCA

[0233] CACAAGCACATACACACACTTATTATTTGCTCATAGTTTTAGTTATTTATCAACATTTGGCAGATATGTGTTGGAAATTC

[0234] AGATGCTCCTTGATGCCATTTTATCTTGCTGGTACATCTGCATAACTCGCTCATTACTATCTGTTGCAATATTATTATAC

[0235] ATTTGGATATTTAATGTGCTGATCGCTTCTTGCTACCTATCTAATTTCAGAATGTCTTGAAAGCAAAGCTGGTGACAGGA

[0236] GAGATGTCATATGAGCAGGCAGTCAGTTGCAGCCTTGTGGTTGCACCTCCCTTTCCTGCTGTCCTCTTTTTTTTGTTTTC

[0237] CCTGGTTTCTCTTCATCAGAATTAAAGCAGATATTTTTGTGGCGGCCGTGGATTTCCATTCATCTGATGATCAGCTAGTA

[0238] ATATTCTGCAAGTGCCTTCCGATAGAATTGAGCGATGATTCTGAGGTCAGATACTCATCAGATGCTCGAAGGATAAGTGG

[0239] GTTTCAGACGATGCTGCAAAAGATATTAGCCGGCGAGTGAGGTGAGGCTACTAGCCTACTAGGCTTATCGCCTTGTATAA

[0240] AACTAAAGGAGTCAGTACAGAGACATCAGGTAAAGTCAGCATATGCAGCTATCCATCTATGCATGCATGCACCAACTGCA

[0241] AAGTAAAGGTAAAAGTGAAAGCTTTGTCTCTCCAGGTGTATGGAAGAAAATTATCCTTGTGATGGTTATGCAACTCACTCT

[0242] TTTGTTTGCACCCAGATATGTCATATTGGCTTTTCACCATGGTGTCAAGGTTGATGTGAATGTGAATGTGATTCTACTA

[0243] ATTTGAGGTCATGTAGAGTAATTAAGTAAGCAAATGGAGCCCGTCATGTCGTCATGCACTGACAAGGATATAGTCCTATG

[0244] GACCTCTATTTTGATTAATTGGTGGAGAAAATTCAGAGGAAAAATATGTGTGTGCTGGAATATGTTGGTATTTTTTTTTT

[0245] ACAA-3'.

[0246] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of the CTH motif of OsD3 protein in regulating the tiller number of rice or preparing products for regulating the tiller number of rice or / and in rice breeding.

2. The use according to claim 1, characterized in that: The CTH motif is any of the following; A1) the amino acid sequence is a polypeptide at positions 693 to 720 of SEQ ID No. 2; A2) a polypeptide having more than 80% identity with the protein represented by A1) and having the same function as the protein represented by A1) obtained by substitution and / or deletion and / or addition of amino acid residues; A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid shown in any one of A1) or A2).

3. The use according to claim 2, characterized in that: The regulation is to upregulate, enhance or increase the expression of the gene encoding the polypeptide of claim 1 or the content or activity of the polypeptide.

4. The use according to claim 2, characterized in that: The regulation is to down-regulate, inhibit or reduce the expression of the gene encoding the protein in claim 1 or the content or activity of the protein.

5. The use according to any one of claims 1 to 4, characterized in that: The substance is a biological material, and the biological material is any one of the following: B1), an RNA molecule that inhibits, reduces or down-regulates the expression of the gene encoding the protein of claim 1 or an RNA molecule that inhibits, reduces or down-regulates the activity or content of the protein; B2), expressing the coding gene of the RNA molecule described in B1); B3), an expression cassette containing the gene described in B2); B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3); B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4); B6), a transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7), transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8), a transgenic plant organ containing the gene described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4); B9), a nucleic acid molecule encoding the protein according to claim 1; B10), an expression cassette containing the nucleic acid molecule described in B9); B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B3); B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10); B14), transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10); B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10).

6. The use according to claim 5, characterized in that: B1) The RNA molecule targets the gene encoding the protein.

7. The use according to claim 5, characterized in that: B9) The coding sequence of the nucleic acid molecule is SEQ ID No.

2.

8. A method for regulating the tiller number of rice, comprising the following steps: regulating the expression of the gene encoding the polypeptide of claim 1 in the target plant or regulating the activity and / or content of the protein to change the tiller number of the target plant.

9. A method for increasing the tiller number of rice, comprising the following steps: down-regulating or inhibiting or reducing the expression of the gene encoding the protein described in claim 1 in a recipient rice or regulating the activity and / or content of the protein, so as to increase the tiller number of the recipient rice; the recipient rice contains the encoding gene.

10. The protein of claim 2 or the biomaterial of claim 5.

Images