Preparation method of PSR.Syn.CD19.BCMA CAR-T cells and their cells and applications

Abstract

The present invention provides a preparation method of PSR.Syn.CD19.BCMA CAR-T cells, and cells and applications thereof. The PSR.Syn.CD19.BCMA CAR-T cells refer to CAR-T cells that induce expression of effector molecules BCMA-CAR after co-incubation with CD19 antigen-positive tumor cells. If the tumor cells simultaneously express BCMA antigens, the CAR-T cells that kill tumors will be recognized. Experimental results show that the cells of the present invention prepared by the method of the present invention can efficiently and specifically kill tumor cells, have a persistent killing effect, and have a safety switch for starting the killing function. In addition, in addition to being able to specifically kill tumors, the cells of the present invention have a high proliferation rate, and the proliferation rate under tumor cell stimulation is higher than that of the PAN-T group.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to a preparation method of PSR.Syn.CD19.BCMA CAR-T cells, cells thereof and applications thereof. Background Art

[0002] CAR-T cell therapy is a therapy that transfers the coding gene of the specific antigen chimeric receptor CAR into T cells, and then re-injects the cells into the patient's body. The CAR expressed by the T cells recognizes the targeted antigens on the surface of tumor cells, activates the killing activity of T cells, and then releases perforin, granzyme, cytokines, etc. to exert tumor killing effects. CAR-T cells will directly exert anti-tumor killing effects without the need for major histocompatibility complex (MHC) recognition restrictions.

[0003] The side effects of CAR-T cell therapy include cytokine release syndrome, cytopenia, neurotoxic syndrome, graft-versus-host disease (GVHD), "On target off tumor" toxicity, etc. Among them, "On target off tumor" toxicity is related to the single mechanical killing recognition mode of CAR-T cells.

[0004] In 2016, Roybal et al. developed a new SynNotch system, which is an "AND GATE" circuit system and successfully applied it to CAR-T cell therapy. Mode of action of the SynNotch system: The corresponding two antigens must be expressed on the surface of tumor cells at the same time to activate the specific killing function of SynNotch CAR-T (Syn-CAR-T) cells. Therefore, Syn-CAR-T cells can achieve the goal of intelligently identifying and killing tumors, thereby improving the safety of CAR-T cell therapy. The SynNotch system only transforms and replaces the extracellular region, intracellular region, and downstream effector elements of the wild-type Notch receptor, retaining the core regulatory region of the Notch receptor. The extracellular region (input recognition signal) can be replaced with scFv molecules of homologous specific antibodies targeting various tumor cells (such as CD19-scFv), and the downstream effector elements (output transcription signals) can be replaced with antibody scFv molecules, cytokines, immune activation or inhibition molecules, fluorescent proteins, etc. The NICD required for transcriptional regulation is replaced with the artificial transcription factor Gal4-VP64, which is a new fusion protein obtained by combining two natural transcription factors. The working principle of the Gal4 / VP16-UAS expression system is that the DNA binding domain of Gal4 can specifically activate the transcription of the target gene after binding to the upstream activation sequence (UAS), and the herpes simplex virus VP16 protein can enhance gene transcription expression. This system has been widely used in the study of gene expression regulation.

[0005] SynNotch is a synthetic Notch receptor. The mouse Notch1 receptor is modified. The extracellular domain is replaced with a single-chain antibody (A antibody scfv (single-chain antibody)), and the intracellular domain is replaced with the transcriptional activation domain Gal4VP64, retaining only the transmembrane core domain (NC) that can be recognized and cleaved by proteases. The Notch receptor protein is composed of an extracellular region fragment (NECD), a transmembrane region fragment (TMD), and an intracellular region fragment (NICD). When the extracellular region receptor binds to the ligand, it changes conformation, exposes the cleavage site, is recognized by metalloproteinases and γ-secretase, and is cleaved. After cleavage, the intracellular region NICD is released. NICD can translocate to the nucleus through the nuclear localization signal NSL and play the role of a transcription factor, thereby activating downstream signaling pathways.

[0006] The response program of the SynNotch system represents a strategy for reconstructing T cell responses. Taking SynNotch CAR-T cells as an example, the surface of tumor cells needs to express two corresponding antigens at the same time to activate the specific killing function of CAR-T cells. Therefore, SynNotch CAR-T cells can achieve the goal of accurately identifying and killing tumors. However, the SynNotch system is relatively large. The system control elements include the Notch receptor core region, the intracellular transcription factor Gal4VP64, the UAS recognition sequence, and the internal promoter, which are about 2.5kb in total. The input signal molecules (such as CD19-scfv) and output signal molecules (such as BCMA-CAR) in the editable region of the system are about 2.5kb in total. The entire system occupies about 5kb and needs to be delivered through two lentiviral vector plasmids, namely a GAL4 induction vector and a UAS effector vector. Therefore, when transducing target cells, it is necessary not only to prepare two lentiviral vectors, but also to perform double virus transduction of target cells.

[0007] The SynNotch system also faces a problem. When the UAS effector vector is not activated, the effector molecule is not expressed, and the transduction efficiency cannot be detected by flow cytometry, unless a promoter is added to express a fluorescent protein signal alone for transduction efficiency detection. The use of lentiviral vectors for dual-virus transduction of T cells will cause a production problem, that is, the efficiency of preparing double-positive T cells is low, and flow sorting and enrichment are required to obtain T cells with a high double positive rate. In addition, due to the toxicity of VSV-G envelope protein and the use of third-generation self-inactivating lentiviral vectors for packaging, lentiviral vectors can only be transiently transfected and packaged, and cannot be prepared on a large scale. The packaging titer is low and enrichment and purification are required, which greatly limits the clinical application of Syn-CAR-T cell therapy. Due to the above reasons, the application of the SynNotch system in CAR-T cell therapy is greatly limited, and further receptor system optimization or vector optimization is needed.

[0008] The problem of low preparation efficiency faced by delivering the SynNotch system through lentiviral vectors can be solved by replacing the viral vector for packaging. Currently, commonly used viral vectors include γ-retroviral vectors (γ-RV). γ-RV is a simple retrovirus with a diameter of about 100nm and an envelope. The genome is 2 copies of positive-strand RNA. The genome size is about 8.3kb, and the genome only includes 2 LTRs, Gag-Pol, and Env. γ-RV can only transduce dividing cells, but not non-dividing cells. It can integrate the host genome and has a high packaging titer. Inserting an exogenous target gene larger than 4kb will greatly reduce the vector packaging titer. In order to further improve the safety of γ-RV and reduce the generation of replicative RCR, the U3 promoter of the 3'LTR of γ-RV was deleted to transform it into a self-inactivating γ-retroviral vector (SIN-RV).

[0009] The γ-RV vector has a mature large-scale stable transfection packaging method and high production titer, but the retroviral vector is randomly integrated into the host chromatin, and there is a risk of insertion mutation inducing host proto-oncogene expression. The U3 enhancer of SIN-RV is deleted, which reduces the risk of carcinogenesis and greatly improves the safety of the vector. The challenge facing SIN-RV is the difficulty in large-scale production of viral vectors. Due to the lack of U3 elements, it is impossible to construct a stable transfection packaging cell line. It can only be obtained through transient transfection packaging, which is difficult to expand production, and it is difficult to screen out cell clones that produce SIN-RV stable transfection using traditional methods. Summary of the invention

[0010] In order to solve the above problems, the present invention provides a method for preparing PSR.Syn.CD19.BCMA CAR-T cells, wherein the PSR.Syn.CD19.BCMA CAR-T cells refer to CAR-T cells that will induce expression of effector molecules BCMA-CAR after co-incubation with CD19 antigen-positive tumor cells. If the tumor cells also express BCMA antigens, they will recognize and kill tumor CAR-T cells; the method includes: step 1: using the PiggyBac transposon system to construct a stably transfected SIN-γ-RV vector, i.e., a PSR vector; step 2: using the PSR vector prepared in step 1 to express the SynNotch system, merging the GAL4 induction vector and the UAS effector vector of the SynNotch system on one of the PSR vectors, so that the SynNotch system is delivered by one of the PSR vectors; constructing a plasmid of a PSR.Syn.CD19.BCMA retroviral vector, i.e., a PSR.SynNotch vector targeting CD19 and BCMA, a plasmid vector with CD19 as an induction target and BCMA as an effector target; and step 3: transducing the plasmid of the above retroviral vector into T cells to prepare the PSR.Syn.CD19.BCMA CAR-T cells.

[0011] The PiggyBac transposon (PB) system is a DNA transposon that can integrate the target gene between ITRs into the target cell genome and express it stably for a long time through a "cut-and-paste" mechanism. In the PB system, the ends of the PB transposon are 13bp inverted repeat sequences (ITRs), and the PB transposase is expressed by a separate plasmid. PB integration mechanism: After double plasmid transfection, the PB transposase recognizes the ITRs at both ends of the vector, cuts off from both ends of the ITR to become a free PB transposon (carrying the target gene), the genomic TTAA site is cut to form a sticky end, and the PB transposon is inserted into the "TTAA" site of the genome for integration.

[0012] In one embodiment, in step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element that is a viral vector packaging signal and a SD that is a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region.

[0013] In one embodiment, the 5'UTR deletes all Gag and Pol coding region sequences and the start codon ATG.

[0014] In one embodiment, when constructing the PSR.Syn.CD19.BCMA plasmid, the effector receptor UAS anti-BCMA-CAR, SFFV promoter, SP signal peptide, Myc tag, induced receptor anti CD19 scfv-Notch-Gal4VP64, and WPRE element are respectively inserted between the 5'LTR and the 3'SIN-LTR, and the induced receptor is expressed by the SFFV promoter.

[0015] In one embodiment, when constructing the plasmid of the PSR.Syn.CD19.BCMA retroviral vector, two molecular tags CopGFP P2A Puro for screening monoclonal cells are inserted between the 3'SIN-LTR and 3'TIR transposon, that is, CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, which are connected by P2A.

[0016] In one embodiment, the molecular tag is expressed by the composite promoter hEF1α-HTLV.

[0017] In one embodiment, PSR.Syn.CD19.BCMA CAR-T cells constructed by the above method are provided.

[0018] In one embodiment, the use of PSR.Syn.CD19.BCMA CAR-T cells prepared by the above method in the preparation of tumor drugs is provided.

[0019] In one embodiment, a pharmaceutical composition for treating a tumor is provided, wherein the pharmaceutical composition contains the above-mentioned CAR-T cells and a pharmaceutically acceptable carrier, diluent or excipient.

[0020] In one embodiment, a method for inhibiting tumor cells in vitro is provided, comprising contacting tumor cells with the above-mentioned CAR-T cells or the above-mentioned pharmaceutical composition, thereby inhibiting the tumor cells.

[0021] The present invention utilizes a PSR vector to express the SynNotch system, and combines a GAL4 inducible vector and a UAS effector vector on a PSR vector (single vector system). Only one PSR.SynNotch vector needs to be constructed for viral packaging, and a single viral vector is used to transduce target cells. When the UAS effector element is not activated and not expressed, the transduction efficiency can be detected by using the label of the GAL4 inducible element. The PSR.SynNotch system of the present invention not only solves the problem that the transduction efficiency of the downstream effector molecules of the dual vectors of the original system is difficult to detect, but also solves the problem that the efficiency of preparing double positive cells by dual vector transduction of target cells is low. Most importantly, a stable transfection packaging cell line can be constructed for expanded production, which is very beneficial to the application of the SynNotch system.

[0022] In order to further verify the induction efficiency of the SynNotch system in the PSR.Syn vector, the present invention selected four tumor antigens (human BCMA antigen, human CD38 antigen, human CD19 antigen, and human GPC3 antigen) as targets, and constructed PSR.SynCAR vectors respectively. In order to facilitate the detection of the induction efficiency of the SynNotch system, the UAS downstream effector molecule will select the fluorescent protein tagBFP. After co-culture with the corresponding tumor cells, the SynNotch receptor activation efficiency in the PSR.Syn vector can be evaluated by detecting the expression efficiency of tagBFP, and the target with the best induction efficiency can be screened out. The results showed that the induction efficiency of targets BCMA, CD38, and GPC3 was extremely low and they were not suitable for the SynNotch system; the target CD19 had the highest induction efficiency and was most suitable for the SynNotch system because CD19-Syn-CAR-T cells recognized CD19 antigen-positive tumor cells, exposed restriction sites, and cleaved and released the artificial transcription factor Gal4-VP64. Gal4-VP64 entered the cell nucleus through the nuclear localization signal NSL and bound to the upstream activation sequence UAS to activate the expression of downstream effector molecules.

[0023] The present invention designs a PSR.SynNotch vector targeting CD19 antigen and BCMA antigen, with CD19 as an induction target and BCMA as an effector target. PSR.Syn.CD19.BCMA plasmid (Syn-CAR190) was constructed by seamless cloning technology, and the successfully prepared cells of the present invention were co-incubated with 6 tumor cells (3 single positive and 3 double positive tumor cells) to detect the induction effect. The experimental results show that the cells of the present invention have a strong intelligent specific induction expression function (induction efficiency greater than 70%), and the background leakage expression is low (within 10%). After the cells of the present invention were successfully prepared and proved to have a strong induction expression ability, the anti-tumor function verification was started. At the same time, this subject prepared CAR10-T cells targeting BCMA antigen as positive control group cells. The killing effect of the cells of the present invention on tumor cells was studied by luciferase method, and there were 6 target cells. The experimental results show that under different effector-target ratios, the cells of the present invention have a specific killing function on double-positive tumor cells (CD19+BCMA+), and have no specific killing effect on single-positive tumor cells (CD19+ or BCMA+), proving that the cells of the present invention can efficiently and specifically kill tumor cells (CD19+BCMA+), and have a safety switch to activate the killing function. Through the Incucyte real-time cell dynamic monitoring system, the experimental results show that the cells of the present invention have a persistent killing effect on RPMI-CD19 cells, K562-CD19-hBCMA cells, and Raji-BCMA cells after 72 hours of co-incubation monitoring. The cytokine content in the cell culture supernatant of the present invention was quantitatively detected by the CBA method. The experimental results showed that the levels of IFN-γ, TNF-α, and cytokine IL-10 secreted by the present invention group and the CAR10-T group were significantly higher than those of the PAN-T group, with statistical differences. The experimental results further showed that Syn-CAR188-T cells have a strong anti-tumor function (CD19+BCMA+), and the induction recognition and re-killing mode can play an effective anti-tumor function. The experiment detected the proliferation ability of T cells by the CFSE method. The experimental results showed that after CFSE staining, when the three groups of T cells were not co-incubated with tumor cells, the cell proliferation efficiency was high after 48 hours of culture, and there was no significant difference between the three groups of T cells. After 48 hours of incubation and culture of the cells in the co-incubation group with K562-CD19-hBCMA cells and K562-hBCMA cells, the proliferation efficiency of the cells of the present invention was higher than that of PAN-T cells, proving that the cell proliferation rate of the present invention under tumor cell stimulation is higher than that of PAN-T cells. In summary, the experimental results show that the cells of the present invention can efficiently and specifically kill tumor cells, have a persistent killing effect, and have a safety switch to start the killing function. In addition, in addition to being able to specifically kill tumors, the cells of the present invention have a high proliferation rate, and the proliferation rate under tumor cell stimulation is higher than that of the PAN-T group. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 It is a schematic diagram of the design of the vector PSR vector plasmid of the present invention;

[0026] Figure 2 It is a schematic diagram of the design of the PSR.Syn.BFP plasmid of the present invention;

[0027] Figure 3 This is the result graph of the transduction efficiency of Syn-CAR-T flow cytometry;

[0028] Figure 4 This is a flow cytometry result diagram of the induction efficiency after incubation of Syn-CAR-T cells and tumor cells;

[0029] Figure 5 This is a schematic diagram of the design of the PSR.Syn.CD19.BCMA plasmid of the present invention;

[0030] Figure 6 This is a diagram showing the electrophoresis identification results of the PCR amplified fragment of the vector PSR.Syn.CD19.BCMA plasmid of the present invention;

[0031] Figure 7 The figure shows the results of luciferase assay to detect the killing efficiency of Syn-CAR190-T on different target cells, where ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns: no statistical difference, n=3; Figure 7 A: The three groups of T cells were incubated with K562-CD19-BCMA (double positive) for 12 h; Figure 7 B: incubated with K562-BCMA (single positive) for 15 h; Figure 7 C: incubated with RPMI-CD19 (double positive) for 12 h; Figure 7 D: incubated with RPMI (single positive) for 6 h; Figure 7 E: incubated with Raji-BCMA (double positive) for 12 h; Figure 7 F: incubated with K562-CD19-CD38 (single positive) for 12 h;

[0032] Figure 8The figure shows the persistent killing effect of Syn-CAR190-T on different target cells detected by the Incucyte method (n=3). Figure 8A: 3 groups of T cells were co-incubated with RPMI-CD19 (double positive), with an effector-target ratio of 1:8; 8B: co-incubated with K562-CD19-hBCMA (double positive), with an effector-target ratio of 1:2; 8C: co-incubated with Raji-BCMA (double positive), with an effector-target ratio of 1:1; 8D: 3 groups of T cells were co-incubated with RPMI (single positive), with an effector-target ratio of 1:2. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of this application.

[0034] In the present invention, DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. PB transposon plasmids and PB transposase plasmids were purchased commercially. Plasmids pCDH-CMV-TNFRSF17 (human), pHR_PGK_antiCD19_synNotch_Gal4VP64, pHR_Gal4UAS_tBFP_PGK_mCherry, pCDH-CMV-TNFRSF17 (human)-EF1a-CopGFP-T2A-Puro were purchased from Wuhan Miaoling Biotechnology Co., Ltd. Other genes EGFP, WPRE, SFFV are from commercial plasmids. Pheonix-Ampho cells and PG13 cells were purchased from the American Type Culture Collection (ATCC). 293T cells were purchased from the Cell Resource Center of Peking Union Medical College, Institute of Basic Medicine, Chinese Academy of Medical Sciences.

[0035] Pyrobest DNA polymerase, TAKARA BIO, Japan; plasmid purification kit, QIAGEN, Germany; 50×TAE gel electrophoresis buffer; ethidium bromide (EB) nucleic acid staining solution, Beijing Solebow Technology Co., Ltd.; 6×DNA loading buffer, TAKARA; sodium chloride, agarose, yeast powder, tryptone, agar powder, dimethyl sulfoxide (DMSO solution), Sigma, USA; anhydrous ethanol, Beijing Chemical Industry Group Co., Ltd.; PCR product purification kit, Nanjing Novozyme Biotechnology Co., Ltd.; DNA Assembly Mix Plus, puromycin hydrochloride, Beijing Rambolide Trading Co., Ltd.; endotoxin-free midi-plasmid extraction kit, Beijing Tiangen Biochemical Technology Co., Ltd.; ampicillin powder, BioRuler, USA. DMEM medium, Opti-MEM medium, fetal bovine serum (FBS), trypsin (1×EDTA), phosphate buffered saline (1×PBS), 100× penicillin-streptomycin solution (P / S), Gibco, USA; FuGene HD transfection reagent, Promega, USA; Retronectin (recombinant human nexin fragment), Takara, Japan; Trypan blue solution, Invitrogen, USA. Polybrene virus infection enhancement reagent, from Beijing Solaibao Technology Co., Ltd. If not otherwise specified, the reagents and raw materials used in the present invention are all from commercial reagents.

[0036] Example 1 Construction of PSR.SynNotch vector and preparation of Syn-CAR-T cells targeting different antigens

[0037] (I) PSR vector construction

[0038] The present invention utilizes the PB transposon system (PB transposon plasmid and PB transposase plasmid) to construct a stably transfected SIN-γ-RV vector (PSR), which can stably produce self-inactivating retroviral vectors. The specific design pattern is shown in FIG. Figure 1As shown. The 5'LTR, non-coding region UTR (Ψ element is the viral vector packaging signal, SD is the splicing donor site), and 3'SIN-LTR sequence of the SIN-γ-RV vector are inserted between the 5'ITR and 3'ITR sequences of the PB transposon. According to SCHAMBACH A, MUELLER D, GALLAM, et al. Overcoming promoter competition in packaging cells improves production of self-inactivating retroviral vectors [J]. Gene Therapy, 2006, 13 (21): 1524-33, the SIN-γ-RV vector was designed based on pSRS11.SF.GFP. SFFV is the internal promoter of the PSR vector. To facilitate the insertion of the target gene at a later stage, a multiple cloning site sequence (MCS) is inserted after the SFFV promoter. In order to increase the viral vector packaging titer, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence is inserted at the C-terminus of the MCS. In order to facilitate the screening of stable cell lines, two screening tags were designed. hEF1-HTLV promoter-CopGFP-T2A-Puro was inserted after the 3'SIN-LTR element. The Puro gene can be used for puromycin drug screening, and the CopGFP gene can be used for later fluorescence microscopy screening of high-expressing monoclonal cells. The 5' end packaging signal non-coding region (5'UTR) deleted all Gag and Pol coding region sequences and the start codon ATG, thereby further improving the vector packaging capacity and vector safety. The designed vector PSR.MCS was sent to Jinweizhi Biotechnology Co., Ltd. for gene synthesis.

[0039] (II) Design and construction of PSR.SynNotch plasmids targeting different antigens

[0040] Since the downstream effector molecules need the transcription factor Gal4VP64 to induce expression, they cannot be placed downstream of the promoter, so they should be designed upstream of the internal promoter and Gal4 induction receptor. The plasmids of the PSR.SynNotch vector targeting CD19 molecules, BCMA molecules, CD38 molecules, and GPC3 molecules are named PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170). The schematic diagram of the four plasmid designs is shown in the figure below. Figure 2As shown, the effector molecule (UAS tagBFP) and the inducible receptor (SFFV_scfv Notch Gal4VP64) of the SynNotch system were inserted between the 5'LTR and 3'SIN-LTR, and the inducible receptor protein was expressed by the SFFV promoter. In addition, P2A-EGFP fluorescent protein was added downstream of the GAL4VP64 protein as a detection tag for the vector receptor protein (CD19scfv, BCMA scfv, CD38 scfv, GPC3scfv).

[0041] 5'LTR(SEQ ID NO.1):ATGTAGTCTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGC ATTGCAGAGATTTGTATTTAAGTGCCTAGCTCGATACAATAAACGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTaTTCCCAATAAAgCCTCTTGCTGTTTGCATCCGAATCGTGGaCTCGCTGaTCCTTGGGAGGGTCTCCTCaGAtTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0042] 5’UTR(SEQ ID NO.2):TTGGAGACCCCTGCCCAGGGACCACCGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGGGCGTGTTTGTGCCGGCATCTAGTGTTTGCGCCTGCGTCTGTACTAGTTGGCTAACTAGATCTGTATCTGGCGGTCCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCCTGGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCTACCCGAGTCGGACTTTTTGGAGCTCCGCCACTGTCCGAGGGGTACGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCGCCCCCGTCTGAATTTTTGCTTTCGGTTTTACGCCGAAACCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGCGGCCCG

[0043] 3’SIN-LTR(SEQ ID NO.3):ATGAAAGACCCCACCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTGTTCtCAATAAACCCTCTTGCaGTTGCATCCGAcTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0044] The construction of the four plasmids is divided into four target DNA fragments and a vector, which are connected by seamless cloning. The construction of the four plasmids is composed of four DNA fragments and a vector. Three of the DNA fragments and the vector fragment are consistent in each plasmid, and only the template plasmid of the SFFV_scfv Notch Gal4 fragment is different. The p167 plasmid consists of four fragments: fragment 1 (UAS tagBFP), the template comes from pHR_Gal4UAS_tBFP_PGK_mCherry (Wuhan Miaoling); fragment 2, the template comes from pHR_PGK_antiCD19_synNotch_Gal4VP64 (Wuhan Miaoling); fragment 3 (P2A EGFP), fragment 3 is a fusion fragment of EGFP and P2A, pBT2-4xUAS:P2A-EGFP (addgene#127591); fragment 4 (WPRE), fragment 8 is a vector fragment after double enzyme digestion. The SFFV_scfv Notch Gal4 of the other three plasmids are fragment 5, fragment 6, and fragment 7, respectively. The templates are replaced with anti BCMA scfv, anti CD38 scfv, and anti-GPC3-scfv based on fragment 2. Among them, anti BCMA scfv is from the bb2121 anti-BCMA antibody approved by the FDA; anti CD38 scfv is obtained by this research team through phage display antibody library screening, and has been proven to have strong killing function in both in vivo and in vitro experiments. For details, see LI X, FENG Y, SHANG F, et al. Characterization of the Therapeutic Effects of Novel Chimeric Antigen Receptor T Cells Targeting CD38 on Multiple Myeloma [J]. Frontiers In Oncology, 2021, 11: 703087; anti BCMA scfv comes from commercial antibody anti BCMA scfv comes from commercial antibody mouse GC33 clone. Amplification primers need to add homology arms, where the primers for fragment 2, fragment 5, fragment 6, and fragment 7 are the same. The primer sequences are shown in Table 1 below. The vector plasmid is PSR.MCS, and the restriction endonucleases are XhoI and NotI-HF. The PCR product and the enzyme digestion product are subjected to agarose gel electrophoresis and gel recovery.

[0045] Table 1 Primer design for PCR amplification of four targeted PSR.SynNotch plasmids

[0046]

[0047] Note: The underlined part is the homology arm.

[0048] Among them, the sequence number of S-16-1F is SEQ ID NO.4, the sequence number of S-16-1R is SEQ ID NO.5, the sequence number of S-16-2F is SEQ ID NO.6, the sequence number of S-16-2R is SEQ ID NO.7, the sequence number of S-16-3F is SEQ ID NO.8, the sequence number of S-16-3R is SEQ ID NO.9, the sequence number of S-16-4F is SEQ ID NO.10, and the sequence number of S-16-4R is SEQ ID NO.11.

[0049] The preparation process of the target fragment is as follows: PCR amplification, agarose gel electrophoresis, and gel recovery. Finally, the recovered 4 target fragments are recombined and connected, and the connection reaction is carried out at 50℃ for 30min. The connection product is transformed into competent E. coli DH5α and then spread on LB plate, cultured at 37℃ overnight, 3 to 5 positive clones are selected for expansion culture, and the plasmid is extracted and sent to the company for sequencing. The plasmid strain with correct sequencing is selected for expansion culture, and the plasmid is extracted and concentrated.

[0050] (III) Preparation of four vectors PSR.Syn.BFP self-inactivating retroviral vectors

[0051] After Pheonix-Ampho cells and PG13 cells were revived, the cells were in good condition, and the cell generation was preferably within 5 generations. When the cell confluence was about 80%, the cells were digested and inoculated in a six-well plate at a cell density of 5×10 5 / well, 2mL per well, and 4 wells are reserved for later flow cytometry detection of transfection efficiency. On the second day of inoculation, wait until the cell confluence is 70%-80%. Remove the culture medium and add fresh warm Opti-MEM culture medium dropwise, 1.8mL per well. Calculate the volume of plasmid required for transfection, and add 3.3μg of plasmid to each well. The transfection plasmids are PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), PSR.GPC3.BFP (p170). Add Opti-MEM culture medium to dilute to 200μL / well, gently blow to mix, and incubate at room temperature for 10min. After incubation, the transfection complex was added dropwise and evenly into the six-well plate, 200 μL per well, and the six-well plate was gently cross-mixed and placed in a 37°C, 5% CO2 cell culture incubator for culture.

[0052] After 24 hours of transfection, remove the supernatant of the six-well plate, replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and place in a 32°C, 5% CO2 cell culture incubator for culture. After 24 hours of culture at 32°C, gently aspirate the supernatant (48h virus vector supernatant), replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and continue to culture in a 32°C, 5% CO2 cell culture incubator. After 24 hours of culture, collect the cell supernatant (72h virus vector supernatant). The collected supernatant was filtered and purified with a 0.45μm disposable syringe filter, and the filtered virus vector was immediately placed in a -80°C refrigerator for aliquoting and storage.

[0053] (IV) Preparation of Syn-CAR-T

[0054] 10 mL of venous blood was collected from healthy volunteers, PBMC cells were extracted, IL-2 and OKT-3 were added to activate T cells, and after culturing with AIM-V complete medium for 48 hours, T cells were transduced with the supernatants of the four retroviral vectors prepared above, PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170), and retronectin was used as a transduction reagent.

[0055] One day before transduction, add the transduction reagent Retronetin to the Non-treated 12-well plate for incubation, that is, add 1mL of 1×PBS solution and 10μL Retronetin reagent to each well and mix well. Store at 4℃ in the dark. 48h after T cell activation, observe the growth status of T cells. If T cells grow in large clusters, the growth status is good and viral vector transduction of T cells can be performed. Take out the Non-treated 12-well plate incubated with Retronetin, and recover the Retronetin supernatant of the 12-well plate. Add 2% BSA for neutralization for 30min. Add 1×PBS solution for washing and remove the PBS solution. Add 1mL of retroviral vector supernatant (Syn-CAR167, Syn-CAR168, Syn-CAR169, Syn-CAR170) to each well and centrifuge at 2500rpm for 60min at 32℃. To treat T cells, take 5×106 cells / well, add 1mL of retroviral vector supernatant and mix well, centrifuge at 2500rpm for 60min, 32℃. After centrifugation, return to the cell culture incubator for incubation for at least 1h. After incubation, add retroviral vector supernatant again and centrifuge for 1h for transduction. After centrifugation, return to the incubator for incubation for at least 1h. After incubation, centrifuge each well of cells and replace with 1mL of fresh AIM-V complete medium for culture, add IL-2, 1μL / well. Return to the incubator for culture. If the viral vector titer is low, transduction can be continued on the second day, using the same method as the first day. 48h after transduction, take an appropriate amount of Pan-T cells as a blank control, and use flow cytometry to detect the transduction efficiency. The positive rate of EGFP detection is the transduction efficiency.

[0056] (V) Cultivation of target cells

[0057] RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were revived from liquid nitrogen tanks. RPMI-CD19, K562-hBCMA, and RPMI cells were sterile cultured in a 37°C, 5% CO2 cell culture incubator using RPMI complete culture medium, and subcultured once every 48 hours with RPMI complete culture medium to a cell density of 5×105 / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment. HepG2 cells were sterile cultured in a 37°C, 5% CO2 cell culture incubator using MEM complete culture medium, and subcultured once every 48 hours with MEM complete culture medium to a cell density of 5×105 / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment.

[0058] (VI) Co-culture of Syn-CAR-T cells and target cells

[0059] Observe the growth status of target cells and Syn-CAR-T cells. If the cells are in good condition, they can be co-cultured. The co-culture is divided into 5 groups. Syn-CAR167 is co-cultured with RPMI-CD19 and RPMI respectively. Syn-CAR168 is co-cultured with K562-hBCMA. Syn-CAR169 is co-cultured with RPMI. Syn-CAR170 is co-cultured with HepG2. Count the target cells and Syn-CAR-T cells. The co-culture ratio of effector cells to target cells is 1:1. Take 5×10 5 cells in a 1.5 mL centrifuge tube and centrifuge at 300 g for 5 min.

[0060] Carefully remove the supernatant and resuspend in AIM-V complete medium. Mix each group of effector cells with target cells and supplement IL-2. Return to the incubator for culture. After 48 hours of culture, treat the cells for flow cytometry. The flow cytometry was divided into 9 groups, 5 in the co-incubation group and 4 in the non-incubation group.

[0061] 2. Experimental results

[0062] (I) Successful construction of four PSR.SynNotch plasmids targeting different antigens

[0063] In this experiment, the lentiviral dual vector of the original SynNotch system was transformed into a PSR (stable self-inactivating γ-retroviral vector) single vector for transduction, namely PSR.SynNotch. In order to verify the induction efficiency of the PSR.SynNotch system for different antigen targets, four antigen-targeted PSR.SynNotch vectors were designed, namely targeting CD19, BCMA, CD38, and GPC3, respectively. The effector molecule after induction was the reporter gene tagBFP fluorescent protein. Since the downstream effector molecule requires the transcription factor Gal4VP64 to induce expression, it cannot be placed downstream of the promoter, so it is designed to be placed upstream of the internal promoter and the Gal4 induction receptor. The four constructed plasmids PSR.Syn.CD19.BFP, PSR.Syn.BCMA.BFP, PSR.Syn.CD38.BFP, and PSR.Syn.GPC3.BFP were downloaded from the official website of the sequencing company. The sequencing results were analyzed and compared using the biological software SnapGene, and the sequencing results were correct. Therefore, this experiment successfully constructed four vector plasmids PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.Syn.GPC3.BFP (p170).

[0064] (II) Successfully prepared four different targeted Syn-CAR-T cells

[0065] The four successfully constructed plasmids were transiently transfected into Ampho cells, and the viral vectors were harvested 48h and 72h after transfection, namely PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170). Volunteers were recruited to collect venous blood, and PBMCs were isolated and activated and cultured for 48h. The harvested viral vectors were transduced into T cells. The transduction efficiency was detected by flow cytometry 48h after transduction. Since P2A-EGFP was added to the C-terminus of Gal4VP64 as a molecular tag, the positive rate of EGFP detected by flow cytometry can be used as the transduction efficiency of T cells. The flow cytometry results are shown as follows: Figure 3 As shown, the transduction efficiencies of the four Syn-CAR-Ts were 50.0%, 30.36%, 36.36%, and 41.68%, respectively. The transduction efficiency was greater than 30%, proving that the four Syn-CAR-T cells were successfully prepared in this experiment.

[0066] (III) Verification of the induction function of Syn-CAR-T cells with four different targets

[0067] The target cells RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were revived and cultured respectively. Syn-CAR-T cells targeting four different antigens were co-cultured with the corresponding target cells at a 1:1 ratio for 48 hours. There were a total of 5 groups of co-culture, Syn-CAR167 was co-cultured with RPMI-CD19 and RPMI, Syn-CAR168 was co-cultured with K562-hBCMA. Syn-CAR169 was co-cultured with RPMI, and Syn-CAR170 was co-cultured with HepG2. There were 4 groups without incubation, Syn-CAR167, Syn-CAR168, Syn-CAR169, and Syn-CAR170. The flow cytometry results are as follows Figure 4As shown. When the four Syn-CAR-Ts were not co-incubated with tumor cells, the effector molecule tagBFP fluorescent protein had low background leakage expression, and the MFI (mean fluorescence intensity) values ​​of the four Syn-CAR-Ts were 3344, 3228, 4986, and 3257, respectively, which were all higher than the Control group (2567); when the four Syn-CAR-Ts were co-incubated with CD19+, BCMA+, CD38+, and GPC3+ tumor cells, only Syn-CAR167 had the highest induction efficiency (MFI: 17528), and the MFI value was 5.2 times that of the non-incubated (3344). When Syn-CAR167 was co-cultured with RPMI (CD19-), the induction efficiency was extremely low, and the MFI value was the same as that when it was not incubated, proving that Syn-CAR167-T cells can be specifically induced to express, and only when co-incubated with CD19-positive cells can the expression be induced. The MFI values ​​of the induced group of the other three groups of Syn-CAR-T were similar to those of the uninduced group, indicating that the induction efficiency of the targets BCMA, CD38, and GPC3 was extremely low and not suitable for the SynNotch system. In summary, the target CD19 had the highest induction efficiency and was most suitable for the SynNotch system.

[0068] Example 2 Preparation of PSR.Syn.CD19.BCMA CAR-T cells and verification of anti-tumor function

[0069] 1. Construction of PSR.Syn.CD19.BCMA plasmid

[0070] Construct a PSR.SynNotch vector targeting CD19 and BCMA, with CD19 as the induction target and BCMA as the effector target, that is, PSR.Syn.CD19.BCMACAR-T (Syn-CAR190-T) will induce the expression of the effector molecule BCMA-CAR after co-incubation with CD19 antigen-positive tumor cells. If the tumor cells also express BCMA antigens, Syn-CAR190-T will recognize and kill the tumor. The specific process is: plasmid design, PCR amplification of target fragments, double enzyme digestion vector preparation, agarose gel electrophoresis identification and gel recovery, seamless cloning connection transformation plate, monoclonal colony expansion culture, bacterial liquid PCR identification, sample sequencing and analysis of sequencing results, plasmid extraction.

[0071] 1. Plasmid Design

[0072] Since the downstream effector molecules need the transcription factor Gal4VP64 to induce expression, they cannot be placed downstream of the promoter, so they should be designed to be placed upstream of the internal promoter and Gal4 induction receptor. The PSR.Syn.CD19.BCMA plasmid was constructed by inserting the effector receptor UAS anti-BCMA-CAR, SFFV promoter, SP signal peptide, Myc tag, induction receptor anti CD19 scfv-Notch-Gal4VP64, and WPRE element in the middle of the 5'LTR and 3'SIN-LTR. CopGFP P2A Puro, two molecular tags for screening monoclonal cells, were inserted between the 3'SIN-LTR and 3'TIR transposon. FDA-approved antibodies FMC63 CD19 and bb2121 anti-BCMA were used to construct PSR.Syn.CD19.BCMA CART cells. The induction receptor anti CD19 scfv was expressed by the promoter SFFV, and a myc tag was added to the 5' end to detect the transduction efficiency of viral vector transduction target cells. CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells. They are connected with P2A and are expressed by the composite promoter hEF1α-HTLV. The total length of the gene fragment inserted between the 5'UTR and 3'SIN-LTR of the vector is 5490bp, which is considered to be an ultra-large packaging capacity, while the conventional packaging size of γ-RV is about 4kb. The larger the designed insertion target fragment, the more difficult it is to package the viral vector, and the viral vector production titer will decrease accordingly. From 5'LTR to 3'SIN-LTR, that is, the total size of the entire self-inactivating retroviral vector is 6601bp, which does not exceed the 8kb of the wild-type γ-RV genome, and the viral vector packaging experiment can be carried out normally. The plasmid design pattern is shown in the figure Figure 5 shown.

[0073] 2. PCR amplification of target fragment and double restriction digestion of vector

[0074] The construction of PSR.Syn.CD19.BCMA plasmid includes 2 PCR amplification fragments, 1 double enzyme digestion vector fragment, and 3 fragments seamlessly cloned and recombined. Fragment 1 is a UAS fragment, and the template plasmid comes from the commercial plasmid p154; fragment 2 is anti-BCMA-CAR, and the template plasmid comes from the commercial plasmid p154. The primers of the two PCR fragments need to add homology arms. The PCR primer design is shown in Table 2 below, and the designed primers are sent to the company for synthesis. The vector plasmid comes from the commercial p184, and the restriction endonucleases are BglII and Mlul.

[0075] Table 2 Plasmid PSR.Syn.CD19.BCMA amplification primer design

[0076]

[0077] Note: The underlined part is the homology arm

[0078] Among them, the sequence number of S-190-1F is SEQ ID NO.12, the sequence number of S-190-1R is SEQ ID NO.13, the sequence number of S-190-2F is SEQ ID NO.14, and the sequence number of S-190-2R is SEQ ID NO.15.

[0079] 3. Seamless cloning, transformation, sequencing, and plasmid extraction

[0080] The PCR products and enzyme digestion products were identified by agarose gel electrophoresis and recovered. A total of 3 DNA fragments were added to the vector fragment, and the recombinant was incubated at 50°C and connected for 25 minutes. The ligation product was transformed into competent cells, plated, and 1 to 5 single colonies were picked and expanded in LB-Amp+ liquid culture medium for 8h to 12h, and the bacterial liquid PCR identification can be performed. After identification, several correct clones were selected for sample sequencing. After the sequencing analysis and alignment are correct, a clone was selected for expansion culture, and the plasmid was extracted using an endotoxin-free small extraction medium kit. Transform competent cells, identify bacterial liquid PCR, and sequence analysis and alignment.

[0081] 4. Experimental Results

[0082] 4.1. Gel electrophoresis results of target fragments

[0083] The construction of PSR.Syn.CD19.BCMA plasmid (Syn-CAR190) consists of 2 PCR amplified fragments and 1 double-enzyme digested vector fragment. The theoretical sizes of fragment 1, fragment 2, and fragment 3 (vector fragment) are 770bp, 2036bp, and 9750bp, respectively. The gel electrophoresis results are as follows: Figure 6 As shown, the band sizes of fragment 1, fragment 2, and fragment 3 are consistent with the theoretical sizes, and the preliminary identification of the PCR amplification products is correct.

[0084] 4.2. Analysis of sequencing results

[0085] The construction of PSR.Syn.CD19.BCMA plasmid (Syn-CAR190) consists of 2 PCR amplification fragments and 1 double-enzyme digestion vector fragment. After the gel recovery fragments were correctly identified, seamless cloning and connection were performed, competent cells were transformed, plates were plated for overnight culture, monoclonal colonies were picked for expansion culture, and after the bacterial solution PCR was correctly identified, the bacterial solution of the correct colony clone was picked for company sequencing. The sequencing results were downloaded from the official website of the sequencing company, and the sequencing results were analyzed and compared using the biological software SnapGene. The base sequence sequencing of the joint site of the three fragments was completely correct, the sequencing was basically successful, and the sequencing results were correct. Therefore, the new vector PSR.Syn.CD19.BCMA plasmid was successfully constructed and named Syn-CAR190.

[0086] 2. Construction of PSR.Syn.CD19.BCMA virus vector stably transfected cell line

[0087] Construct a packaging cell line stably transfected with the vector PSR.Syn.CD19.BCMA (Syn-CAR190). Since the gene loaded by the vector Syn-CAR190 is too large, the total inserted fragment is 5490bp, and the size from 5'LTR to 3'SIN-LTR is 6601bp, so the virus packaging capacity will be greatly reduced. In order to obtain a packaging cell line with stable toxin production and high titer, it is necessary to screen the successfully constructed stable transfected cell line for monoclonal cells. The screening markers are 3, CopGFP fluorescent protein, puromycin drug screening, and Myc tag upstream of the anti-CD19 scfv fragment. The specific process is: resuscitation of Ampho cells, transfection of cells, puromycin drug screening to obtain stable transfected cell lines, flow cytometry detection, monoclonal cell plating, fluorescence microscopy observation, and screening of monoclonal cells.

[0088] 1. Methods

[0089] When the cell density of Ampho cells reaches 80% to 90%, cells are plated, with 1×10 cells per well of a six-well plate. 6cells, volume 2mL. After 24h of plating culture, cell transfection can be performed when the cell density reaches 80% to 90%. Transfection complex is prepared, transfection plasmid PSR.Syn.CD19.BCMA (Syn-CAR190) and PB transposase are transfected, the transfection ratio is 1:1, and the total amount of transfection plasmid per well is 3.3μg. 24h after transfection, the cell medium is changed to DMEM complete medium. 72h after transfection, cell passage is performed, and a part of the cells are taken for flow cytometry detection. The staining antibody is AF647 antic-Myc (Biolegend), and the staining is incubated at 4℃ in the dark for 60min. The remaining cells are used for subculture, and puromycin is added for drug screening, with a final concentration of 4μg / mL, and returned to the incubator for continued culture. When the cell density reaches 80%, subculture is performed, and culture is added with medium containing puromycin, and drug screening is performed for a long time until the cell line is stable and highly expresses Myc and CopGFP. After obtaining a stably transfected cell line, plate the cells in a 96-well plate, and plate 3 96-well plates with a cell density of 1 cell per well. After 7 days of culture, observe under a microscope to select a single group of cells as monoclonal cells, mark them, and change the cell medium after selection. On the second day, observe the cells under a fluorescence microscope, select the monoclonal cell wells with bright and uniform green fluorescence, and mark them as Chuyang cells. When the density of Chuyang cells reaches more than 50%, they can be subcultured to a 24-well plate. When the density of Chuyang cells in the 24-well plate reaches 80% to 90%, subculture can be performed, and a portion of the cells are taken for flow cytometry (1 round of flow cytometry), and the positive rate of cells expressing Myc and CopGFP is detected by flow cytometry, and the remaining cells are subcultured to a 6-well plate. Screen out Chuyang cells with a positive rate of cells expressing Myc and CopGFP greater than 70% by flow cytometry. A total of 3 consecutive passages were performed to screen out the first positive cells with a positive rate of more than 70% in the expression of Myc and CopGFP in 2 rounds of flow cytometry, and then passaged to T75 cell culture flasks for expansion. When the cell density of the T75 flask reached more than 90%, it was placed in a 32°C, 5.0% CO2 incubator for culture. Low temperature culture is conducive to increasing the titer of viral vectors in the cell supernatant. After 24 hours of culture at 32°C, the cell supernatant was collected as the viral vector supernatant and replaced with fresh DMEM complete medium. Cultured continuously at 32°C for 5 days, and the cell supernatant was collected every 24 hours as the viral vector supernatant (A190-H1 to A190-H5).

[0090] 2. Experimental results

[0091] 2.1. Construction of the PSR.Syn.CD19.BCMA (Syn-CAR190) stably transfected packaging cell line

[0092] The constructed plasmid Syn-CAR190 and transposase plasmid were co-transfected into Ampho cells. Since the plasmid carries the puromycin resistance gene, in order to obtain a stable transfection packaging cell line, puromycin screening is required for a long time. Plasmid Syn-CAR190 carries the CopGFP fluorescent protein gene and adds the Myc tag upstream of the anti-CD19 scfv, so the flow cytometry transfection efficiency after transfection has two tags, CopGFP and Myc. 48h (day 2) and day 10 after transfection, the positive rates of Ampho cells expressing CopGFP were 81.98% and 94.8%, respectively; 48h (day 2) and day 10 after transfection, the positive rates of Ampho cells expressing Myc were 53.65% and 64.9%, respectively. The experimental results showed that the positive rate of Ampho cells expressing CopGFP reached 94% on day 10 after transfection, proving that the Ampho packaging cell line (A190) stably transfected with the vector Syn-CAR190 has been successfully prepared in this experiment. However, at 48h (day 2) and day 10, the positive rate of Ampho cells expressing Myc tags (53.65%, 64.9%) was much lower than the positive rate of CopGFP (81.98%, 94.8%), which may be related to the expression efficiency of different promoters and the location of the vector integration into the host genome.

[0093] 2.2. Screening of monoclonal cells stably transfected with the vector PSR.Syn.CD19.BCMA (Syn-CAR190)

[0094] In order to obtain a stable transfected cell line that produces high-titer viral vectors, this experiment will perform monoclonal cell screening. The Syn-CAR190-Ampho stable transfected cell line was inoculated into three 96-well plates, with 1 cell in each well. Fifteen wells with bright and uniform green fluorescence were initially screened by fluorescence microscopy. When the cell density in a single well reaches more than 50%, it is subcultured to a 24-well plate and a 6-well plate. When the 6-well plate is subcultured, a portion of the cells are taken for flow cytometry detection to detect the positive rate of Syn-CAR190-Ampho cells expressing CopGFP and Myc, and monoclonal cells with a positive rate greater than 70% need to be screened. In this experiment, a monoclonal cell A190-5 was finally screened from the 15 monoclonal cells with bright and uniform green fluorescence in the initial screening, and the positive rates of CopGFP and Myc were both greater than 70%, with positive rates of 99.96% and 83.3%, respectively. After successfully screening out monoclonal cells, the monoclonal cell A190-5 was subcultured to a T75 flask for expansion culture. When the density reached more than 90%, the medium was changed and the cells were placed in a 32°C incubator for low-temperature culture for 5 days. The cell supernatant, i.e., the viral vector supernatant (A190-H1 to A190-H5), was harvested every 24 hours.

[0095] 3. Preparation and induction function verification of PSR.Syn.CD19.BCMA CAR-T cells

[0096] PSR.Syn.CD19.BCMA CAR-T cells (Syn-CAR190-T) targeting CD19 and BCMA were prepared, with CD19 as the induction target and BCMA as the effector target. Syn-CAR190-T cells can only have a specific killing function on tumor cells that express both CD19 and BCMA antigens. In order to verify the induction expression efficiency of Syn-CAR190-T cells, Syn-CAR190-T cells were co-cultured with tumor cells expressing different antigens (CD19 antigen, BCMA antigen), and the positive rate of anti-BCMAscfv expression in positive T cells expressing anti-CD19scfv was detected by flow cytometry. The experimental process is: the viral vector produced by the harvested monoclonal cell A190-5 is transduced into T cells, and after successful transduction, it is co-cultured with tumor cells, and the induction efficiency of Syn-CAR190-T cells is detected by flow cytometry.

[0097] 1. Preparation of Syn-CAR190-T cells

[0098] Healthy volunteers were recruited to collect peripheral venous blood, human PBMCs were isolated, and OK-T3 and IL-2 were added for activation and culture. 48 hours after PBMC activation and culture, the virus vector (A190-H3) produced by monoclonal cell A190-5 was added to transduce T cells. 72 hours after transduction, the transduction efficiency of T cells was detected by flow cytometry, and the staining antibody was AF647 anti-c-Myc (Biolegend).

[0099] 2. Co-incubation of Syn-CAR190-T cells with tumor cells

[0100] Tumor cells expressing different antigens were revived, RPMI-CD19, RPMI, Raji-LU, Raji-BCMA, K562-BCMA, and K562-CD19-BCMA. The successfully prepared Syn-CAR190-T cells were co-incubated with tumor cells for 48 hours. After the co-incubation, the co-incubated cells were taken for flow cytometry. The staining antibodies were AF647 anti-c-Myc (Biolegend) and FITC-BCMA FC. After the staining was completed, the cells were resuspended in staining buffer to terminate the staining, the supernatant was removed by centrifugation, the cells were resuspended in staining buffer, and the flow cytometry was performed.

[0101] 3. Experimental results

[0102] 3.1 Preparation of Syn-CAR190-T cells

[0103] The virus vector (A190-H3) produced by the prepared monoclonal cell A190-5 was transduced into T cells, and the transduction efficiency was detected by flow cytometry 72 hours after transduction. The transduction efficiency of Syn-CAR190-T was 47.21%. The results of the study showed that Syn-CAR190-T cells were successfully prepared in this experiment, which can be used to subsequently verify the induction efficiency of Syn-CAR190-T cells for tumor cells expressing different antigens.

[0104] 3.2 Induction efficiency of Syn-CAR190-T cells on different tumor cells

[0105] The successfully prepared Syn-CAR190-T cells were co-cultured with K562-BCMA cells (CD19 antigen negative, BCMA antigen positive), K562-CD19-BCMA cells (CD19 positive, BCMA positive), RPMI cells (CD19 negative, CD38 positive, BCMA positive), RPMI-CD19 cells (CD19 positive, BCMA positive), Raji-Lu (CD19 positive, BCMA antigen negative), Raji-BCMA (CD19 antigen positive, BCMA antigen positive) for 48 hours. After the co-incubation, flow cytometry was performed, and the flow staining antibodies were AF647 anti-c-Myc and FITCCD38Fc. The flow cytometry results were analyzed using Flowjo software, and the positive rate of T cells induced to express CD38 Fc-FITC was analyzed in the Myc-APC positive T cell population. The induction efficiency of Syn-CAR190-T cells co-incubated with single positive tumor cells K562-BCMA (CD19-BCMA+) and RPMI (CD19-BCMA+) was 9.71% and 8.58% respectively; the induction efficiency of co-incubated with double positive tumor cells K562-CD19-BCMA (CD19+BCMA+), RPMI-CD19 (CD19+BCMA+), Raji-Lu (CD19+BCMA-), Raji-BCMA (CD19+BCMA+) was 75.6%, 90.5%, 91.7%, 89.1% respectively; the positive rate was 7.48% when not incubated with tumors. The experimental results showed that the induction efficiency of Syn-CAR190-T cells after co-incubation with a variety of CD19 antigen positive tumor cells was greater than 75%, and the induction efficiency was lower after co-incubation with CD19 antigen negative tumor cells, and the background expression without incubation with tumors was less than 10%. It is proved that Syn-CAR190-T cells have strong specific induction expression function and low background expression, which can be used for further research on the specific killing effect of Syn-CAR190-T cells on tumor cells.

[0106] 4. Validation of the anti-tumor function of PSR.Syn.CD19.BCMA CAR-T cells

[0107] The successfully prepared PSR.Syn.CD19.BCMACAR-T (Syn-CAR190-T) cells were co-cultured with tumor cells expressing different antigens (CD1, BCMA) to study the anti-tumor function of Syn-CAR190-T cells. The luciferase method was used to study the killing effect of Syn-CAR190-T cells on tumor cells, the real-time dynamic live cell imaging monitoring system Incucyte was used to study the persistent killing effect of Syn-CAR190-T cells on tumor cells, the CFSE (live cell fluorescent dye) flow cytometry was used to detect the proliferation effect of Syn-CAR190-T cells, and the CBA (multi-cytokine detection) flow cytometry was used to detect the differences in the cytokine secretion levels of Syn-CAR190-T cells.

[0108] 1. Cell recovery and culture, recovery of tumor cells, RPMI-CD19, RPMI, Raji-Lu, Raji-BCMA, K562-BCMA, K562-CD19-BCMA, are all suspension cells, and the culture medium is RPMI complete culture medium. The subculture ratio is 1 to 4 to 1 to 3, and the subculture is performed every 2 days. Syn-CAR190-T cells and CAR10-T cells were prepared. CAR10-T cells were obtained by transducing T cells with the supernatant of the retroviral vector anti BCMA-CAR (CAR10). PAN-T cells, Syn-CAR190-T cells and CAR10-T cells were subcultured every 2 days.

[0109] 2. Luciferase assay to detect the killing efficiency of Syn-CAR190-T cells on tumor cells

[0110] PAN-T cells, Syn-CAR190-T cells, CAR10-T cells and tumor cells were observed under a microscope. Cells could be plated when the cells were in good growth condition. There were 6 types of target cells, RPMI-CD19, RPMI, Raji-Lu, Raji-BCMA, K562-BCMA, and K562-CD19-BCMA. The experiment was divided into 3 groups, PAN-T group, Syn-CAR190-T group, and CAR10-T group. There were 5 ratios of co-incubation culture, and the effector-target ratios were 2:1, 1:1, 1:2, 1:4, and 1:8, respectively.

[0111] 3. Incucyte detects the persistent killing effect of Syn-CAR190-T cells on tumor cells

[0112] The experiment was divided into 3 groups, PAN-T group, Syn-CAR190-T group, and CAR10-T group. Syn-CAR190-T cells were co-incubated with tumor cells, and the Incucyte real-time live cell imaging system was used to detect the persistent killing effect of Syn-CAR190-T cells on tumor cells. There were 5 ratios of co-incubation culture, with effector-target ratios of 2:1, 1:1, 1:2, 1:4, and 1:8, respectively. There were 4 types of target cells, namely RPMI-CD19 cells, K562-CD19-hBCMA cells, Raji-BCMA cells, and RPMI cells.

[0113] 4. CBA detection of cytokine secretion by Syn-CAR190-T cells against tumor cells

[0114] Syn-CAR190-T cells were co-cultured with tumor cells RPMI and SW620 cells. The experiment was divided into 3 groups, PAN-T group, Syn-CAR190-T group, and CAR10-T group, with an effector-target ratio of 1:1. The supernatant of the co-cultured cells was collected, and the content of cytokines in the supernatant was quantitatively detected by CBA method. The CBA kit used in this experiment was Human CD8 / NK Panel (13-plex), Biolegend.

[0115] 5. Experimental Results

[0116] 5.1. Luciferase assay to detect the killing efficiency of Syn-CAR190-T cells on tumor cells

[0117] After the successfully prepared Syn-CAR190-T cells were co-cultured with tumor cells for 8h to 15h, luciferase detection reagent was added for cleavage reaction and then detected using the chemiluminescence mode of a multifunctional microplate reader. There are 6 types of target cells, K562-CD19-hBCMA, K562-hBCMA, RPMI-CD19, RPMI, Raji-BCMA, K562-CD19-CD38. There are 5 effector-target ratios, namely 2:1, 1:1, 1:2, 1:4, and 1:8. Some co-culture groups have only 4 effector-target ratios. The experiment was divided into 3 groups, PAN-T group, Syn-CAR190-T group, and CAR10-T group. The PAN-T group was a co-culture of non-transduced T cells and tumor cells (negative control group), the Syn-CAR190-T group was a co-culture of T cells transduced with the viral vector PSR.Syn.CD19.BCMA and tumor cells (experimental group), and the CAR10-T group was a co-culture of T cells transduced with the viral vector BCMA-CAR (CAR10) and tumor cells (positive control group). The results of the microplate reader were analyzed, the killing efficiency of the effector cells was calculated according to the formula, and the Graphpad Prim 9.5 software was used for statistical analysis. The experimental results are shown in Figure 2. Figure 7 shown. Figure 7 A is the killing efficiency test result after T cells were co-incubated with K562-CD19-hBCMA tumor cells for 12 hours at 4 effector-target ratios. K562-CD19-BCMA tumor cells express CD19 and BCMA antigens and are double-positive tumor cells. In theory, both the experimental group T cells and the positive control group T cells co-incubated with double-positive tumor cells have specific tumor killing function. Figure 7 A Experimental results showed that at effector-target ratios of 2:1, 1:1, and 1:2, Syn-CAR190-T cells and CAR10-T cells had high killing efficiencies against K562-CD19-hBCMA tumor cells, and were significantly higher than the negative control PAN-T group, with statistically significant differences. Figure 7 B is the killing efficiency test result after T cells were co-incubated with K562-hBCMA tumor cells for 15 hours. K562-hBCMA tumor cells do not express CD19 antigen, but express BCMA antigen, and are single-positive tumor cells. In theory, the Syn-CAR190-T group co-incubated with K562-hBCMA tumor cells cannot induce the expression of anti-BCMA-CAR and cannot activate the specific killing function, while the positive control group CAR10-T cells can specifically kill tumor cells expressing CD38 antigen. Figure 7B Experimental results showed that the killing efficiency of CAR10-T cells in the positive control group against K562-hBCM tumor cells was significantly higher than that in the Syn-CAR190-T group and PAN-T group. The killing efficiency of the Syn-CAR190-T group and PAN-T group against K562-hBCM tumor cells was lower, which was consistent with the theoretical results. Figure 7 F is the killing efficiency test result after T cells were co-incubated with K562-CD19-CD38 tumor cells for 12 hours. K562-CD19-CD38 tumor cells express CD19 antigen but not BCMA antigen. Theoretically, Syn-CAR190-T cells can induce the expression of anti-BCMA-CAR after co-incubation with K562-CD19-CD38 tumor cells, but tumor cells do not express BCMA antigen and cannot activate specific killing function. Similarly, CAR10-T cells cannot theoretically activate specific killing function after co-incubation with K562-CD19-CD38 tumor cells. Figure 7 The experimental results of F showed that the killing efficiency of the three groups of T cells on K562-CD19-CD38 tumor cells was low, with no statistical difference, which was consistent with the theoretical results. Figure 7 C is the killing efficiency test result after T cells were co-incubated with RPMI-CD19 tumor cells for 12 hours. RPMI-CD19 tumor cells express CD19 and BCMA antigens and are double-positive tumor cells. Figure 7 C Experimental results showed that at four different effector-target ratios, the killing efficiency of Syn-CAR190-T group and CAR10-T group on RPMI-CD19 tumor cells was significantly higher than that of the negative control group. When the effector-target ratio was 2:1, the killing efficiency of Syn-CAR190-T group and CAR21-T group was greater than 90%. Figure 7 D is the killing efficiency test result after T cells and RPMI tumor cells were co-incubated for 6 hours. RPMI tumor cells do not express CD19 antigen, but express BCMA antigen, and are single-positive tumor cells. Theoretically, Syn-CAR190-T cells have no specific killing function on RPMI cells, while CAR10-T cells can specifically kill RPMI cells. Figure 7 D Experimental results showed that at four different effector-target ratios, the killing efficiency of CAR10-T cells against RPMI tumor cells was significantly higher than that of the Syn-CAR190-T group and PAN-T group. Figure 7 E is the killing efficiency test result after T cells were co-incubated with Raji-BCMA tumor cells for 12 hours. Raji-BCMA tumor cells express CD19 and BCMA antigens and are double-positive tumor cells. Figure 7E Experimental results showed that under 5 different effector-target ratios, Syn-CAR190-T cells and CAR10-T cells had a high killing efficiency against Raji-BCMA tumor cells, and both were significantly higher than the negative control group PAN-T group, with statistical differences.

[0118] In summary, Syn-CAR190-T cells have a specific killing function against double-positive tumor cells (expressing both CD19 and BCMA antigens), but have no specific killing effect on single-positive tumor cells (expressing only CD19 or BCMA antigens). This proves that Syn-CAR190-T cells can efficiently and specifically kill tumor cells and have a safety switch to activate the killing function.

[0119] 5.2. Incucyte detection of the persistent killing effect of Syn-CAR190-T cells on tumor cells

[0120] The successfully prepared Syn-CAR190-T cells were co-cultured with tumor cells, and the Incucyte real-time live cell imaging system was used to detect the persistent killing effect of T cells. The experiment was divided into 3 groups, PAN-T group, Syn-CAR190-T group, and CAR10-T group. There were 4 types of target cells, namely RPMI-CD19, K562-CD19-hBCMA, Raji-BCMA, and RPMI. The experimental results are shown in the figure. Figure 8 The horizontal axis represents the co-incubation time, and the vertical axis represents the average fluorescence intensity of tumor cells. If the vertical axis value is lower at a certain time, it means that the T cell killing effect is stronger. Figure 8 A is the killing test result of the three groups of T cells co-incubated with RPMI-CD19 tumor cells for 72 hours, with an effector-target ratio of 1:8. The experimental results showed that the killing effect of Syn-CAR190-T cells on RPMI-CD19 tumor cells was always higher than that of the PAN-T group after 72 hours of co-incubation monitoring, and the killing effect of CAR10-T cells in the positive control group on RPMI-CD19 tumor cells was the strongest. Figure 8 B is the killing test results of the three groups of T cells co-incubated with K562-CD19-hBCMA cells for 72 hours, with an effector-target ratio of 1: 2. The experimental results showed that during the 72-hour co-incubation monitoring process, the average fluorescence intensity of the PAN-T group gradually increased and finally exceeded the starting value, while the average fluorescence intensity of the Syn-CAR190-T group and the positive control group CAR10-T group gradually weakened, proving that the Syn-CAR190-T group and the positive control group CAR10-T group had a persistent specific killing effect on K562-CD19-hBCMA cells. Figure 8C is the killing test result of 72h co-incubation with Raji-BCMA cells, with an effector-target ratio of 1:1. The experimental results show that during the 72h co-incubation monitoring process, the average fluorescence intensity of the PAN-T group gradually increased, and finally far exceeded the starting value, while the average fluorescence intensity of the Syn-CAR190-T group and the CAR10-T group gradually weakened. It proves that the Syn-CAR190-T group and the positive control group CAR10-T group have a persistent specific killing effect on Raji-BCMA cells. Figure 8 D is the killing test result of 72h co-incubation with RPMI cells, with an effect-target ratio of 1:2. The experimental results show that during the 72h co-incubation monitoring process, the average fluorescence intensity of the three groups gradually weakened, but there was no significant difference in the average fluorescence intensity between the Syn-CAR190-T group and the PAN-T group, and in the later stage, the average fluorescence intensity of the Syn-CAR190-T group was slightly higher than that of the PAN-T group. It proves that the Syn-CAR190-T group has no specific killing effect on RPMI cells. In summary, the results of the Incucyte detection experiment show that Syn-CAR190-T cells have a persistent killing effect on RPMI-CD19 cells, K562-CD19-hBCMA cells, and Raji-BCMA cells.

[0121] 5.3.CBA detection of cytokine secretion by Syn-CAR190-T cells against tumor cells

[0122] The CBA method was used to quantitatively detect the cytokine content in the culture supernatant after Syn-CAR190-T cells were incubated with tumor cells, thereby analyzing the anti-tumor cell ability of Syn-CAR190-T cells. The experiment was divided into 3 groups, PANT group, Syn-CAR190-T group, and CAR10-T group. In the experiment, the three groups of T cells were co-incubated with tumor cells RPMI-CD19 for 12 hours and the supernatant was collected for detection. The co-incubation culture effect-target ratio was 1:1. The levels of IFN-γ, TNF-α, and cytokine IL-10 secreted by the Syn-CAR190-T group and the CAR10-T group were significantly higher than those of the PAN-T group, with statistical differences. The experimental results further showed that Syn-CAR190-T cells have strong anti-tumor function, and the induced recognition and re-killing mode can exert effective anti-tumor function.

[0123] 5.4. CFSE detection of Syn-CAR190-T cell proliferation ability

[0124] The proliferation ability of T cells was detected by CFSE method, and the cells were divided into 3 groups: PAN-T group, Syn-CAR190-T group, and CAR10-T group. After CFSE staining, the 3 groups of T cells were divided into 3 groups: unincubated group, co-incubated group with K562-CD19-hBCMA cells, and co-incubated group with K562-hBCMA cells. The CFSE expression efficiency was detected by flow cytometry after 48 hours of culture. After CFSE staining, the proliferation efficiency of the 3 groups of T cells was high after 48 hours of culture without incubation, and there was no significant difference between the 3 groups of T cells, which proved that the proliferation of Syn-CAR190-T cells was not affected after transduction of viral vectors; after 48 hours of co-incubation with the two cells, the proliferation efficiency of Syn-CAR190-T was higher than that of PAN-T cells and CAR10-T cells, which proved that the cell proliferation rate of Syn-CAR190-T under tumor cell stimulation was higher than that of PAN-T cells and CAR10-T cells.

[0125] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A method for preparing PSR.Syn.CD19.BCMA CAR-T cells, characterized in that: The PSR.Syn.CD19.BCMA CAR-T cells refer to the CAR-T cells that will induce the expression of effector molecules BCMA-CAR after co-incubation with CD19 antigen-positive tumor cells. If the tumor cells also express BCMA antigens, they will recognize the CAR-T cells that kill the tumor; the method includes: Step 1: Use the PiggyBac transposon system to construct a stable transfection SIN-γ-RV vector, namely the PSR vector; Step 2: Use the PSR vector prepared in step 1 to express the SynNotch system, merge the GAL4 induction vector and the UAS effector vector of the SynNotch system into one PSR vector, so that the SynNotch system is delivered by one PSR vector; construct a plasmid of a PSR.Syn.CD19.BCMA retroviral vector, i.e., a PSR.SynNotch vector targeting CD19 and BCMA, with CD19 as an induction target and BCMA as a plasmid vector of an effector target; Step 3: transduce the plasmid of the above retroviral vector into T cells to prepare the PSR.Syn.CD19.BCMACAR-T cells; In step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for a viral vector packaging signal and a SD for a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region; When constructing the PSR.Syn.CD19.BCMA plasmid, the effector receptor UAS anti-BCMA-CAR, SFFV promoter, SP signal peptide, Myc tag, inducible receptor anti CD19 scfv-Notch-Gal4VP64, and WPRE element were inserted between the 5'LTR and 3'SIN-LTR, respectively. The inducible receptor is expressed by the SFFV promoter, and the effector receptor is upstream of the SFFV promoter and the inducible receptor.

2. The method according to claim 1, characterized in that The 5'UTR deleted all Gag and Pol coding sequences and the start codon ATG.

3. The method according to claim 1, characterized in that When constructing the plasmid of the PSR.Syn.CD19.BCMA retroviral vector, two molecular tags CopGFPP2A Puro for screening monoclonal cells were inserted between the 3'SIN-LTR and 3'TIR transposon, that is, CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, connected by P2A.

4. The method according to claim 3, characterized in that The molecular tag is expressed by the composite promoter hEF1α-HTLV.

5. PSR.Syn.CD19.BCMA CAR-T cells constructed according to any one of claims 1-4.

6. Use of the PSR.Syn.CD19.BCMA CAR-T cells described in claim 5 in the preparation of tumor drugs.

7. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition contains the CAR-T cells according to claim 5, and a pharmaceutically acceptable carrier, diluent or excipient.

8. A method for inhibiting tumor cells in vitro, characterized in that: The method comprises contacting a tumor cell with the CAR-T cell according to claim 5 or the pharmaceutical composition according to claim 7, thereby inhibiting the tumor cell.

Images