Gene for guiding / evaluating tacrolimus and pronotegravir / ritonavir or nemategravir / ritonavir combined sequential medication and application thereof

Abstract

The invention discloses a gene for guiding / evaluating tacrolimus and pronotegravir / ritonavir or nemategravir / ritonavir combined sequential medication and application thereof, the gene is a human ABCA13 gene, the nucleotide sequence of the gene is as shown in SEQ ID NO: 1, the 220 site of the ABCA13 gene is a polymorphic site, and the polymorphic basic group is A / G. The invention also discloses a method for guiding / evaluating tacrolimus and pronotegravir / ritonavir or nemategravir / ritonavir combined sequential medication. The method has the capability of identifying the metabolism speed of tacrolimus when prenotegravir / ritonavir or nemategravir / ritonavir is applied, and can effectively help to judge the starting opportunity of prenotegravir / ritonavir or nemategravir / ritonavir, the concentration monitoring frequency of tacrolimus and the treatment opportunity of restarting tacrolimus in a tacrolimus medication patient.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to genes for guiding / evaluating the sequential combined use of tacrolimus and senoteivir / ritonavir or namateivir / ritonavir and applications thereof. Background Art

[0002] The severe acute respiratory syndrome coronavirus 2 (SARS-COVID-2) pandemic has had a significant impact on healthcare systems worldwide. Lung transplant recipients are at higher risk of hospitalization and death from SARS-COVID-2 compared to immunocompetent populations and other solid organ transplant recipients. The mortality rate of SARS-COVID-2 in lung transplant recipients has been reported to range from 14% to 46%. In addition, with the spread of the Omicron variant, treatment options are limited.

[0003] Namatevir / ritonavir is an oral antiviral drug that targets key enzymes in the replication of the SARS-COVID-2 virus. It is a combination of the 3CL protease inhibitor Namatevir and its enhancer Ritonavir. Namatevir / ritonavir is one of the first-line treatment options for patients with mild to moderate COVID-19, reducing the risk of the disease deteriorating to severe illness. On February 12, 2022, the state approved the drug for emergency treatment of COVID-19. Senotegravir / ritonavir is an antiviral drug independently developed in my country. Its mechanism of action is similar to that of Namatevir / ritonavir. It exerts its antiviral effect by combining the 3CL protease inhibitor Senotegravir with the enhancer Ritonavir. Ritonavir has a strong inhibitory effect on cytochrome P450 (CYP) 3A and P-glycoprotein, and improves the efficacy by inhibiting the metabolic clearance of the antiviral active ingredients Namatevir or Senotegravir. Therefore, there are significant, deleterious interactions between namatevir / ritonavir and sennotevir / ritonavir and tacrolimus, a commonly used immunosuppressant after transplantation. Several studies have made recommendations for drug interaction management in solid organ transplant recipients, but to date, few studies have described the use of sennotevir / ritonavir and namatevir / ritonavir in Chinese lung transplant recipients infected with SARS-COVID-2. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0005] The present invention relates to a polymorphic site combination and a kit for predicting the metabolic capacity of tacrolimus when tacrolimus and senotevir / ritonavir or namatevir / ritonavir are used in combination sequentially.

[0006] Another object of the present invention is to provide genes and their use for guiding / evaluating the sequential combined use of tacrolimus and senotevir / ritonavir or namatevir / ritonavir.

[0007] In order to achieve these purposes and other advantages according to the present invention, the following technical solutions are provided: A gene for guiding / evaluating the sequential combined use of tacrolimus and senotevir / ritonavir or namatevir / ritonavir, wherein the gene is human ABCA13 Gene, whose nucleotide sequence is shown in SEQ ID NO: 1, said ABCA13 The 220th position of the gene is a polymorphic site, and the polymorphic base is A / G.

[0008] A SNP molecular marker for detecting the metabolic ability of tacrolimus when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, wherein the SNP molecular marker is located at position 48625860 of human chromosome 7, and the polymorphic base is A / G.

[0009] Amplification primers for detecting SNP molecular markers of tacrolimus metabolic ability when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, wherein the SNP molecular marker is located at position 48625860 of human chromosome 7, the polymorphic base is A / G, and the amplification primers are a pair of primers shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0010] A kit for predicting the metabolic capacity of tacrolimus when tacrolimus and senotevir / ritonavir or namatevir / ritonavir are used in combination sequentially, the kit comprising the amplification primers.

[0011] The application of the gene or the SNP molecular marker or the amplification primer in predicting / detecting the metabolic capacity of tacrolimus when tacrolimus is used sequentially in combination with sennotevir / ritonavir or namatevir / ritonavir.

[0012] Preferably, in the application, if the individual genotype (referring to the 48625860th base of chromosome 7 may be A or G, i.e., allele) is GG, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir is started 24 hours after tacrolimus is discontinued, and tacrolimus treatment is started 48 hours after cessation of sennotevir / ritonavir or namatevir / ritonavir, and the metabolism of tacrolimus is not affected; if the patient's genotype is GA or AA, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir can be started 48 hours after tacrolimus is discontinued, and tacrolimus treatment must be started after at least 72 hours after cessation of sennotevir / ritonavir or namatevir / ritonavir.

[0013] Preferably, in the above application, the individual is a transplant patient.

[0014] Preferably, in the application, the individual is a lung transplant patient. Preferably, in the application, the detection method is Sanger sequencing, PCR or next generation sequencing.

[0015] Preferably, in the application, the sample to be tested is any one of the individual's blood, urine, saliva, gastric juice, hair or biopsy.

[0016] The present invention has at least the following beneficial effects: The present invention can help patients determine the metabolic capacity of tacrolimus when tacrolimus and senotevir / ritonavir, or namatevir / ritonavir are used sequentially, and provide the timing for restarting tacrolimus treatment, avoid large fluctuations in blood drug concentration, and reach the target blood drug concentration as soon as possible, thereby reducing the risk of rejection reaction and the risk of adverse reactions caused by excessive immune suppression.

[0017] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A graph showing the tacrolimus concentration ratio of SNPs before and after the application of namatevir / ritonavir or senotevir / ritonavir in the present invention.

[0019] Figure 2 The tacrolimus concentration graph of SNPs after applying namatevir / ritonavir or sennotevir / ritonavir in the present invention is shown. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments so that those skilled in the art can implement the invention with reference to the description.

[0021] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0022] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0023] At present, the research on the metabolism of tacrolimus in vivo focuses on the CYP3A5 rs776746 typing, and our study found that the CYP3A5 rs776746 genotyping does not affect the metabolism of tacrolimus when the tacrolimus and ritonavir combination preparations are administered sequentially. The newly reported ABCA13 rs17132491 locus in the present invention can effectively help determine the start time of sennotevir / ritonavir and namatevir / ritonavir in patients taking tacrolimus, the frequency of tacrolimus concentration monitoring, and the time to restart tacrolimus treatment.

[0024] The present invention also discloses a polymorphic site and a kit for guiding / evaluating the combined sequential medication of tacrolimus and senotevir / ritonavir or namatevir / ritonavir.

[0025] A gene for guiding / evaluating the sequential combined use of tacrolimus and senotevir / ritonavir or namatevir / ritonavir, wherein the gene is human ABCA13 Gene, whose nucleotide sequence is shown in SEQ ID NO: 1, said ABCA13 The 220th position of the gene is a polymorphic site, and the polymorphic base is A / G.

[0026] A SNP molecular marker for detecting the metabolic ability of tacrolimus when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, wherein the SNP molecular marker is located at position 48625860 of human chromosome 7, and the polymorphic base is A / G.

[0027] Amplification primers for detecting SNP molecular markers of tacrolimus metabolic ability when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, wherein the SNP molecular marker is located at position 48625860 of human chromosome 7, the polymorphic base is A / G, and the amplification primers are a pair of primers shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0028] A kit for predicting the metabolic capacity of tacrolimus when tacrolimus and senotevir / ritonavir or namatevir / ritonavir are used in combination sequentially, the kit comprising the amplification primers.

[0029] The application of the gene or the SNP molecular marker or the amplification primer in predicting / detecting the metabolic capacity of tacrolimus when tacrolimus is used sequentially in combination with sennotevir / ritonavir or namatevir / ritonavir.

[0030] In one of the schemes of the present invention, preferably, if the individual genotype is GG, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir is started 24 hours after tacrolimus is discontinued, and tacrolimus treatment is started 48 hours after cessation of sennotevir / ritonavir or namatevir / ritonavir, and the metabolism of tacrolimus is not affected; if the patient's genotype is GA or AA, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir can be started 48 hours after tacrolimus is discontinued, and tacrolimus treatment must be started after at least 72 hours after cessation of sennotevir / ritonavir or namatevir / ritonavir.

[0031] In one embodiment of the present invention, preferably, the individual is a transplant patient.

[0032] In one embodiment of the present invention, preferably, the individual is a lung transplant patient. In one embodiment of the present invention, preferably, the detection method is Sanger sequencing, PCR or next generation sequencing.

[0033] In one embodiment of the present invention, the sample to be tested is preferably any one of blood, urine, saliva, gastric juice, hair or biopsy of an individual.

[0034] In order to enable those skilled in the art to better understand the technical solution of the present invention, the following examples are provided for further explanation: The present invention provides a polymorphic site kit for predicting tacrolimus metabolic ability, including the ABCA13rs17132491 site.

[0035] This study adopted a single-center, regression cohort study method, and included all lung transplant patients who received sennotevir / ritonavir or namatevir / ritonavir at the China-Japan Friendship Hospital from November 1, 2022 to May 1, 2023 and met the inclusion and exclusion criteria. The inclusion criteria are as follows: 1) receiving stable tacrolimus medication before antiviral treatment; 2) adding sennotevir / ritonavir or namatevir / ritonavir more than 12 hours after the last dose of tacrolimus, and completing at least 3 days of antiviral treatment; 3) surviving within 30 days after starting antiviral treatment; 4) the baseline tacrolimus and the follow-up trough within 20 days after antiviral treatment can be obtained. The exclusion criteria are as follows: 1) death within 30 days after antiviral treatment; 2) using immunosuppressive regimens other than tacrolimus before antiviral treatment; 3) no genetic polymorphism detection.

[0036] A total of 53 lung transplant patients were included in this study. The basic information of the patients (demographic characteristics and clinical data) was obtained by querying the hospital electronic medical record system, as shown in Table 1. To evaluate the effect of sennotevir / ritonavir or namatevir / ritonavir on tacrolimus metabolism, this study compared the tacrolimus concentration level during the use of sennotevir / ritonavir or namatevir / ritonavir with the baseline level before antiviral treatment. The concentration increase of 130% was defined as the slow metabolizer group, and the concentration increase within 130% was defined as the normal metabolizer group. Figure 1 and Figure 2 shown.

[0037] First, each subject was genetically tested using a custom chip. All samples with a response rate greater than 95% were genotyped using the ASACHIA (Infinium Asian Screening Array-China Health Industry Alliance) chip according to the Illumina Infinium HTS chip standard operating procedure (SOP). All genetic data sets used in this study were assembled based on the human genome Hg19. Finally, one SNP that may be associated with ritonavir-mediated tacrolimus metabolism was screened out, and the frequencies of each genotype and haplotype are shown in Table 2.

[0038] Table 1 Patient baseline information Note: Continuous variables are expressed as median (IQR), and categorical variables are expressed as n (%).

[0039] a Two patients were taking irbesartan, two patients were taking amlodipine, two patients were taking rivaroxaban, and one patient was taking clopidogrel. One patient was taking tamsulosin, one patient was taking rifabutin, one patient was taking zopiclone, and one patient was taking estazolam Table 2 Genotype and allele distribution frequency of rs17132491 locus Gene rs number genotype Number of genotypes Genotype frequency (%) rs17132491 AA 45 84.9 AG 8 15.1 ABCA13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1: 1 aagaagtgac aattattttt tctgatgaga gatatgggct gggccttcta ggatgtggga 61 caagctggca gggtggaagg cagggaagaa gaaagaagct gtgaaccgca ggctcttggg 121 tacagtctga actctcctgt ggctggaggg gtgaggtttg acaaatgctg ccaccatcct 181 tgggtcttgg caaagtggtt ttcagcagtt gcaaataaga aatatttccc attctcctcc 241 ccatctctag ttactttata aaccaaactc tgagtttgca aacattaaca gtggcttctc 301 aatgtcaaag ggatatttct ttccttgtgt taatattgaa aattccctcc agccataaaa 361 atgaacaaaa tcacatcctt tgcagcagca tggatgcagc tggaggcatc atcctaagca 421 aattaacaca ggaacacaaa accaaatacc gtgtgttctc gt Based on the combination of polymorphic sites, corresponding primer sequences are designed. In a specific embodiment, the primer set for evaluating the risk of post-transplantation diabetes in a subject includes: Primer set 1, which is used to detect ABCA13 The gene polymorphism at the rs17132491 site of the gene consists of the nucleotide sequences shown in the sequence numbers SEQ ID NO: 2 and SEQ ID NO: 3; Amplification upstream primer: AACTCTCCTGTGGCTGGAGG (SEQ ID NO: 2); Amplification downstream primer: GCTGCTGCAAAGGATGTGAT (SEQ ID NO: 3); The specific detection method is: obtaining peripheral blood of the individual to be tested to obtain a sample to be tested; and extracting the subject's DNA from the sample to be tested to obtain sample DNA.

[0040] 1. Perform PCR amplification and purification on sample DNA; 1.1 Take the PCR reaction solution, mix it evenly, add the sample DNA to form a reaction system, and perform PCR amplification according to the PCR reaction program to obtain the PCR amplification product. The PCR reaction program is: 94℃ / 4 min; 90-95℃ / 20s, 50-60℃ / 30s, 70-75℃ / 60s, 45 cycles; keep at 72℃ for 5 min; keep at 4℃ until the reaction is completed; 1.2 Purify the PCR amplification product by agarose gel electrophoresis to obtain the purified PCR amplification product; 2. Sequencing of purified PCR products 2.1 Sequencing the purified PCR amplification product PCR amplification reaction to obtain sequencing products, where: The reaction system of sequencing PCR amplification reaction is shown in the following table: Prepare the reaction system: first add water to a 96-well reaction plate, then centrifuge at 1000 rpm to the bottom of the 96-well reaction plate, then add 2 μL of sequencing primers, then centrifuge at 1000 rpm to the bottom of the 96-well reaction plate, then add purified PCR amplification products, then centrifuge at 1000 rpm to the bottom of the 96-well reaction plate, then add 4 μL of diluted BigDye, where the sequencing primers are the upstream primers corresponding to the amplification of each polymorphic site; After adding, put sealing film on the reaction plate, press it tightly, put it into the PCR instrument, and set the reaction parameters as follows: 96℃ 12 s, 50℃ 6s, 60℃ 3min, a total of 24 cycles; keep warm at 10℃; 2.2 Purification of sequencing products: Purification of sequencing products includes the following steps: Remove the 96-well reaction plate, centrifuge it briefly to 1200 rpm, add 1.5 μL of StopSolution to the wells of the centrifuged 96-well reaction plate, and centrifuge it briefly to 1200 rpm; Add 100 μL of 75% isopropanol to the 96-well reaction plate, shake and mix, and keep it at room temperature for about 10 minutes away from light; after balancing, centrifuge at 4000 rpm, 20°C for 30 min; Place the tube upside down on absorbent paper and centrifuge for a short time until the tube reaches 800 rpm, then press the STOP button of the centrifuge. Add 100 μL of 75% isopropanol and mix without shaking; after balancing, centrifuge at 4000 rpm, 20°C for 10 min.

[0041] Invert the tube onto absorbent paper and centrifuge for an instant until the tube reaches 800 rpm. Press the STOP button of the centrifuge and blow with an electric fan for about 10 minutes in a light-proof environment to remove residual isopropanol.

[0042] Add 10 μL of Hi-Di solution to each well of the reaction plate (add 10 μL of Hi-Di solution to the empty wells as well), shake to mix, and then centrifuge briefly at 1000 rpm; 2.3 Place the processed 96-well reaction plate in the plastic rack of the machine, cover it with a rubber pad, check whether the 96 wells are aligned, and sequence it on the machine to obtain the genotype of each polymorphic site carried by the individual to be tested.

[0043] The present invention discloses a polymorphic site rs17132491 for predicting the metabolic capacity of tacrolimus, sennotevir / ritonavir and namatevir / ritonavir. The present invention has the ability to identify the metabolism speed of tacrolimus when sennotevir / ritonavir or namatevir / ritonavir is used, and can effectively help determine the starting time of sennotevir / ritonavir or namatevir / ritonavir, the frequency of tacrolimus concentration monitoring and the time of restarting tacrolimus treatment in patients taking tacrolimus.

[0044] The number of devices and processing scales described here are used to simplify the description of the present invention. Applications, modifications and variations of the present invention will be obvious to those skilled in the art.

[0045] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the embodiments shown and described herein.

Claims

1. A gene for guiding / evaluating the sequential administration of tacrolimus and senotevir / ritonavir or namatevir / ritonavir, characterized in that: The gene is human ABCA13 Gene, whose nucleotide sequence is shown in SEQ ID NO: 1, said ABCA13 The 220th position of the gene is a polymorphic site, and the polymorphic base is A / G.

2. A SNP molecular marker for detecting the metabolic capacity of tacrolimus when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, characterized in that: The SNP molecular marker is located at position 48625860 of human chromosome 7, and the polymorphic base is A / G.

3. Amplification primers for detecting the SNP molecular markers of tacrolimus metabolism ability when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir, characterized in that: The SNP molecular marker is located at position 48625860 of human chromosome 7, the polymorphic base is A / G, and the amplification primers are a pair of primers shown as SEQ ID NO: 2 and SEQ ID NO:

3.

4. A kit for predicting the metabolic capacity of tacrolimus when tacrolimus and senotevir / ritonavir or namatevir / ritonavir are used sequentially, characterized in that: The kit comprises the amplification primers as claimed in claim 2.

5. Use of the gene according to claim 1 or the SNP molecular marker according to claim 2 or the amplification primer according to claim 3 in predicting / detecting the metabolic capacity of tacrolimus when tacrolimus is used sequentially in combination with senotevir / ritonavir or namatevir / ritonavir.

6. The use according to claim 5, characterized in that If the individual genotype is GG, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir should be started 24 hours after tacrolimus discontinuation. After stopping sennotevir / ritonavir or namatevir / ritonavir, tacrolimus treatment should be started 48 hours later. The metabolism of tacrolimus will not be affected. If the patient's genotype is GA or AA, antiviral treatment with sennotevir / ritonavir or namatevir / ritonavir can be started 48 hours after tacrolimus discontinuation. After stopping sennotevir / ritonavir or namatevir / ritonavir, wait at least 72 hours before starting tacrolimus treatment.

7. The use according to claim 5, characterized in that The individual is a transplant patient.

8. The use according to claim 7, characterized in that The individual is a lung transplant patient.

9. The use according to claim 5, characterized in that The detection method is Sanger sequencing, PCR or second-generation sequencing.

10. The use according to claim 5, characterized in that The sample to be tested is any one of blood, urine, saliva, gastric juice, hair or biopsy of the individual.

Images