An MBTD1 gene molecular marker related to the body weight and body size of geese and its application

By detecting the SNP site polymorphism of the MBTD1 gene, the problem of long breeding cycle and high cost of goose weight scales was solved, and the early screening of goose with large weight scales was achieved, and breeding efficiency was improved.

CN119287032BActive Publication Date: 2025-06-24ZHONGKAI UNIV OF AGRI & ENG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411645654.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-18
Publication Date
2025-06-24
Estimated Expiration
2044-11-18

AI Technical Summary

Technical Problem

In the prior art, the breeding of goose weight rulers requires waiting until the goose develops to sexually mature before accurate data can be obtained, resulting in a long breeding cycle, high cost and low breeding efficiency.

Method used

By detecting the polymorphism of the SNP site at the MBTD1 gene at position 6290111 of the goose chromosome 18, the body weight scale traits of the goose were judged early, and geese with large body weight scales were screened for breeding.

Benefits of technology

It has achieved rapid judgment of the traits of goose body weight rulers in the early stage, reducing screening costs and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119287032B_ABST
    Figure CN119287032B_ABST
Patent Text Reader

Abstract

The present invention discloses an MBTD1 gene molecular marker related to the body weight and body size of geese and its application. The molecular marker is located at the 6,290,111th position on chromosome 18 of geese, and the site polymorphism is C or A. This polymorphic site is significantly correlated with the body weight and body size traits of geese, can relatively accurately judge the final changes in the body weight and body size during the future development of geese, can be used for early screening of the body weight and body size traits of geese, greatly reduce the screening cost, accelerate the genetic breeding process, effectively improve the breeding efficiency, and has high economic application value and scientific research value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of goose genetic breeding, and specifically relates to an MBTD1 gene molecular marker related to goose body weight and body size and its application. Background Art

[0002] Geese are one of the edible poultry with the largest breeding scale at present. Body weight and body size are significantly correlated with the growth rate, weight gain and body type characteristics of geese, and are key indicators for evaluating the production performance of geese. Among them, body weight directly affects consumers' consumption choices and the economic interests of enterprises, and is the most important economic trait of geese, which has been widely studied in goose genetic breeding. Body size traits such as chest depth and semi-diving length are also important growth traits of geese, which are significantly correlated with body weight and can reflect the growth potential, maturity and production capacity of geese.

[0003] For the selection and breeding of goose body weight and body size, accurate body weight and body size data can only be obtained after the goslings develop to sexual maturity, and then the individual breeding value is determined based on the obtained data, and then it is decided whether to retain or eliminate the individual. This method has a long breeding cycle, high cost and low breeding efficiency. Summary of the Invention

[0004] The purpose of the present invention is to provide an MBTD1 gene molecular marker related to goose body weight and body size aiming at the above deficiencies in the prior art. By detecting the polymorphism of this molecular marker, the body weight and body size traits of geese can be quickly judged at an early stage, and the breeding efficiency can be improved.

[0005] The technical solution of the present invention is described in detail as follows:

[0006] In the first aspect, the present invention provides an MBTD1 gene molecular marker related to goose body weight and body size. The molecular marker is located at position 6290111 on chromosome 18 of geese, and the site polymorphism is C or A. When the SNP (single nucleotide polymorphism) site is A, the goose has larger body weight and body size traits.

[0007] It should be understood that for the MBTD1 gene molecular marker described in the present invention, when detecting, it can be a genomic fragment of any length containing the SNP site at position 6290111 on chromosome 18 of geese, as long as the primers designed for it as the target gene can amplify this SNP site. Generally, the length of the target gene is between 200 - 700bp.

[0008] Optionally or preferably, the nucleotide sequence of the above MBTD1 gene molecular marker is as shown in SEQ ID NO.1, and the SNP site is located at the 271st position of the nucleotide sequence.

[0009] In a second aspect, the present invention provides the use of the MBTD1 gene molecular marker in goose genetic breeding, which is used to screen or identify geese with large body weight and size. Geese with large body weight and size can be screened in advance as breeding objects in the gosling stage.

[0010] In a third aspect, the present invention provides the above-mentioned reagent for molecular labeling of MBTD1 gene, wherein the reagent comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO. 2-3.

[0011] In a fourth aspect, the present invention provides the use of the above reagent for detecting MBTD1 gene molecular markers in goose genetic breeding, for screening or identifying geese with large body weight and size.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention screens out a SNP molecular marker related to goose weight and body size, which is located at position 6290111 (Chr18:6290111) of chromosome 18 of the goose and is a part of the MBTD1 gene. The present invention also provides a target sequence SEQ ID NO.1 containing the SNP site, which can accurately obtain the polymorphism of the above site by detecting with designed primers, and then can more accurately judge the final changes in the weight and body size of the goose in the future development process according to its polymorphic characteristics, which can be used for early screening of goose weight and body size traits, greatly reducing screening costs and effectively improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The Manhattan plot and QQ plot of the genome-wide association analysis of goose body length in the embodiment;

[0015] Figure 2 The Manhattan plot and QQ plot of the genome-wide association analysis of goose semi-diving in the embodiment;

[0016] Figure 3 The Manhattan plot and QQ plot of the genome-wide association analysis of goose breast depth in the embodiment;

[0017] Figure 4 The electrophoresis result diagram of PCR performed on the sample to be tested using the primers of the present invention;

[0018] Figure 5 This is the sequencing result of PCR amplification products of different samples with genotypes CC, CA and AA. DETAILED DESCRIPTION

[0019] To enable those skilled in the art to better understand the solution of this application, the following will clearly and completely describe this application in conjunction with the embodiments and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. The instruments and reagents used in the embodiments are from commercial channels unless otherwise specified.

[0020] Example 1

[0021] Collect blood samples, as well as data on two body size traits, such as body weight, chest depth, and semi-diving length, of 504 Shitou geese (adult goose stage) from a certain goose farm in Shantou City, Guangdong Province. Use the DNBSEQ TM sequencing system to obtain the original sequencing data through second-generation whole-genome resequencing.

[0022] To ensure the quality and accuracy of the data, strict quality control was performed on the original genomic sequencing data of 504 Shitou geese. First, use the SOAPnuke (v1.5.0) software to perform quality filtering and remove low-quality sequences on the data. Then, use the BWA (v0.7.17) software to align the filtered sequences to the swan goose reference genome to identify SNPs. Finally, use the GATK (v4.2.3.0) software to further screen and filter the SNPs, and use the Plink (v1.90b6.21) software to perform quality control and extraction on these SNPs, retaining the minor allele frequency (MAF) > 0.05, passing the Hardy-Weinberg equilibrium test (p < 10 -6 ), and SNPs on autosomes. Finally, 8,486,076 SNP loci were obtained.

[0023] Combined with the phenotypic measurement data, use the linear mixed model (LMM) in the GEMMA (v0.98.1) software to construct a genomic relationship matrix and perform a genome-wide association study (GWAS) for all traits (body weight, chest depth, and semi-diving length) respectively. GWAS is one of the methods to study the genetic mechanism of complex traits. It mainly determines the genetic factors affecting phenotypic traits by analyzing the correlation between phenotypic traits and genetic variations of genes. We converted the P value of each SNP locus to -log(P) according to the results of GWAS. The threshold for significant SNPs was 0.05 / n (n is the number of SNPs on each chromosome). Finally, significant SNPs were screened out for the next step of analysis, and the Manhattan plot and Quantile-Quantile plot (QQ plot) were drawn using the CMplot package in R language. See Figures 1-3 .

[0024] Significant SNPs within a distance of 1.5 Mb were combined to form a candidate region, and the BFMAP (v0.65) software was used to fine-map the candidate regions for all traits (body weight, chest depth, and semi-diving length), and the posterior probabilities of all SNPs within the candidate regions were predicted.

[0025] Combining the results of GWAS and fine-mapping, we screened out the polymorphic locus Chr18:6290111 in the traits of body weight, chest depth, and semi-diving length, and the signals of this locus were significant in different trait GWAS and fine-mapping.

[0026] Table 1 P-values of the polymorphic locus Chr18::6290111 in different trait GWAS and posterior probabilities after fine-mapping

[0027]

[0028] The association analysis between the polymorphic locus Chr18::6290111 and body size is shown in Table 2 below.

[0029] Table 2 Association analysis between the polymorphic locus Chr18::6290111 and body size

[0030]

[0031] Note: Values marked with different letters are significantly different, while values marked with the same letter are not significantly different.

[0032] In the male and female goose populations, this locus showed a significant association with body weight, chest depth, and semi-diving length.

[0033] In this example, the nucleotide sequence of the molecular marker where a segment of the polymorphic locus Chr18:6290111 is located is as follows:

[0034] TTGTGGTGCTTGGTCAACTTTCATACTATGTTGTGTTAATTTTAGTTAAATCTACCAGA

[0035] GAAAAATACGTGATAAATCATTTTTAAAACTTAAGTGTTTTCTTTTTTTTCCCCCCACA

[0036] GTGACTTTTTTCAAAAAAGTTGCATCAGAAATATGCTACAGATCTATGGAAATTTTCG

[0037] GGTTGGAGTTTGGAAAGGCTTTATTTACTTAGCTTTTTGTTGTTGTTTTAGGGTAAACC

[0038] TCCAACAAAAAAGGCTAAAGTTCTACAAAAACAAC C ATTGGTGGCTAAATTAGCAG

[0039] CATATGCTCAGTACCAAGCAACTTTACAAAACCAGGCAAAGACTAAAGCAGGTAATG

[0040] GCACATAAACAGCTAAAACAAATTCTGAGCAATACAAGATTTATGTTTCATTAGCAG

[0041] CTTCCTAAATGAAATAACTTTCTCTTAACAGCTGTCCCTGTGGAAGGTTTCAGCTGGGGTAACTACATCAATAGCAATAGCTTTACAGCAGCTCCT(SEQ ID NO.1).

[0042] In the above nucleotide sequence, the polymorphism site at position 271 is C or A. The results of Turkey HSD multiple comparisons found that when this marker mutates to A, geese have greater body weight, chest depth, and semi-diving length traits, and this trend is more obvious in the male goose population.

[0043] In summary, by collecting blood samples of Shitou geese and using the DNBSEQ TM sequencing system for sequencing, using SOAPnuke to perform quality filtering and removing low-quality sequences on the sequencing data. Then, using BWA to align the filtered sequences to the swan goose reference genome to identify SNPs. Finally, using GATK to further screen and filter the SNPs, and using Plink to perform quality control and extraction on these SNPs to obtain a genotype dataset. Combining its phenotypic measurement data, using the GEMMA software and adopting the single-marker LMM model, major genes and functional mutation sites related to four body size traits such as the body weight, chest depth, and semi-diving length of Shitou geese were screened out, providing new SNP sites for the breeding selection of the body weight, chest depth, and semi-diving length of Shitou geese.

[0044] Detection of the polymorphic site at Chr18:6290111: The MBTD1 gene sequence was found from https: / / www.ncbi.nlm.nih.gov / , and primer pairs were designed using Primer premier 5.0 software. The primer pair information is shown in Table 3 (primer sequences 5’→3’). The designed primer pair sequences were sent to Sangon Biotech for synthesis, and the blood DNA was subjected to PCR using this primer pair to test the specificity of the primers. The results are attached Figure 4 as shown.

[0045] Table 3 Primer Information for Screening Polymorphic Loci at Chr18: 6290111

[0046] F: TTGTGGTGCTTGGTCAACT (SEQ ID NO.2) R: AGGAGCTGCTGTAAAGCTATTG (SEQ ID NO.3)

[0047] Randomly select two DNA samples for each genotype, a total of six DNA samples for PCR amplification. Send the obtained PCR products to Sangon Biotech for sequencing. The genotypes of the Chr18: 6290111 locus detected by sequencing are CC, CA, and AA, which are consistent with the genotypes obtained by individual second-generation genome sequencing. The sequencing results are attached Figure 5 as shown

[0048] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be pointed out that for those of ordinary skill in the art, any obvious modifications, equivalent replacements, or other improvements made without departing from the inventive concept should be included within the protection scope of the present invention

Claims

1. The use of a reagent for detecting MBTD1 gene SNP molecular markers in screening or identifying lion-head geese with large body weight and size, characterized in that: The SNP molecular marker is located at position 6290111 of chromosome 18 of the goose, and the site polymorphism is C or A. When the polymorphism is A, the lion-head goose has a larger weight and body size trait.

2. The use of a reagent for detecting a nucleotide sequence containing a SNP molecular marker of the MBTD1 gene in screening or identifying lion-head geese of large body weight and size, characterized in that: The sequence is shown in SEQ ID NO.1, the SNP molecular marker is located at the 271st position of the nucleotide sequence, and the site polymorphism is C or A. When the polymorphism is A, the lion-head goose has a larger weight and body size traits.

3. The use according to claim 2, characterized in that: The reagents include a primer pair whose nucleotide sequences are shown as SEQ ID NO. 2-3.