Anthocyanin-free broccoli

Abstract

The invention relates to a broccoli plant free of anthocyanin. The broccoli plant comprises a combination of an inactive MYB2 gene and an inactive DFR1 gene. The invention further relates to a method for providing an anthocyanin-free broccoli plant of the invention. The invention also relates to seeds and plant parts of anthocyanin-free broccoli plants of the invention.

Description

Technical Field

[0001] The present invention relates to anthocyanin-free broccoli (broccoli, cauliflower) plants, which broccoli plants contain a combination of an inactive MYB2 gene and an inactive DFR1 gene. The present invention further relates to a method for providing an anthocyanin-free broccoli plant of the present invention. The present invention also relates to seeds and plant parts of the anthocyanin-free broccoli plant of the present invention. Background Art

[0002] Broccoli is a well-known vegetable from the plant species Brassica oleracea (Brassicaceae). It is cultivated for its large flower heads and eaten in its immature form as a vegetable.

[0003] The plant species Brassica oleracea includes many common vegetables such as cauliflower, kale, and cabbage. Vegetables in the Brassica species can be divided into eight cultivars based on their phenotypic characteristics: Brassica oleracea var. acephala (collard greens and collard greens); Brassica oleracea var. alboglabra (Chinese kale); Brassica oleracea var. botrytris (cauliflower and Roman broccoli); Brassica oleracea var. capitata (cabbage and savoy cabbage); Brassica oleracea var. gemmifera (Brussels sprouts); Brassica oleracea var. gongylodes (kohlrabi); Brassica oleracea var. italica (broccoli); and Brassica oleracea var. sabellica (curly kale and Portuguese kale). These cultivars are all derived from wild cabbages native to southern and western Europe by selecting specific parts of the plant. Kale and cabbage were selected for their prominent leaves, Brussels sprouts were selected for their axial buds, cauliflower was selected for its white inflorescence meristem, and broccoli was selected for its large flower heads.

[0004] Broccoli is a cool season crop that generally prefers temperatures between 18 and 23 degrees Celsius. Depending on the variety and climate conditions, broccoli takes about 50 to 115 days from sowing to harvesting. Broccoli is harvested when the flower heads are fully mature, but before the individual green buds open and reveal small yellow flowers. Although broccoli flower heads are usually green, they are known to become slightly purple in cold conditions. This purple discoloration is caused by the production of anthocyanins.

[0005] Anthocyanins are a large group of secondary metabolites belonging to a group of flavonoids. Depending on the pH of their environment, they can be orange, red, purple or blue in color. Anthocyanins are found to be widely present in higher plants and can give color to various plant parts, including leaves, roots, stems, flowers, fruits and seeds. Anthocyanins perform various functions in plants, such as attracting pollinators like insects, and protecting plants from exposure to UV, low temperatures and drought stress.

[0006] The biosynthesis, regulation, and transport of anthocyanins have been well studied, especially in the model plant Arabidopsis thaliana. The anthocyanin biosynthetic pathway begins with the conversion of phenylalanine to p-coumaroyl-CoA via the phenylpropanoid pathway genes phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), and 4-coumaroyl-CoA ligase (4CL). Subsequently, p-coumaroyl-CoA is condensed with malonyl-CoA and converted to flavonols by the early biosynthetic enzymes chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), and flavonoid 3'-hydroxylase (F3'H). These flavonols are then oxidized by flavonol synthase (FLS) or used as substrates by flavonoid 3'-hydroxylase (F3'H), flavonoid 3',5'-hydroxylase (F3'5'H), dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS), also known as leucoanthocyanidin dioxygenase (LDOX), to produce various anthocyanidins. Anthocyanidin aglycones can undergo further modifications such as glycosylation, acylation, methylation or a combination thereof. Anthocyanidin aglycones in plants exist mainly in the form of glycosides, which are generally referred to as anthocyanidins. The glycosylation of anthocyanidin aglycones is catalyzed by the enzyme UDP (uridine diphosphate)-glycosyltransferase (UGT). After synthesis in the cytoplasm, anthocyanidins are transported to the vacuole by glutathione S-transferases (GSTs), ATP binding cassettes (ABCs) and multidrug and toxic compound extrusion (MATE) proteins.

[0007] Biosynthetic genes are regulated primarily at the transcriptional level, particularly by members of the R2R3-MYB protein family. In Arabidopsis and other eudicots, the phenylpropanoid pathway and early anthocyanin biosynthetic genes are regulated by R2R3-MYB proteins such as MYB11, MYB12, and MYB111. Late anthocyanin biosynthetic genes, such as DRF and ANS, are activated by the MYB-bHLH-WDR (MBW) transcriptional activation complex, which includes an R2R3-MYB protein (AtMYB75 / PAP1, AtMYB90 / PAP2, AtMYB112, MYB113, or MYB114), a bHLH protein (GL3, EGL3, or TT8), and a protein named Transparent Testa Hairless 1 (TTG1, also known as WD40). R2R3-MYB transcription factors, such as AtMYB75 / PAP1, AtMYB90 / PAP2, AtMYB112, AtMYB113, and AtMYB114, are positive regulators of the initiation and activation of the MBW complex. In addition, two single-repeat R3-MYB transcription factors, MYBL2 and CAPRICE (CPC), and three lateral organ boundary domain (LBD) gene family members, named LBD37, LBD38, and LBD39, negatively regulate anthocyanin biosynthesis in Arabidopsis. In addition to controlling anthocyanin production, various transcriptional regulators also control anthocyanin modification and anthocyanin translocation to the vacuole.

[0008] The basic structure of the anthocyanin biosynthetic pathway is conserved in all flowering plants. However, the characterization of the anthocyanin biosynthetic pathway in other plants, such as petunia (Petunia hybrida), corn (Zea mays), snapdragon (Antirrhinum majus), grape (Vitis vinifera) and apple (Malus domestica), has shown that there are species-specific differences in this universal metabolic pathway. For example, in corn, all biosynthetic genes are regulated by the MBW complex, while in Arabidopsis, early synthesis genes are regulated by the R2R3-MYB protein. In addition to regulatory differences, changes in the sequence of anthocyanin synthesis genes can change the expression pattern and substrate specificity of the synthases. For example, in ornamental flowering plants such as Senecio cruentus, the enzymes F3'H, F3'5'H and DFR compete to produce cyanidin (Cy), delphinidin (Dp) and pelargonidin (Pg), which are precursors of red, blue and orange anthocyanidins. Variation in the activity of one of these enzymes results in the accumulation of different combinations of red, blue and orange anthocyanidins, changing the color of the flower. New colors can also be obtained by changing the methylation, glycosylation and acylation patterns of anthocyanidins.

[0009] In many plant species, the regulatory and synthetic genes of the anthocyanin pathway have undergone gene duplication events that have enabled extensive sequence, expression, and regulatory divergence. For example, in strawberry, there are two DFR genes encoding enzymes with different substrate specificities. One variant does not accept the flavanone dihydrokaempferol (DHK) as a substrate, while the other strongly prefers DHK. In addition to substrate specificity, the two paralogous genes also have different expression patterns. The expression of DFR2 is dependent on fruit development, while the expression of DFR1 is relatively stable.

[0010] In cabbage species, the number of anthocyanin biosynthesis genes has also expanded in evolution through whole genome and tandem duplications. In Arabidopsis, 41 anthocyanin biosynthesis genes could be identified in the genome, while the genome of cabbage contains up to 88 putative anthocyanin biosynthesis genes. However, the exact number varies between cabbage cultivars. For example, in broccoli, not only late anthocyanin biosynthesis genes, such as DRF and ANS, have been duplicated, but also the number of R2R3-MYB transcription factors has expanded.

[0011] In addition to variations in the number of anthocyanin biosynthesis genes, cultivars also contain different mutations in the promoter and coding sequences of these genes. These mutations lead to significant expression differences between paralogous genes in B. oleracea. As a result, each cultivar contains a unique version of the anthocyanin biosynthesis pathway, each with a different set of anthocyanin biosynthesis and regulatory genes. Due to these differences between cultivars, the mechanisms underlying anthocyanin accumulation in many vegetable crops of B. oleracea remain unknown.

[0012] In Brussels sprouts, cabbage, kale, and cauliflower, purple cultivars were obtained by upregulating the R2R3-MYB transcription factor MYB2. MYB2 increases transcription of anthocyanin biosynthesis genes. In cauliflower, MYB2 was upregulated by transposon insertion, while in cabbage, kale, and Brussels sprouts, MYB2 was upregulated by point mutations and / or 1 base pair insertions in the MYB2 promoter region. In response to MYB2 upregulation, although all four cultivars accumulated anthocyanins, there were significant differences in the distribution of anthocyanin accumulation. While kale accumulated anthocyanins in both leaves and stems, Brussels sprouts accumulated anthocyanins primarily in stems and only slightly in leaves. In cauliflower, anthocyanins accumulated in the inflorescence but very little in other tissues. In red cabbage, anthocyanins were found only in the epidermis. The reasons for these differences in anthocyanin accumulation between tissues and cultivars are unknown and suggest that additional factors control anthocyanin production in different tissues.

[0013] Tissue-specific regulation of anthocyanin accumulation can also be observed in broccoli. For example, no purple color was observed in the leaves of the broccoli line DH16-2, although its flower heads were purple and turned dark purple under cold conditions. In broccoli, one major locus and two minor loci on chromosome C1 were associated with the purple trait of flower heads.

[0014] In addition to tissue-specific effects, the production of anthocyanin biosynthesis is also affected by environmental stress. In broccoli, green cultivars can accumulate anthocyanins in response to various environmental factors, especially cold conditions.

[0015] Since the accumulation of anthocyanins can cause a slight purple pigmentation, which reduces the commercial value of broccoli, developing anthocyanin-free broccoli is an important goal for breeding. Summary of the invention

[0016] Among other objects, it is an object of the present invention to meet the above-mentioned unmet needs in the art.

[0017] The present invention meets the above objects, among others, as outlined in the appended claims.

[0018] In particular, the above objects are met by providing an anthocyanin-free broccoli plant, which, among other objects, comprises a combination of an inactive MYB2 gene and an inactive DFR1 gene. Preferably, the anthocyanin-free broccoli plant homozygously comprises an inactive MYB2 gene and an inactive DFR1 gene.

[0019] The present inventors surprisingly found that when broccoli plants comprise a combination of an inactive MYB2 gene and an inactive DFR1 gene, the broccoli plants do not accumulate anthocyanins in response to abiotic stresses such as drought, high light intensity and especially cold.

[0020] An inactive MYB2 gene results in an absence or deficiency of a functional MYB2 protein, whereas an inactive DFR1 gene results in an absence or deficiency of a functional DFR1 protein. A complete lack of MYB2 or DFR1 protein or a biologically insufficient amount can be caused by various mechanisms, including but not limited to a lack or reduced level of mRNA for MYB2 or DFR1. Alternatively, an inactive DFR or MYB2 gene can result in the production of an inactive MYB2 or DFR1 protein. Among other reasons, an inactive MYB2 or DFR1 protein may be inactive due to modification of its wild-type amino acid sequence, including deletion and / or insertion of one or more amino acids that destroy the wild-type function of the protein. The simultaneous lack of a functional MYB2 protein and a DFR1 protein prevents the accumulation of anthocyanins in broccoli plants.

[0021] Preferably, the inactive MYB2 gene is located on chromosome 6 and the inactive DFR1 gene is located on chromosome 9.

[0022] According to a preferred embodiment, the inactive DFR1 gene of the present invention is obtained from kale (Brassica oleracea var. acephala). Preferably, the inactive DFR1 gene from kale comprises a 1 base pair insertion in the second exon of the DFR1 gene. This nonsense mutation causes premature termination of translation due to a frameshift of the reading frame, resulting in the production of a functionally inactive truncated DFR1 protein.

[0023] According to another preferred embodiment, the inactive DFR1 gene of the present invention is inactivated due to premature termination of transcription and / or translation.

[0024] According to another preferred embodiment, the inactive DFR1 gene of the present invention is inactivated by mutation. Preferably, the mutation is a mutation in the promoter and / or coding region of the DFR1 gene. More preferably, the mutation is an insertion and / or deletion in part or all of the DFR1 gene.

[0025] The indefinite articles "a" or "an" can be used interchangeably with the phrases "one or more" or "at least one." Thus, the articles "a" and "an" should be understood to mean one, two, three, four, five, six or more.

[0026] According to another aspect, the present invention relates to seeds or plant parts of broccoli plants that are free of anthocyanins. The seeds of the present invention are preferably polished, coated, shelled, spherical and / or primed.

[0027] The present invention also relates to a method for preventing purple discoloration of broccoli plants, wherein the method comprises the step of cultivating or growing anthocyanin-free broccoli plants according to the present invention. Purple discoloration of broccoli plants, in particular of the curd, is caused by the accumulation of anthocyanins, which results in purple pigmentation.

[0028] The present invention also includes the use of a combination of an inactive MYB2 and an inactive DFR1 gene to prevent purple pigmentation in broccoli plants, particularly in the inflorescence of broccoli plants, preferably after exposure of the broccoli to cold, and to provide evergreen broccoli plants. An evergreen broccoli plant is a broccoli plant that does not accumulate purple pigmentation after exposure to abiotic stress, preferably cold. Preferably, the combination of an inactive MYB2 and an inactive DFR1 gene is used in a homozygous manner to prevent purple pigmentation in broccoli plants.

[0029] The present invention also relates to a method for providing a broccoli plant without anthocyanins according to the present invention. Such a method preferably comprises the step of inactivating the DFR1 and / or MYB2 gene by introducing a mutation. The mutation may be, but is not limited to, a deletion, substitution or insertion of a nucleic acid in the DFR1 gene or MYB2 gene coding sequence.

[0030] Mutations can be introduced by mutagenesis or genome editing techniques, preferably CRISPR-Cas. Chemical compounds such as ethyl methanesulfonate (EMS) or N-methyl-N-nitrosourea (MNU) can be used, or irradiation techniques such as UV-irradiation can be used to complete mutagenesis. Examples of genome editing techniques include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), or clustered regularly interspaced short palindromic repeats (CRISPR).

[0031] The present invention also provides a method for providing anthocyanin-free broccoli according to the present invention, wherein the method comprises: crossing broccoli containing an inactive MYB2 gene with kale containing an inactive DFR1 gene to obtain an F1 plant; backcrossing the F1 plant with broccoli containing an inactive MYB2 gene, preferably with a broccoli plant used as a parent line for producing the F1 plant, to obtain a backcross plant; selfing the backcross plant to obtain an inbred plant; and selecting an inbred plant containing a combination of an inactive MYB2 gene and an inactive DFR1 gene.

[0032] Backcrossing and selfing are performed at least once. However, the steps of backcrossing and selfing can be performed any number of times, independently of each other, as needed or desired to obtain a broccoli line of sufficient commercial quality and / or homozygosity.

[0033] The presence of the inactive MYB2 gene and the inactive DFR1 gene in the plant is preferably determined after each step of hybridization, backcrossing and selfing. Sequencing methods, such as PCR followed by Sanger sequencing, or marker assisted selection (MAS), particularly single nucleotide polymorphism (SNP) markers, can be used to determine the presence of the inactive MYB2 gene and the inactive DFR1 gene in the plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The present invention will be further described in the following examples. In the examples, reference is made to the accompanying drawings, in which:

[0035] Figure 1 : Shows the anthocyanin-colored inflorescence of the original parental line A (top) containing an inactive MYB2 gene and an active DFR1 gene, compared with two green inflorescences of the NIL (bottom) containing an inactive DFR1 gene and an inactive MYB2 gene after exposure of the parental lines and NIL (near isogenic line) lines to cold. DETAILED DESCRIPTION

[0036] Example

[0037] Example 1. Development of anthocyanin-free broccoli

[0038] In order to develop anthocyanin-free broccoli, an introgression library was constructed. An introgression library is a population of plants constructed from one parent line, containing a small DNA introgression from another parent line. For this purpose, a cross between the broccoli parent line A and the kale parent line B was made. The F1 was used for subsequent backcrossing with parent line A and marker-assisted selection of specific introgressed DNA fragments. From these backcrossing steps, new homozygous near-isogenic lines (NILs) were developed through inbreeding generation.

[0039] Under field conditions, the effect of the small introgression on the line phenotype was compared to parent line A. Lines A and B both had a green phenotype, but the resulting F1 hybrid showed anthocyanin color change. This suggests that the "blocked" anthocyanin pathway of the two green parent lines was complemented in the resulting F1.

[0040] Comparison of new Brassica introgression pool lines revealed the involvement of two introgressions located on chromosome 6 and chromosome 9, respectively. Near-isogenic lines (NILs) with a combination of an introgression on chromosome 6 from broccoli and an introgression on chromosome 9 from kale produced anthocyanin-free broccoli lines in different cases. Both introgressions were required to completely block the anthocyanin pathway in broccoli and obtain anthocyanin-free broccoli.

[0041] Example 2. Fine mapping of anthocyanin pathway and transcription factor genes

[0042] The NIL (near isogenic line) with a small kale introgression on chromosome 6 harbored the MYB2 gene. Additional dedicated backcross populations fine-mapped the co-segregation of the purple trait with the MYB2 gene (SEQ ID No. 1; BOLC6T39061H) located on chromosome C6:37,571,911-37,573,320 of the B. oleracea HDEM genome (GenBank: LR031880.1).

[0043] A NIL (near isogenic line) with a kale introgression on chromosome 9 contains the TT8 and DFR1 genes involved in the anthocyanin pathway. This particular NIL was used for additional backcrossing and recombination selection. From this backcross population, specific plants containing recombination between the TT8 and DFR1 genes were selected. Phenotypic analysis of these recombinations showed that the DFR1 gene (SEQ ID No. 2; Bo9g058630.1) co-segregated with anthocyanin content. The DFR1 gene is located on chromosome C9: 17,116,312-17,117,891 of the Brassica oleracea TO1000 genome (GenBank GCA_000695525.1).

[0044] Figure 1 A comparison between the anthocyanin color-changing inflorescence of the original parent line A (top) and the two green inflorescences of the NIL (near isogenic line) line (bottom) is shown.

[0045] Table 1. Sequence information

[0046]

[0047]

[0048] Example 3. CRISPR / Cas9 knockout of DFR1

[0049] To evaluate whether DFR1 is indeed the functional gene for anthocyanin production in broccoli, DFR1 was knocked out using CRISPR / Cas9 in broccoli containing an inactive MYB2 gene. Four target sites were identified (SEQ ID No. 3, 4, 5 and 6) and used to generate guide RNAs (gRNAs). The CRISPR system, gRNA and Cas9 protein were delivered into broccoli plant cells by PEG-mediated ribonucleoprotein (RNP) transfection or by Agrobacterium-mediated gene transfer. The edited cells were regenerated to obtain living plants. Broccoli plants without an active DFR1 gene showed the expected phenotype.

[0050] Table 2. Identified target sites for CRISPR / Cas9 knockout of DFR1

[0051] SEQ ID No. sequence SEQ ID No.3 CATCAGGATTCATTGGTTCATGG SEQ ID No.4 GTGAGTTGCGTCTTCGCGTTTGG SEQ ID No.5 GATAATGAAAGCATGTGATAAGG SEQ ID No.6 AGCAGCTTGGGATTACGCTAAGG

[0052] Example 4. Identification of DFR1 mutants from the TILLING population

[0053] To evaluate whether DFR1 is indeed a functional gene for anthocyanin production in broccoli, DFR1 mutant alleles can be found in the TILLING population of broccoli by screening and / or resequencing.

[0054] The TILLING population is produced by treating broccoli seeds containing an inactive MYB2 gene with ethyl methanesulfonate (EMS). The surviving seedlings are grown into plants and then selfed to obtain M2 seeds. M2 seeds are sampled to identify DFR1 mutants. Plants with nonsense mutations in DFR1 can be selected and backcrossed multiple times to select mutants. Due to the absence of active MYB2 and DFR1 genes, this will produce broccoli plants that do not contain anthocyanins.

Claims

1. Broccoli plants without anthocyanins contain a combination of an inactive MYB2 gene and an inactive DFR1 gene.

2. The anthocyanin-free broccoli plant according to claim 1, wherein The inactive MYB2 gene is located on chromosome 6 and the inactive DFR1 gene is located on chromosome 9.

3. The anthocyanin-free broccoli plant according to claim 1 or claim 2, wherein: The inactive DFR1 gene was obtained from kale.

4. The anthocyanin-free broccoli plant according to any one of claims 1 to 3, wherein The inactive DFR1 gene is inactive due to premature termination of transcription and / or translation.

5. The anthocyanin-free broccoli plant according to any one of claims 1 to 3, wherein The inactive DFR1 gene comprises a mutation, wherein the mutation results in the absence of functional DFR1 protein.

6. The anthocyanin-free broccoli plant according to claim 5, wherein: The mutation is an insertion and / or deletion in part or all of the DFR1 gene.

7. The anthocyanin-free broccoli plant according to any one of claims 1 to 3, wherein The inactive DFR1 gene encodes an inactive DFR1 protein.

8. Seeds or plant parts of the anthocyanin-free broccoli plant according to any one of claims 1 to 7.

9. A method for preventing purple discoloration in broccoli plants, wherein: The method comprises the steps of cultivating or growing the anthocyanin-free broccoli plant according to any one of claims 1 to 7.

10. Use of a combination of an inactive MYB2 and an inactive DFR1 gene for providing an evergreen broccoli plant.

11. Use of a combination of an inactive MYB2 gene and an inactive DFR1 gene for preventing purple pigmentation in broccoli plants.

12. The use according to claim 11, wherein The purple pigmentation in broccoli plants occurs after the broccoli plants are exposed to cold.

13. A method for providing anthocyanin-free broccoli plant according to claim 1, wherein: The method comprises the step of inactivating the DFR1 gene and / or the MYB2 gene by introducing a mutation.

14. The method according to claim 13, wherein: The mutations are introduced by mutagenesis or genome editing techniques, preferably CRISPR-Cas.

15. A method for providing anthocyanin-free broccoli plant according to claim 1, wherein: The method comprises the following steps: a) crossing a broccoli plant containing an inactive MYB2 gene with a kale plant containing an inactive DFR1 gene to obtain an F1 plant; b) backcrossing the F1 plant with the broccoli plant containing the inactive MYB2 gene to obtain a backcross plant; c) selfing the backcross plants to obtain inbred plants; and d) Selecting inbred plants containing a combination of an inactive MYB2 gene and an inactive DFR1 gene.

Images