Recombinant therapeutic FMR1 constructs and methods of treating fragile x syndrome and related conditions

Abstract

Recombinant human FMR1 constructs and related methods for treating fragile X syndrome and related conditions in a subject are provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of and priority to UK patent application No. GB2206336.6 filed on April 29, 2022, the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing with 13 sequences, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy was created on April 19, 2023, named 55225WO_CRF_sequencelisting.xml, and is 61,563 bytes in size. Background Art

[0005] Fragile X syndrome (FXS) is an X-linked disorder that affects approximately 1 in 4,000 males and 1 in 8,000 females worldwide. It is the leading genetic cause of intellectual disability and autism. Many FXS patients also suffer from attention deficit hyperactivity disorder (ADHD), increased susceptibility to seizures, anxiety, and language impairment. FXS is caused by a CGG trinucleotide repeat expansion within the 5' untranslated region (UTR) of the Fragile X gene FMR1.

[0006] The normal length of this locus ranges from 5 to 44 CGG repeats. However, longer stretches of CGG repeats tend to be unstable when passed from parent to child. Premutation alleles (55-200 CGG repeats) are the causative mutations for Fragile X-associated tremor / ataxia syndrome (FXTAS), a late-onset neurodegenerative disorder, and Fragile X-associated primary ovarian insufficiency (FXPOI), a disorder that causes fertility problems in women. Full mutations (greater than 200 CGG repeats) are the main cause of Fragile X syndrome (FXS). FXS is the most common single gene cause of intellectual disability and autism spectrum disorder. Individuals with FMR1 premutations are at risk of developing FXTAS or FXPOI (1:130-1:256 in females and 1:250-1:810 in males), and individuals with full mutations are diagnosed with FXS (1:2500 to 1:8000 in females; 1:5000 in males).

[0007] When the premutation allele is present on the FMR1 gene, it is transcribed into messenger RNA (mRNA). However, it is located upstream of the start codon and is not translated as part of the typical protein isoform. While the mechanisms leading to FXTAS and FXPOI are not fully understood, the longer CGG repeat stretches are thought to alter how the gene is expressed (higher mRNA levels and alternative translation initiation) and how other proteins interact with the CGG repeats or alternative FMRP isoforms. Alternatively, when the full mutation allele is present on the FMR1 gene, it undergoes epigenetic changes, including methylation of cytosine nucleotides within the CGG repeats and along the promoter region, and modification of histones to have heterochromatin features. These changes lead to silencing of FMR1, such that the gene is neither significantly transcribed into mRNA nor significantly translated into protein. While the exact mechanisms and sequence of events leading to transcriptional silencing are still not fully understood, the end result of these epigenetic changes is the loss of the synaptic function regulator FMR1, also known as fragile X mental retardation protein (FMRP).

[0008] There is strong evidence that loss of FMRP causes FXS symptoms, as rare patients with mutations or deletions elsewhere in FMR1 also develop FXS. Furthermore, FMR1 knockout (KO) mouse models recapitulate many key features of the human disease, including learning impairments, abnormal social and anxious behaviors, enhanced seizure susceptibility, and abnormal dendritic spine morphology. FMRP is an RNA-binding protein that binds approximately 4% of brain mRNAs, including a fraction of synaptic transcripts that are enriched in genes associated with autism.

[0009] There are currently no effective treatments for FXS and related disorders, and thus, there is a need in the art for an effective therapy to treat these disorders and restore FMRP production. Summary of the invention

[0010] FXS is considered a good candidate for gene therapy because it is a monogenic disease with severe manifestations and no effective treatment. The goal of the present disclosure is to develop an effective gene therapy cassette for treating FXS. In one aspect, the present disclosure provides a therapeutic polynucleotide comprising:

[0011] A human endogenous FMR1 promoter fragment; a human FMR1 isoform, suitably a human FMR1 isoform 7 sequence; an endogenous human 3' regulatory element and polyadenylation signal.

[0012] In an embodiment, the human FMR1 coding sequence comprises the nucleotide sequence of SEQ ID NO:4, or a nucleotide sequence having at least 80%, 90%, 95% or 99% identity with SEQ ID NO:4. In an embodiment, the human FMR1 coding sequence comprises the nucleotide sequence of SEQ ID NO:4, or a nucleotide sequence lacking exon 12, in particular a nucleotide sequence lacking exon 12 and having at least 80%, at least 90%, at least 95% identity with SEQ ID NO:4. In an embodiment, the human FMR1 coding sequence comprises a nucleotide sequence encoding a functionally equivalent nucleotide sequence of SEQ ID NO:4. In some embodiments, the human FMR1 coding sequence encodes a polypeptide or human FMRP comprising an amino acid sequence having at least 80%, at least 90%, at least 95% identity with SEQ ID NO:6.

[0013] In embodiments, the promoter comprises SEQ ID NO: 3 or SEQ ID NO: 12, or a nucleotide sequence having at least 80%, 90%, 95% or 99% identity to SEQ ID NO: 3 or SEQ ID NO: 12. In certain embodiments, the 3' regulatory element comprises SEQ ID NO: 5 or SEQ ID NO: 13, or a nucleotide sequence having at least 80%, 90%, 95% or 99% identity to SEQ ID NO: 5 or SEQ ID NO: 13. Suitably, a promoter and / or 3' regulatory element functionally equivalent to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 12 or SEQ ID NO: 13 may be provided.

[0014] In embodiments, the therapeutic construct sequence comprises the nucleotide sequence of SEQ ID NO:2, SEQ ID NO:9 or SEQ ID NO:11, or a nucleotide sequence at least 90%, 95% or 99% identical to SEQ ID NO:2, SEQ ID NO:9 or SEQ ID NO:11.

[0015] In embodiments, the polynucleotide further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR).

[0016] In an embodiment, the polynucleotide comprises two AAVITRs.

[0017] In additional embodiments, the present disclosure provides a vector comprising a polynucleotide of any embodiment described herein.

[0018] In an embodiment, the vector is a viral vector.

[0019] In an embodiment, the vector is an adeno-associated virus (AAV) vector.

[0020] In an embodiment, the AAV vector is an AAV9 vector.

[0021] In another aspect, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising any polynucleotide or vector described herein. In certain embodiments, the rAAV is AAV9.

[0022] In another aspect, the present disclosure provides a virion comprising the rAAV described herein.

[0023] In another aspect, the present disclosure provides a transformed cell comprising any polynucleotide described herein, a vector described herein, an rAAV described herein, or a virion described herein.

[0024] In another aspect, the present disclosure provides a pharmaceutical composition comprising any polynucleotide described herein, a vector described herein, an rAAV described herein, or a virosome described herein, and optionally a pharmaceutically acceptable carrier.

[0025] In another aspect, the present disclosure provides a method for treating a subject's FXS or FMR1-related condition, the method comprising administering to the subject an effective amount of any polynucleotide described herein, a vector described herein, an rAAV described herein, or a virion described herein, or a pharmaceutical composition described herein. Therefore, any polynucleotide described herein, a vector described herein, an rAAV described herein, or a virion described herein, or a pharmaceutical composition described herein is provided for use as a drug. In particular, any polynucleotide described herein, a vector described herein, an rAAV described herein, a virion described herein, or a pharmaceutical composition described herein is provided for use in a method for treating a subject's FXS or FMR1-related condition. Also provided is the use of any polynucleotide described herein, a vector described herein, an rAAV described herein, a virion described herein, or a pharmaceutical composition described herein in the preparation of a drug for treating a subject's FXS or FMR1-related condition.

[0026] BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1A -B. Figure 1A The FMR1 construct driven by the constitutive CBh promoter expression (SEQ ID NO: 7) is shown, and ( Figure 1B) Low-level transgenic FMRP expression observed by immunohistochemistry analysis 70 days after ICV delivery into P0-2 wild-type mice. AAV9-CBh-hFMR1-Myc-bGHpA was delivered at two different doses and FMRP levels compared to vehicle-treated wild-type mice.

[0028] Figure 2 The FMR1 construct design of SEQ ID NO: 2 is illustrated, which includes a 1050 bp fragment of the endogenous FMR1 promoter (hFMP1050), a human wild-type FMR1 sequence encoding isoform 7 (hFMR1), a Myc tag, and an endogenous 3'UTR fragment of human FMR1 (FMpA1).

[0029] Figure 3 The plasmid FMR1 construct comprising the hMP1050-FMR1-Myc-FMpA1 construct flanked by wild-type AAV2 inverted terminal repeats (ITRs) is shown. The plasmid has the sequence of SEQ ID NO:1.

[0030] Figure 4 Shown is the use of AAV9-hFMP1050-Myc-hFMR1-FMpA1 to test Fmr1 - / y Schematic representation of the experimental design and various phenotypic analyses in mice.

[0031] Figure 5A -B shows WT and Fmr1 - / y Marble burying data for mice ( Figure 5A ) and Fmr1 receiving different doses of AAV9-hFMP1050-Myc-hFMR1-FMpA1 - / y Observable therapeutic effects on marble burying in mice ( Figure 5B ).

[0032] Fig. 6A -C indicates ( Fig. 6A ) in Fmr1 - / y Strong genotype effects observed in mouse models of audiogenic epilepsy; Figure 6B -C) Therapeutic effect of treatment with AAV9-hFMP1050-Myc-hFMR1-FMpA1 (virus). Increasing doses of AAV9-hFMP1050-hFMR1-Myc-FMpA1 reduced the number of Fmr1 cells treated. - / y Seizure rates in mice.

[0033] Figure 7Wild-type (WT) and Fmr1 mice dosed with vehicle or 5E10 vg / mouse of AAV9-hFMP1050-hFMR1-Myc-FMpA1 are shown. - / y Immunoblot data of cortex, hippocampus and thalamus of (KO) mice.

[0034] Fig. 8A -B shows wild-type mice treated with increasing doses of AAV9-hFMP1050-hFMR1-Myc-FMpA1 ( Fig. 8A ) and Fmr1 - / y Mouse ( Figure 8B ) Quantification of FMRP expression levels in the cortex.

[0035] Fig. 9A -H shows immunohistochemical analysis of transgenic FMRP expression in different brain regions of mice 70 days after injection of AAV9-hFMP1050-hFMR1-Myc-FMpA1. Wild-type (WT) mice and Fmr1 mice were treated by ICV delivery of 1E11 vg / mouse at P0-2. - / y Mouse.

[0036] Fig. 10A -D shows the Fmr1 - / y Increased FMRP expression in mice after delivery of AAV9-hFMP1050-hFMR1-Myc-FMpA1. Representative sagittal flat-mount micrographs of whole brains immunolabeled with FMRP (green fluorescence) from ( Fig. 10A )WT mice treated with vehicle, ( Fig. 10B ) Fmr1 treated with vehicle - / y Mouse, ( Fig. 10C -D) AAV9-hFMP1050-hFMR1-Myc-FMpA1 was used at 1E11 vg / mouse ( Fig. 10C )or( Fig. 10D )3E11 vg / mice treated with Fmr1 - / y Mouse. Scale bar represents 1 mm.

[0037] Fig.11 Schematic representation of the FMR1 construct design (SEQ ID NO:9) comprising a 1050 bp fragment of the endogenous FMR1 promoter (hFMP1050), the human wild-type FMR1 sequence encoding isoform 7 (hFMR1), and the endogenous 3'UTR fragment of human FMR1 (FMpA1).

[0038] Fig.12Schematic representation of the plasmid FMR1 construct (SEQ ID NO: 8), which comprises the hMP1050-FMR1-FMpA1 construct flanked by wild-type AAV2 inverted terminal repeats (ITRs).

[0039] Fig.13 The FMR1 promoter region in the UCSC genome browser is shown. The 1050 bp fragment contains most of the key genetic regulatory elements required for endogenous expression and regulation of FMR1 in this genomic region.

[0040] Fig.14 Shown is a dot plot generated by EMBOSS Dotmatcher comparing human (hum) and mouse (mus) sequences in the genomic region upstream of the FMR1 coding region, which includes a 1050 bp fragment of the promoter.

[0041] Fig.15 Schematic representation of the FMR1 construct design (hFMP734-hFMR1-FMpA2 construct, SEQ ID NO: 11), comprising a shorter 734 bp fragment of the endogenous FMR1 promoter (hFMP734), the human wild-type FMR1 sequence encoding isoform 7 (hFMR1), and the human FMR1 endogenous 3'UTR fragment (FMpA2).

[0042] Fig.16 Schematic representation of the plasmid FMR1 construct (SEQ ID NO: 10), which comprises the hMP734-FMR1-FMpA2 construct flanked by wild-type AAV2 inverted terminal repeats (ITRs).

[0043] Fig.17 Immunoblot data for FMRP expression in plasmids containing hFMP1050-hFMR1-FMpA1 or hFMP734-hFMR1-FMpA2 are shown. HEK293A cells were transfected with different amounts of plasmid DNA, and FMRP levels were detected using an anti-FMRP antibody. FMRP levels were calculated relative to FMRP levels in untransfected HEK293A cells and plotted against copy number / cell, calculated based on input DNA levels and cell number / well.

[0044] definition

[0045] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by ordinary technicians in the field to which the invention belongs. The terms used herein are only used to describe specific embodiments and are not intended to limit the present invention. The following terms have the given meanings:

[0046] AAV "rep" and "cap" genes refer to polynucleotide sequences encoding adeno-associated virus replication and capsid proteins. AAV rep and cap are referred to herein as AAV "packaging genes".

[0047] "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its modifications, derivatives or pseudotypes. Unless otherwise required, the term encompasses all subtypes and naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus. The term "AAV" includes AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV and ovine AAV, and modified forms, derivatives or pseudotypes thereof. "Primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, "bovine AAV" refers to AAV that infects bovine mammals, and so on. In some embodiments, the AAV particles are AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV. 7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6 , AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16.In some embodiments, the rAAV particles are AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV-PH A derivative, modification or pseudotype of P.B, AAV-PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16.

[0048] There are several reasons why the various serotypes of AAV are attractive, the most prominent of which is that AAV is considered non-pathogenic and the wild-type virus can integrate its genome site-specifically into human chromosome 19 (Linden et al., 1996, Proc Natl Acad Sci USA 93: 11288-11294). The site where AAV inserts into the human genome is called AAVS1. In contrast to random integration, site-specific integration is thought to result in predictable long-term expression profiles.

[0049] The genomic sequences of various AAV serotypes and the sequences of natural terminal repeats (TR), Rep proteins and capsid subunits are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. See, for example, GenBank accession numbers NC-002077 (AAV-1), AF063497 (AAV-1), NC-001401 (AAV-2), AF043303 (AAV-2), NC-001729 (AAV-3), NC-001829 (AAV-4), U89790 (AAV-4), NC-006152 (AAV-5), AF513851 (AAV-7), AF513852 (AAV-8), and NC-006261 (AAV-8); the disclosures thereof are incorporated herein by reference. See also, e.g., Srivistava et al., 1983, J. Virology 45:555; Chiorini et al., 1998, J. Virology 71:6823; Chiorini et al., 1999, J. Virology 73:1309; Bantel-Schaal et al., 1999, J. Virology 73:939; Xiao et al., 1999, J. Virology 73:3994; Muramatsu et al., 1996, Virology 221:208; Shade et al., 1986, J. Virol. 58:921; Gao et al., 2002, Proc. Nat. Acad. Sci. USA 99:11854; Moris et al., 2004, Virology 33:375-383; International Patent Publications WO00 / 28061, WO99 / 61601, WO98 / 11244, WO2013 / 063379, WO2014 / 194132, WO2015 / 121501 and U.S. Patent Nos. 6,156,303 and 7,906,111.

[0050] "rAAV vector" used herein refers to an AAV vector comprising a polynucleotide sequence from a non-AAV source (i.e., a polynucleotide heterologous to AAV), which is generally a sequence of interest for genetic transformation of cells. In some embodiments, the heterologous polynucleotide flank can be at least one, sometimes two AAV terminal inverted repeats (ITRs). The term rAAV vector encompasses rAAV vector particles and rAAV vector plasmids. The rAAV vector can be single-stranded (ssAAV) or self-complementary (scAAV). "AAV virus" or "AAV virus particle" or "rAAV vector particle" refers to a virus particle composed of at least one AAV capsid protein (usually composed of all capsid proteins of wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene for delivery to mammalian cells), it is generally referred to as "rAAV vector particle" or simply "rAAV vector". Therefore, the production of rAAV particles necessarily includes the production of rAAV vectors, because such vectors are contained in rAAV particles.

[0051] "Vector" refers to a recombinant plasmid or virus comprising a polynucleotide to be delivered to a host cell (in vitro or in vivo).

[0052] As used herein, "recombinant" means that the vector, polynucleotide, polypeptide or cell is the product of various combinations of cloning, restriction or ligation steps and / or other procedures (e.g., related to the polynucleotide or polypeptide contained therein), which produce a construct different from that found in nature. A recombinant virus or vector is a viral particle containing a recombinant polynucleotide. These terms include copies of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0053] "Recombinant viral vector" refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (ie, polynucleotide sequences of non-viral origin).

[0054] "Recombinant" as applied to an AAV particle means that the AAV particle is the product of one or more procedures that produce an AAV particle construct that is qualitatively different from the AAV particle.

[0055] "AAV Rep" refers to AAV replication protein and its analogs.

[0056] "AAV Cap" refers to AAV capsid proteins VP1, VP2 and VP3 and their analogs. In wild-type AAV viruses, the three capsid genes vp1, vp2 and vp3 overlap each other. See Grieger and Samulski, 2005, J. Virol. 79 (15): 9933-9944. A single P40 promoter can express all three capsid proteins (vp1, vp2, vp3, respectively) in a ratio of about 1:1:10, which is complementary to rAAV production. For the production of recombinant AAV vectors, the desired ratio of VP1: VP2: VP3 is in the range of about 1:1:1 to about 1:1:100, preferably in the range of about 1:1:2 to about 1:1:50, and more preferably in the range of about 1:1:5 to about 1:1:20. Although the desired ratio of VP1: VP2 is 1:1, the ratio of VP1: VP2 can range from 1:50 to 50:1.

[0057] A complete list and alignment of the amino acid sequences of the capsids of known AAV serotypes is provided in Marsic et al., 2014, Molecular Therapy 22(11):1900-1909, especially Supplementary Figure 1.

[0058] For purposes of illustration only, wild-type AAV2 comprises a small (20-25 nm) icosahedral AAV viral capsid composed of three proteins (VP1, VP2, and VP3; a total of 60 capsid proteins make up the AAV capsid) with overlapping sequences. Proteins VP1 (735 aa; Genbank Accession No. AAC03780), VP2 (598 aa; Genbank Accession No. AAC03778), and VP3 (533 aa; Genbank Accession No. AAC03779) are present in the capsid in a 1:1:10 ratio. That is, for AAV, VP1 is a full-length protein, while VP2 and VP3 are progressively shortened versions of VP1, with increasing degrees of N-terminal truncation relative to VP1.

[0059] "AAVTR" refers to a palindromic terminal repeat sequence located at or near the end of the AAV genome, which mainly comprises complementary symmetrically arranged sequences, including analogs of natural AAVTR and its analogs. In the case of a recombinant parvoviral vector, the recombinant polynucleotide is flanked by at least one, preferably two, inverted terminal repeat sequences (ITR).

[0060] "Cis-motifs" include conserved sequences, such as sequences located at or near the ends of genomic sequences and recognized as initiators of replication; cryptic promoters or sequences at internal locations that may serve for transcription initiation, splicing or termination.

[0061] "Therapeutically effective amount" refers to the minimum amount of an active agent necessary to confer a therapeutic benefit on a subject. For example, for a patient, a "therapeutically effective amount" refers to an amount that induces, improves, stabilizes, slows progression, or otherwise improves pathological symptoms, disease progression, or physiological conditions associated with a disorder, or resists disease.

[0062] "Gene" refers to a polynucleotide containing at least one open reading frame, which is capable of encoding a specific polypeptide or protein after transcription and translation.

[0063] "Coding sequence" refers to a sequence that encodes a specific protein" or "coding nucleic acid", which means a nucleic acid sequence that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of (operably linked to) appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. Coding sequences may include, but are not limited to, cDNA of prokaryotic or eukaryotic mRNA, genomic DNA sequences of prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.

[0064] "Chimeric" with respect to viral capsids or particles means that the capsids or particles include sequences from different parvoviruses, preferably different AAV serotypes, as described in U.S. Pat. No. 6,491,907 to Rabinowitz et al., the disclosure of which is incorporated herein by reference in its entirety. See also Rabinowitz et al., 2004, J. Virol. 78(9):4421-4432. A particularly preferred chimeric viral capsid is an AAV2.5 capsid, which has the sequence of an AAV2 capsid, but has the following mutations: 263Q to A; 265 inserted into T; 705N to A; 708V to A; and 716T to N. The nucleotide sequence encoding such a capsid is defined as SEQ ID NO: 15, as described in WO2006 / 066066. Other preferred chimeric AAVs include, but are not limited to, AAV2i8 described in WO2010 / 093784, AAV2G9 and AAV8G9 described in WO2014 / 144229, and AAV9.45 (Pulicherla et al., 2011, Molecular Therapy 19(6):1070-1078).

[0065] In the case of a sequence flanked by other elements, "flanked by" means that one or more flanking elements are present upstream and / or downstream (i.e., 5' and / or 3') relative to the sequence. The term "flanked by" is not intended to mean that a sequence must be contiguous. For example, there may be intervening sequences between the nucleic acid encoding the transgene and the flanking elements. A sequence (e.g., a transgene) that is "flanked by" two other elements (e.g., TRs) means that one element is located 5' of the sequence and the other element is located 3' of the sequence; however, there may be intervening sequences between them.

[0066] "Polynucleotide" refers to a sequence of nucleotides linked by phosphodiester bonds. Polynucleotides are presented herein in a 5' to 3' direction. The polynucleotides of the present invention may be deoxyribonucleic acid (DNA) molecules or ribonucleic acid (RNA) molecules. When the polynucleotide is a DNA molecule, the molecule may be a gene or a cDNA molecule. Nucleotide bases are represented herein by single letter codes: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I) and uracil (U). The polynucleotides of the present invention may be prepared using standard techniques well known to those skilled in the art.

[0067] Human FMRP or synaptic function modulator FMRI described in UniProtKB-Q06787 (FMRI_human) is a multifunctional polyribosome-associated RNA-binding protein that plays a central role in neuronal development and synaptic plasticity by regulating alternative mRNA splicing, mRNA stability, mRNA dendritic transport, and postsynaptic local protein synthesis of a group of rnRNAs.

[0068] Viral "transduction" of cells refers to the transfer of nucleic acid from the viral particle to the cell.

[0069] "Transfection" of cells refers to the introduction of genetic material into cells to genetically modify the cells. Transfection can be achieved by various methods known in the art (e.g., calcium phosphate, polyethyleneimine, electroporation, etc.).

[0070] "Polypeptide" includes peptides and proteins, unless otherwise indicated.

[0071] "Gene transfer" or "gene delivery" refers to a method or system for reliably inserting foreign nucleic acids (e.g., DNA or RNA) into a host cell. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of the host cell.

[0072] "Transgene" is used to refer to any heterologous nucleotide sequence that is incorporated into a vector (including a viral vector) for delivery to and expression in a target cell (also referred to herein as a "host cell"), and associated expression control sequences, such as a promoter. It will be understood by those skilled in the art that expression control sequences will be selected based on their ability to promote expression of the transgene in the target cell. An example of a transgene is a nucleic acid encoding a therapeutic polypeptide.

[0073] The term "cell culture" refers to cells grown adherently or in suspension in bioreactors, roller bottles, hyperstacks, microspheres, macrospheres, flasks, etc., and the components of the supernatant or suspension itself, including but not limited to rAAV particles, cells, cell debris, cell contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids and lipids, and flocculants. Large-scale methods (e.g., bioreactors), including suspension cultures and adherent cells grown on microcarriers or macrocarriers in stirred bioreactors, are also included in the term "cell culture". The present disclosure encompasses cell culture procedures for large-scale and small-scale production of proteins.

[0074] As used herein, the terms "purifying," "purification," "separate," "separating," "separation," "isolate," "isolating," or "isolation" refer to increasing the purity of rAAV particles from a sample comprising a desired product and one or more impurities. Typically, the purity of a desired product is increased by removing (completely or partially) at least one impurity from a sample. In some embodiments, the purity of rAAV in a sample is increased by removing (completely or partially) one or more impurities from a sample using the methods described herein.

[0075] "Homologous" as used in reference to peptides refers to the amino acid sequence similarity between two peptides. When an amino acid position in two peptides is occupied by the same amino acid, they are homologous at that position. Thus, "substantially homologous" means that the amino acid sequences are largely (but not completely) homologous and retain most or all of the activities of the sequences to which they are homologous.

[0076] As used herein, "substantially homologous" means that the sequence is at least 50% identical to the reference peptide, and preferably at least 75% homologous and more preferably 95% homologous. It includes additional peptide sequence modifications, such as minor changes, deletions, substitutions or derivatizations to the amino acid sequence of the sequences disclosed herein, as long as the peptide has substantially the same activity or function as the unmodified peptide. Derivatives of amino acids may include, but are not limited to, trifluoroleucine, hexafluoroleucine, 5,5,5-trifluoroisoleucine, 4,4,4-trifluorovaline, p-fluorophenylalanine, o-fluorotyrosine, m-fluorotyrosine, 2,3-difluorotyrosine, 4-fluorohistidine, 2-fluorohistidine, 2,4-difluorohistidine, fluoroproline, difluoroproline, 4-hydroxyproline, selenomethionine, tellurylmethionine, selenocysteine, selenotryptophan, 4-aminotryptophan, 5-aminotryptophan, 5- Hydroxytryptophan, 7-azatryptophan, 4-fluorotryptophan, 5-fluorotryptophan, 6-fluorotryptophan, homoallylglycine, homopropargylglycine, 2-butynylglycine, cis-crotonylglycine, allylglycine, dehydroleucine, dehydroproline, 2-amino-3-methyl-4-pentenoic acid, azidohomoalanine, azidoalanine, azidonorleucine, p-ethynylphenylalanine, p-azidophenylalanine, p-bromophenylalanine, p-acetylphenylalanine and benzofuranylalanine. It is noteworthy that the modified peptide will retain the activity or function associated with the unmodified peptide, and the modified peptide generally has an amino acid sequence that is "substantially homologous" to the amino acid sequence of the unmodified sequence.

[0077] In some embodiments, a recombinant human FMR1 construct is provided herein. Other embodiments provided herein include nucleic acid constructs (e.g., vectors) comprising recombinant human FMR1 as part of its sequence. For example, the present invention includes plasmids and / or other vectors comprising recombinant human FMR1 sequences and other elements, such as regulatory elements. In addition, the present invention provides packaged gene delivery vectors (e.g., viral coats) comprising recombinant human FMR1 sequences. The present invention also includes delivery methods, and preferably the recombinant human FMR1 gene is expressed by delivering the modified sequence together with the elements required to promote expression in the cell to the cell. The present invention also provides a gene therapy method in which the recombinant human FMR1 gene sequence is administered to a subject, for example, as a component of a vector and / or packaged as a component of a viral gene delivery vector. Specific embodiments include those having 75% identity of the recombinant human FMR1 sequence to SEQ ID NO:4 (human FMR1 isoform 7). In certain embodiments, the recombinant human FMR1 construct exhibits greater than 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4 (human FMR1 isoform 7).

[0078] Recombinant FMR1 design. More than 20 transcriptional isoforms of human FMR1 have been detected in vivo. Among them, isoform 7 is the most abundant in adult brain tissue. Isoform 7 also lacks exon 12 (due to alternative splicing of human FMR1), and isoforms lacking exon 12 show increased affinity for kissing complex RNA. Therefore, human FMR1 isoform 7 was selected as the transgenic sequence. In the first iteration of recombinant FMR1 construct design, the expression of the transgene was driven by the strong constitutive promoter CBh (cytomegalovirus enhancer, chicken beta actin promoter), and the transcript was stabilized by the ubiquitous polyadenylation signal bGHpA (bovine growth hormone polyadenylation signal). This sequence is described in SEQ ID NO:7. The human FMR1 transgenic expression from this box is poor; it can only be detected above the endogenous level of FMRP in wild-type treated mice. This led to the design of a new recombinant FMR1 construct design, in which the expression of the transgene is driven by a fragment of the endogenous human FMR1 promoter, which is a 1050bp fragment located just upstream of the transcription start site (TSS) and the 5'UTR of FMR1. This 1050bp fragment has a high degree of sequence conservation with other species (including mice and cynomolgus monkeys) and combines the core promoter elements of the human FMR1 gene to drive the expression of the FMR1 transgene with endogenous regulatory elements (elements not present in the constitutive promoter). The transgene is further regulated by the endogenous regulatory elements provided in the 3'UTR. This 1400bp fragment of human FMR1 3'UTR contains putative regulatory elements (including miRNA recognition sites) and the most commonly used polyadenylation signal for FMR1 transcriptional isoforms.

[0079] For example, treatment may be performed to increase FMRP levels in a subject.

[0080] Modified nucleic acids for expressing FMRP

[0081] "Optimized" or "codon optimized" as used interchangeably herein refers to a coding sequence that has been optimized relative to a wild-type coding sequence (e.g., a coding sequence for FMRP) to increase expression of the coding sequence, for example, by minimizing the use of rare codons, reducing the number of CpG dinucleotides, removing cryptic splice donor or acceptor sites, removing Kozak sequences, removing ribosome entry sites, etc.

[0082] As used herein, "codon adaptation index" refers to the degree to which a codon has adapted from a tRNA codon that rarely occurs in a given organism or cell to a tRNA that occurs more frequently in a given organism or cell. A non-limiting example of calculating a codon adaptation index is using the "GenScript Rare Codon Analysis Tool". (genscript.com / tools / rare-codon-analysis).

[0083] "Percent identity" as used herein refers to a numerical score for two given polynucleotides and / or polypeptides having identical nucleic acids and / or amino acids at the same positions, as given by typical sequence comparison programs (ie, BLAST method).

[0084] Codon optimization

[0085] There are sixty-four different codons. Sixty-one of these encode the twenty standard amino acids, while the other three serve as stop codons. The high number of codons relative to the number of amino acids they encode means that a single amino acid can be encoded by multiple codons. In fact, some common amino acids, such as arginine and leucine, are encoded by as many as six codons.

[0086] Different organisms show a preference for using certain codons for the same amino acid. Some species are known to avoid using certain codons almost completely. This preference may affect protein expression. Therefore, in certain embodiments, it is useful to consider codon optimization when designing gene therapy constructs.

[0087] While many factors contribute to the success of protein expression, codon optimization plays a crucial role, especially when the protein is expressed in a heterologous system. For example, if a human gene is to be expressed in E. coli, selecting codons that are preferentially used by the bacteria can improve the success of protein expression. This is especially true when rare codons are eliminated.

[0088] Codon adaptation index

[0089] One option for analyzing codon usage bias is the technical codon adaptation index (CAI). It calculates an index to illustrate how a "foreign" sequence will adapt to the host protein expression machinery. CAI compares the codon usage in the GOI with the most frequent codon usage in a set of highly expressed genes in a model expression organism. The relative adaptability of the codons ranges from 0 to 1, depending on how the GOI relates to a reference set of highly expressed gene sequences, with 1 being the closest.

[0090] Examples of reference codon usage are contained in various databases, including the Codon Usage Database at kazusa.or.jp / codon / .

[0091] Sequence modification

[0092] Examples of modifications include elimination of one or more cis-acting motifs and introduction of one or more Kozak sequences. In one embodiment, one or more cis-acting motifs are eliminated and a Kozak sequence is introduced.

[0093] Examples of cis-acting motifs that can be eliminated include internal TATA boxes; chi sites; ribosome entry sites; ARE, INS and / or CRS sequence elements; repetitive sequences and / or RNA secondary structures; (cryptic) splice donor and / or acceptor sites, branch points; and restriction sites, (e.g., Sall).

[0094] In addition, in certain embodiments, the codon adaptation index of the modified nucleic acid encoding FMRP (i.e., the modified FMR1 gene) is preferably at least 0.74, preferably at least 0.76, more preferably at least 0.77, more preferably at least 0.80, preferably at least 0.82, more preferably at least 0.84, more preferably at least 0.85, more preferably at least 0.89, more preferably at least 0.90, and most preferably at least 0.91.

[0095] In another embodiment, the modified FMR1 sequence has reduced CpG dinucleotide levels, ie, about 10%, 20%, 30%, 50% or more, compared to a wild-type nucleic acid sequence encoding FMR1 (eg, SEQ ID NO: 4).

[0096] It is known that methylation of CpG dinucleotides plays an important role in the regulation of gene expression in eukaryotes. Specifically, methylation of CpG dinucleotides in eukaryotes essentially silences gene expression by interfering with the transcriptional machinery. Therefore, due to gene silencing caused by methylation of CpG motifs, nucleic acids and vectors with reduced numbers of CpG dinucleotides in certain embodiments will provide high and sustained transgene expression levels and may have lower risks of host / subject immune response and / or toxicity.

[0097] In one embodiment, the modified recombinant human FMR1 gene comprises fewer potential CpG dinucleotides than the wild-type FMR1 gene.

[0098] In certain embodiments, the recombinant human FMR1 gene sequence may also include flanking restriction sites to facilitate subcloning into an expression vector. Many such restriction sites are known in the art, including but not limited to Figure 2 Restriction sites are shown in (Plasmid map of hFMP1050-hFMR1-Myc-FMpA1).

[0099] The present disclosure includes nucleic acid vectors that include a recombinant human FMR1 isoform 7 gene sequence and various regulatory or control elements. The exact nature of the regulatory elements used for gene expression will vary depending on the organism and cell type.

[0100] In a particular embodiment, the promoter comprises a 1050 bp fragment of the human FMR1 core promoter (SEQ ID NO:3) (eg, a fragment of the endogenous or "native" core promoter of human FMR1). Suitably, a promoter functionally equivalent to the 1050 bp fragment of the human FMR1 core promoter may be provided.

[0101] In certain embodiments, the promoter comprises a 734 bp fragment of the human core promoter of human FMR1 (SEQ ID NO: 12) (e.g., a fragment of the endogenous or "native" core promoter of human FMR1). Appropriately, a promoter functionally equivalent to the 734 bp fragment of the human core promoter of human FMR1, as well as promoters exhibiting 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity can be provided.

[0102] Typically, a promoter is used that directs the initiation of RNA transcription in the target cell. Promoters can be constitutive or regulated. Constitutive promoters are those that cause the operably linked gene to be expressed essentially all the time. Regulated promoters are those that can be activated or inactivated. Regulated promoters include inducible promoters, which are normally in an "off" state but can be induced to be "on", and "repressible" promoters, which are normally in an "on" state but can be "off". Many different regulatory factors are known, including temperature, hormones, cytokines, heavy metals, and regulatory proteins. These distinctions are not absolute; constitutive promoters are usually subject to some degree of regulation. In some cases, endogenous pathways can be used to regulate transgene expression, for example, using promoters that are naturally downregulated when pathological conditions improve.

[0103] Examples of suitable promoters include adenovirus promoters, such as the adenovirus major late promoter; heterologous promoters, such as the cytomegalovirus (CMV) promoter; respiratory syncytial virus promoter; Rous sarcoma virus (RSV) promoter; albumin promoter; inducible promoters, such as the mouse mammary tumor virus (MMTV) promoter; metallothionein promoter; heat shock promoter; alpha-1-antitrypsin promoter; hepatitis B surface antigen promoter; transferrin promoter; apolipoprotein A-1 promoter; chicken β-actin (CBA) promoter, CBh promoter and CAG promoter (cytomegalovirus early enhancer element and the promoter of the chicken β-actin gene, the first exon and the first intron and the splice acceptor of the rabbit β-globin gene) (Alexopoulou et al., 2008, BioMed. Central Cell Biol.9:2), CBE promoter (cytomegalovirus early enhancer element and chicken β-actin promoter, and the first exon, first intron and second exon of human elongation factor 1α), CBM promoter (cytomegalovirus early enhancer element and chicken β-actin promoter, and the first exon, first intron and second exon of MINIX) and human MECP2 promoter. The promoter can be a tissue-specific promoter (e.g., mouse albumin promoter), which is active in hepatocytes, and thyroxine transporter promoter (TTR). In certain embodiments, a liver off-targeting promoter can be used. Those skilled in the art will appreciate how to utilize and adjust any of these features described herein.

[0104] In another aspect, the recombinant human FMR1 construct also includes an enhancer to increase the expression of protein. Many enhancers are known in the art, including but not limited to the cytomegalovirus major immediate early enhancer. More specifically, the CMV MIE promoter includes three regions: a regulator, a unique region and an enhancer (Isomura and Stinski, 2003, J.Virol.77 (6): 3602-3614). The CMV enhancer region can be combined with other promoters or a portion thereof to form a hybrid promoter to further increase the expression of the nucleic acid operably connected thereto. For example, the chicken beta-actin (CBA) promoter or a portion thereof can be combined with a mixed intron of a CMV promoter / enhancer or a portion thereof and a chicken beta-actin (CBA) and a minute virus of mice (MMV) intron to form a CBA version called a "CBh" promoter, which represents a chicken beta-actin hybrid promoter, as described in Gray et al. (2011, Human Gene Therapy 22: 1143-1153).

[0105] Introns can also be used to improve the efficiency of mammalian expression vectors. Examples of introns are the mouse cytomegalovirus (MCMV) immediate early (IE) promoter, the human cytomegalovirus (HCMV) immediate early (IE) promoter, and the human elongation factor-α (EF-1α) promoter. Introns can vary depending on the target gene.

[0106] In addition, control elements may include a collagen stabilizing sequence (CSS), a stop codon, a termination sequence, and a polyadenylation signal sequence (such as, but not limited to, the bovine growth hormone poly A signal sequence (bGHpA)) to drive the efficient addition of a polyadenylic acid "tail" to the 3' end of a eukaryotic mRNA (see, e.g., Goodwin and Rottman, 1992, J. Biol. Chem. 267(23):16330-16334).

[0107] In a specific embodiment, the recombinant construct comprises an endogenous fragment of the human 3'UTR and a polyadenylation sequence (SEQ ID NO: 5 or SEQ ID NO: 13).

[0108] The poly A tail is a long chain of adenine nucleotides that are added to messenger RNA (mRNA) molecules during RNA processing to increase the stability of the molecule. This is similar to what happens in the body. The poly A tail makes the RNA molecule more stable and prevents it from degradation. In addition, the poly A tail enables the mature messenger RNA molecule to be exported from the cell nucleus and translated into protein by ribosomes in the cytoplasm.

[0109] The woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) can increase transgene expression from a variety of viral vectors. The WPRE is most effective when placed downstream of the transgene, close to the polyadenylation signal. The WPRE can reduce read-through transcription of viral mRNA by improving transcription termination, which in turn increases viral titer and expression. (Gene Therapy Volume 14, pp. 1298-1304 (2007)).

[0110] Non-viral vectors

[0111] In a specific embodiment, the vector used according to the present invention is a non-viral vector. Generally, the non-viral vector can be a plasmid, which includes a nucleic acid sequence containing recombinant human FMR1 or a variant thereof.

[0112] Packaged recombinant FMR1 sequences

[0113] The recombinant human FMR1 gene sequence can also be provided as a component of a packaged viral vector. Generally speaking, a packaged viral vector includes a viral vector packaged in a capsid. The viral vector and the viral capsid will be discussed in subsequent sections. The nucleic acid packaged in the rAAV vector can be single-stranded (ss), self-complementary (sc) or double-stranded (ds). It is expected that a construct comprising any one of SEQ ID NO:2, SEQ ID NO:9 or SEQ ID NO:11 can be packaged and expressed as required.

[0114] Viral vectors

[0115] Typically, a viral vector carrying a transgene is assembled from a polynucleotide encoding the transgene, appropriate regulatory elements, and elements necessary to produce viral proteins that mediate cell transduction. Examples of viral vectors include, but are not limited to, adenovirus, retrovirus, lentivirus, herpes virus, and adeno-associated virus (AAV) vectors.

[0116] The viral vector components of the packaging viral vector produced according to the method of the present invention include at least one transgene (such as a recombinant human FMR1 gene sequence) and a related expression control sequence for controlling the expression of the recombinant human FMR1 gene sequence.

[0117] In a preferred embodiment, the viral vector comprises a portion of the parvoviral genome (e.g., an AAV genome with rep and cap deleted and / or replaced by recombinant human FMR1) and its associated expression control sequences. The recombinant human FMR1 gene sequence is usually adjacent to one or two AAV TR or TR elements and inserted (i.e., flanked by) elements suitable for viral replication (Xiao et al., 1997, J. Virol. 719 (2): 941-948), replacing the nucleic acid encoding the viral rep and cap proteins. Other regulatory sequences suitable for promoting tissue-specific expression of the recombinant human FMR1 gene sequence in target cells may also be included.

[0118] Those skilled in the art will appreciate that AAV vectors containing transgenes and lacking viral proteins (e.g., cap and rep) required for viral replication cannot replicate because these proteins are necessary for viral replication and packaging. In addition, AAV is a dependent virus (Dependovirus) because it cannot replicate in the cell without the co-infection of the cell by a helper virus. Helper viruses typically include adenoviruses or herpes simplex viruses. Alternatively, as discussed below, auxiliary functions (E1a, E1b, E2a, E4, and VA RNA) can be provided to packaging cells (including by transfecting cells with one or more nucleic acids encoding various auxiliary elements) and / or cells can contain nucleic acids encoding auxiliary proteins. For example, HEK 293 is produced by transforming human cells with adenovirus 5 DNA, and now expresses many adenovirus genes, including but not limited to E1 and E3 (see, e.g., Graham et al., 1977, J. Gen. Virol. 36: 59-72). Therefore, these auxiliary functions can be provided by HEK 293 packaging cells without providing them to cells by, for example, plasmids encoding them.

[0119] The viral vector may be any suitable nucleic acid construct, such as a DNA or RNA construct, and may be single-stranded, double-stranded or duplexed (ie, self-complementary as described in WO2001 / 92551).

[0120] Those skilled in the art will appreciate that rAAV vectors may also include a "stuffer" or "filler" sequence (filler / stuffer), wherein the size of the nucleic acid containing the transgene is less than about 4.1 to 4.9 kb in order to optimally package the nucleic acid into the AAV capsid. See Grieger and Samulski, 2005, J. Virol. 79(15):9933-9944. That is, AAV vectors generally accept DNA inserts of a defined size range, which is generally about 4 kb to about 5.2 kb, or slightly larger. Therefore, for shorter sequences, a filler / stuffer sequence is included in the insert to adjust the length to be close to or equal to the normal size of the viral genomic sequence acceptable to the AAV vector for packaging into viral particles. In various embodiments, the filler / stuffer nucleic acid sequence is an untranslated (non-protein coding) nucleic acid segment. In a specific embodiment of the rAAV vector, the length of the heterologous polynucleotide sequence is less than 4.7 Kb, and the length of the filler / filler polynucleotide sequence, when combined with the heterologous polynucleotide sequence (e.g., inserted into a vector), has a total length of between about 3.0-5.5 Kb, or between about 4.0-5.0 Kb, or between about 4.3-4.8 Kb.

[0121] Introns can also be used as fillers / filler polynucleotide sequences to achieve the length of AAV vector packaging into viral particles. Introns and intron fragments used as fillers / filler polynucleotide sequences can also enhance expression. For example, compared with expression without intron elements, the inclusion of intron elements can enhance expression (Kurachi et al., 1995, J.Biol.Chem.270(10):5276-5281). In addition, filler / filler polynucleotide sequences are well known in the art, including but not limited to those described in WO2014 / 144486.

[0122] Virus capsid

[0123] The viral capsid component of the packaging viral vector can be a parvoviral capsid. AAV Cap and chimeric capsids are preferred. Examples of suitable parvoviral capsid components are capsid components from the Parvoviridae family, such as autonomous parvoviruses or dependent viruses. For example, the viral capsid can be an AAV capsid (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9.45, AAVrh10, AAVrh74, RHM4-1 (SEQ ID NO: WO2015 / 013313) NO:5), AAV2-TT, AAV2-TT-S312N, AAV3B-S312N, AAV-LK03, AAVrh10, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV2.GL, AAV2.NN, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and any other AAV now known or later discovered. See, e.g., Fields et al., VIROLOGY, Vol. 2, Chapter 69 (4th ed., Lippincott-Raven Publishers). The capsid may be derived from a variety of AAV serotypes disclosed in U.S. Patent No. 7,906,111; Gao et al., 2004, J. Virol. 78:6381; Moris et al., 2004, Virol. 33:375; WO2013 / 063379; WO2014 / 194132; and includes the true AAV (AAV-TT) variant disclosed in WO2015 / 121501, and RHM4-1, RHM15-1 to RHM15-6 and variants thereof disclosed in WO2015 / 013313, and those skilled in the art know that there may be other variants that have not yet been identified that have the same or similar functions, or may include components from two or more AAV capsids. The complete complement of AAV Cap proteins includes VP1, VP2, and VP3. An ORF comprising a nucleotide sequence encoding an AAV VP capsid protein may contain less than a complete complement of AAV Cap proteins, or may provide a complete complement of AAV Cap protein.

[0124] One or more AAVCap proteins can be chimeric proteins, including amino acid sequences of AAVCaps from two or more viruses (preferably two or more AAVs), as described in U.S. Pat. No. 6,491,907 to Rabinowitz et al., the entire disclosure of which is incorporated herein by reference. For example, a chimeric viral capsid can include an AAV1 Cap protein or subunit and at least one AAV2 Cap or subunit. A chimeric capsid can, for example, include an AAV capsid having one or more B19 Cap subunits, for example, an AAVCap protein or subunit can be replaced by a B19Cap protein or subunit. For example, in a preferred embodiment, the Vp3 subunit of the AAV capsid can be replaced by the Vp2 subunit of B19.

[0125] Another embodiment includes a synthetic chimeric virus strain comprising an AAV backbone from AAV2, AAV3, AAV6, AAV8, etc. in combination with a galactose (Gal) binding footprint from AAV9. Adeno-associated virus (AAV) is a helper-dependent parvovirus that utilizes heparan sulfate (HS), galactose (Gal), or sialic acid (Sia) as primary receptors for cell surface binding. For example, AAV serotypes 2 and 3b utilize HS. AAV1, 4, and 5 bind Sia with different attachment specificities, AAV serotype 6 recognizes both Sia and HS, and AAV9 utilizes Gal for host cell attachment. Specifically, the galactose (Gal) binding footprint of AAV9 is grafted onto the heparin sulfate-binding AAV serotype 2, and the transduction efficiency is improved by grafting only the orthogonal glycan binding footprint. By integrating the Gal binding footprint of AAV9 into the AAV2 VP3 backbone or chimeric AAV2i8 capsid template using structural alignment and site-directed mutagenesis, a new dual glycan binding strain (AAV2G9) and a chimeric muscle-tropic strain (AAV2i8G9) were generated. In vitro binding and transduction assays confirmed that AAV2G9 uses both HS and Gal receptors to enter cells. Subsequent in vivo characterization of transgene expression kinetics and vector genome biodistribution profiles showed that this rationally designed chimeric AAV strain has rapid, sustained and enhanced transgene expression. Similar, improved transduction profiles were observed in liver-detargeted, muscle-specific AAV2i8G9 chimeras (Shen et al., 2013, J. Biol. Chem. 288 (4): 28814-28823). This new transplant combination is fully described in WO2014 / 144229, the contents of which are incorporated herein by reference. Other liver detargeting AAVs (eg, AAV9.45) are described in Pulicherla et al., 2011, Molecular Therapy 19(6): 1070-1078, the contents of which are incorporated herein by reference as if fully set forth in text.

[0126] In yet another embodiment, the present invention provides the use of ancestral AAV vectors in therapeutic in vivo gene therapy. Specifically, computer experimental derived sequences were synthesized from scratch and characterized for biological activity. This attempt resulted in the generation of nine functional putative ancestral AAVs and the identification of Anc80, the predicted ancestor of AAV serotypes 1, 2, 8 and 9 (Zinn et al., 2015, Cell Reports 12: 1056-1068). In addition to being assembled into viral particles, such ancestral sequences can also be predicted and synthesized using the methods described in WO2015 / 054653, the contents of which are incorporated herein by reference. It is noteworthy that viral particles assembled using ancestral viral sequences show reduced sensitivity to pre-existing immunity in today's human populations than contemporary viruses or portions thereof.

[0127] Production of packaged viral vectors

[0128] The present invention includes packaging cells, which are contained in "host cells" that can be cultured to produce the packaged viral vectors of the present invention. The packaging cells of the present invention generally include cells that have heterologous (1) viral vector functions, (2) packaging functions, and (3) helper functions. Each of these component functions will be discussed in subsequent sections.

[0129] Initially, the vector can be prepared by several methods known to those skilled in the art (see, for example, WO2013 / 063379). The preferred method is described in Grieger et al., 2015, Molecular Therapy 24(2): 287-297, the contents of which are incorporated herein by reference for all purposes. In short, the efficient transfection of HEK293 cells is used as a starting point, where adherent HEK293 cell lines from qualified clinical master cell banks are grown in animal component-free suspension conditions in shake flasks and WAVE bioreactors to achieve rapid and scalable rAAV production. Using a triple transfection method (e.g., WO96 / 40240), suspension HEK293 cell lines produce more than 1×10 when harvested 48 hours after transfection. 5 Particles containing vector genomes (vg) / cell or greater than 1×10 14 More specifically, triple transfection refers to packaging cells being transfected with three plasmids: one plasmid encoding AAV rep and cap genes, another plasmid encoding various auxiliary functional proteins (e.g., adenovirus or HSV proteins, such as E1a, E1b, E2a, E4, and VA RNA), and another plasmid encoding a transgene and its various control elements (e.g., a recombinant FMR1 gene and a human endogenous promoter, such as SEQ ID NO: 3).

[0130] To achieve the desired yields, many variables were optimized, such as the selection of a compatible serum-free suspension medium that supports growth and transfection, the choice of transfection reagent, transfection conditions, and cell density. A general purification strategy based on ion exchange chromatography was also developed, resulting in highly pure vector preparations of AAV serotypes 1-6, 8, 9, and various chimeric capsids. This user-friendly process can be completed within one week, resulting in a high ratio of full to empty particles (>90% intact particles), providing post-purification yields suitable for clinical applications (>1×10 13 vg / L) and purity and is universal for all serotypes and chimeric particles. This scalable manufacturing technology has been used to manufacture GMP Phase I clinical AAV vectors for retinal neovascularization (AAV2), hemophilia B (scAAV8), giant axon neuropathy (scAAV9), and retinitis pigmentosa (AAV2), which have been administered to patients. In addition, total vector yield was increased at least 5-fold by implementing a perfusion approach that requires harvesting rAAV from the culture medium at multiple time points after transfection.

[0131] Viral vector function

[0132] The packaging cells of the present invention include viral vector functions as well as packaging and vector functions. The viral vector function typically includes a portion of a parvoviral genome, such as an AAV genome, in which rep and cap are deleted and replaced by a recombinant human FMR1 sequence and its associated expression control sequence. The viral vector function includes sufficient expression control sequences to cause viral vector replication for packaging. Typically, the viral vector includes a portion of a parvoviral genome, such as an AAV genome, in which rep and cap are deleted and replaced by a transgene and its associated expression control sequence. The transgene is typically flanked by two AAVTRs, replacing the deleted viral rep and cap ORFs. Appropriate expression control sequences are included, such as tissue-specific promoters and other regulatory sequences suitable for promoting tissue-specific expression of transgenes in target cells. A transgene is typically a nucleic acid sequence that can be expressed to produce a therapeutic polypeptide or a marker polypeptide.

[0133] "Duplex vectors" may be referred to interchangeably herein as "dimers" or "self-complementary" vectors. Duplex parvoviral particles may, for example, include a parvoviral capsid containing virion DNA (vDNA). vDNA is self-complementary so that it can form a hairpin structure when released from the viral capsid. Duplex vDNA appears to provide double-stranded DNA to the host cell, which can be expressed (i.e., transcribed and optionally translated) by the host cell without the need for second-strand synthesis, whereas conventional parvoviral vectors require second-strand synthesis. Duplex / self-complementary rAAV vectors are well known in the art and are described in, for example, WO2001 / 92551, WO2015 / 006743, and many other documents.

[0134] Viral vector functions can be suitably provided in the form of a duplex vector template, as described in U.S. Pat. No. 7,465,583 to Samulski et al. (the entire disclosure of which is incorporated herein by reference for its teachings on duplex vectors). A duplex vector is a dimeric self-complementary (sc) polynucleotide (usually DNA). The duplex vector genome preferably contains sufficient packaging sequences for packaging within a selected parvoviral capsid (e.g., AAV capsid). Those skilled in the art will appreciate that duplex vDNA may not exist in double-stranded form under all conditions, but has the ability to do so under conditions that are conducive to annealing of complementary nucleotide bases. "Duplex parvoviral particles" include hybrid, chimeric and targeted viral particles. Preferably, the duplex parvoviral particle has an AAV capsid, which can also be a chimeric or targeted capsid, as described above.

[0135] Viral vector functions can be appropriately provided in the form of a duplex vector template, as described in U.S. Pat. No. 7,465,583 to Samulski et al. (the entire disclosure of the patent is incorporated herein by reference for its teachings on duplex vectors). A duplex vector is a dimeric self-complementary (sc) polynucleotide (usually DNA). For example, the DNA of a duplex vector can be selected so that a double-stranded hairpin structure is formed due to intrachain base pairing. Both chains of a duplex DNA vector can be packaged in a viral capsid. A duplex vector provides functions comparable to double-stranded DNA viral vectors, and can alleviate the need for target cells to synthesize single-stranded genomic complementary DNA that is usually encapsulated with viruses.

[0136] The TRs (resolvable and non-resolvable) selected for viral vectors are preferably AAV sequences, with serotypes 1, 2, 3, 4, 5, and 6 being preferred. A resolvable AAV TR need not have a wild-type TR sequence (e.g., the wild-type sequence may be altered by insertion, deletion, truncation, or missense mutation), as long as the TR mediates the desired function, such as viral packaging, integration, and / or proviral rescue. The TR may be a synthetic sequence that functions as an AAV terminal inverted repeat sequence, such as the "double D sequence" described in U.S. Pat. No. 5,478,745 to Samulski et al. (the entire disclosure of which is incorporated herein by reference). Typically, but not necessarily, the TRs are from the same parvovirus, for example, both TR sequences are from AAV2.

[0137] The packaging function comprises a capsid component. The capsid component is preferably from a parvoviral capsid, such as an AAV capsid or a chimeric AAV capsid function. Examples of suitable parvoviral capsid components are capsid components from the Parvoviridae family, such as an autonomous parvovirus or a dependent virus. For example, the capsid component can be selected from AAV capsids, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh10, AAVrh74, RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, RHM15-6, AAV Hu.26, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9.45, AAV2i8, AAV2i9, AAV2i18, AAV2i19, AAV2i2i18, AAV2i19, AAV2i2i19, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18, AAV2i2i18 AAV2-TT-S312N), AAV3B-S312N and AAV-LK03 (see U.S. Pat. No. 10,548,947), as well as other novel capsids that have not yet been identified or are from non-human primate sources. The capsid components may include components from two or more AAV capsids.

[0138] In another embodiment, one or more VP capsid proteins are chimeric proteins comprising amino acid sequences from two or more viruses (preferably two or more AAVs), as described in U.S. Pat. No. 6,491,907 to Rabinowitz et al. Chimeric capsids are described herein as having at least one amino acid residue from one serotype in combination with another serotype sufficient to alter a) viral yield, b) immune response, c) targeting, d) de-targeting, etc.

[0139] Other chimeric proteins can be prepared according to the instructions described in Li et al., 2008, Mol. Ther. 16 (7): 1252-1260, the contents of which are incorporated herein by reference. Specifically, cell type-specific vectors were developed using a DNA shuffling-based approach through directed evolution. The capsid genomes of adeno-associated virus (AAV) serotypes 1-9 were randomly segmented and reassembled using PCR to generate a chimeric capsid library. A separate infectious clone (chimeric-1829) containing genomic fragments from AAV1, 2, 8, and 9 was isolated from an integrin-minus hamster melanoma cell line previously shown to have low tolerance to AAV. Molecular modeling studies have shown that AAV2 contributes to the surface loops of the icosahedral three-fold symmetry axis, while AAV1 and 9 contribute to two-fold and five-fold symmetric interactions, respectively. Through rational mutagenesis, the C-terminal domain (AAV9) was identified as a key structural determinant of melanoma tropism. Chimeric-1829 uses heparin sulfate as the primary receptor and transduces melanoma cells more efficiently than all serotypes. Applying this technology to alternative cell / tissue types using AAV or other viral capsid sequences may yield a new class of biological nanoparticles as vehicles for human gene transfer.

[0140] The packaged viral vector typically includes a recombinant human FMR1 sequence and expression control sequences flanked by TR elements (referred to herein as a "transgene" or "transgene expression cassette") sufficient to result in packaging of the vector DNA and subsequent expression of the modified FMR1 sequence in the transduced cells. The viral vector function can be provided to the cell, for example, as a plasmid or component of an amplicon.

[0141] Viral vector functions can exist extrachromosomally within a cell line and / or can be integrated into the chromosomal DNA of the cell.

[0142] Any method for introducing a nucleotide sequence carrying a viral vector function into a cell host for replication and packaging may be used, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, and a combination of liposomes and nuclear localization signals. In embodiments where viral vector function is provided by using viral vector transfection, standard methods for producing viral infections may be used.

[0143] Packaging function

[0144] The packaging function includes genes for viral vector replication and packaging. Thus, for example, the packaging function may include viral gene expression, viral vector replication, rescue of viral vectors from an integrated state, viral gene expression, and the functions necessary for packaging viral vectors into viral particles as needed. The packaging function may be provided to the packaging cell together or individually using a genetic construct (e.g., a plasmid or amplicon, a baculovirus, or an HSV auxiliary construct). The packaging function may be present outside the chromosome of the packaging cell, but is preferably integrated into the chromosomal DNA of the cell. Examples thereof include genes encoding AAV Rep and Cap proteins.

[0145] rAAV production system

[0146] Many cell culture-based systems are known in the art for producing rAAV particles, any of which can be used to implement the methods disclosed herein. Cell culture-based systems include transfection, stable cell line production, and infectious hybrid virus production systems (among which adenovirus-AAV hybrids, herpes virus-AAV hybrids, and baculovirus-AAV hybrids). The rAAV production culture used to produce rAAV viral particles requires: (1) suitable host cells, including (for example) human cell lines, such as HeLa, A549 or HEK293 cells and their derivatives (HEK293T cells, HEK293F cells), mammalian cell lines, such as Vero, CHO cells or CHO-derived cells, or insect-derived cell lines, such as SF-9 in a baculovirus production system; (2) suitable helper virus functions, provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpes virus, baculovirus or plasmid constructs providing helper functions; (3) AAV rep and cap genes and gene products; (4) a transgene flanked by AAV ITR sequences (such as a therapeutic transgene); and (5) suitable culture medium and culture medium components that support rAAV production.

[0147] Those skilled in the art are aware that AAV rep and cap genes, AAV helper genes (e.g., adenovirus Ela gene, Elb gene, E4 gene, E2a gene, and VA gene), and rAAV genome (comprising one or more target genes flanked by terminal inverted repeats (ITRs)) can be introduced into cells by a variety of methods to produce or package rAAV. The phrase "adenovirus helper function" refers to multiple viral helper genes (as RNA or protein) expressed in cells to enable AAV to grow effectively in cells. Those skilled in the art understand that helper viruses (including adenoviruses and herpes simplex viruses (HSV)) can promote AAV replication, and certain genes have been identified that can provide essential functions, for example, helper viruses can induce changes in the cellular environment to promote such AAV gene expression and replication. In some embodiments, AAV rep and cap genes, helper genes, and rAAV genomes are introduced into cells by transfecting one or more plasmid vectors encoding AAV rep and cap genes, helper genes, and rAAV genomes. In some embodiments, the AAV rep and cap genes, the accessory genes, and the rAAV genome can be introduced into cells by transduction with a viral vector (e.g., an rHSV vector encoding the AAV rep and cap genes, the accessory genes, and the rAAV genome). In some embodiments, one or more of the AAV rep and cap genes, the accessory genes, and the rAAV genome are introduced into cells by transduction with an rHSV vector. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes the accessory genes. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes the accessory genes and the rAAV genome. In some embodiments, the rHSV vector encodes the accessory genes and the AAV rep and cap genes.

[0148] Any suitable culture medium known in the art can be used to produce rAAV particles. These culture media include, but are not limited to, culture media produced by Hyclone Laboratories and JRH, including modified Eagle medium (MEM), Dulbecco's modified Eagle medium (DMEM), and Sf-900IISFM culture medium, as described in U.S. Patent No. 6,723,551, which is incorporated herein by reference in its entirety. In some embodiments, the culture medium includes Dynamis from Invitrogen / ThermoFisher. TM Culture medium, FreeStyle TM 293 Expression Medium or Expi293 TMIn some embodiments, the culture medium includes Dynamis TM Culture medium. In some embodiments, the methods disclosed herein use a cell culture comprising a serum-free culture medium, an animal component-free culture medium, or a chemically defined culture medium. In some embodiments, the culture medium is an animal component-free culture medium. In some embodiments, the culture medium includes serum. In some embodiments, the culture medium includes fetal bovine serum. In some embodiments, the culture medium is a glutamine-free culture medium. In some embodiments, the culture medium includes glutamine. In some embodiments, the culture medium is supplemented with one or more nutrients, salts, buffers, and additives (e.g., defoaming agents). In some embodiments, the culture medium is supplemented with glutamine. In some embodiments, the culture medium is supplemented with serum. In some embodiments, the culture medium is supplemented with fetal bovine serum. In some embodiments, the culture medium is supplemented with poloxamers, e.g. P188Bio. In some embodiments, the culture medium is a basal medium. In some embodiments, the culture medium is a feed medium.

[0149] rAAV production cultures can be routinely grown under a variety of conditions appropriate to the particular host cells used (over a wide temperature range, for varying lengths of time, etc.). As is known in the art, rAAV production cultures include attachment-dependent cultures, which can be cultured in suitable attachment-dependent containers (e.g., roller bottles, hollow fiber filters, multi-layer or multi-tray tissue culture flasks (or stacks, such as superstacks), microcarriers, and packed bed or fluidized bed bioreactors. rAAV vector production cultures can also include suspension-adapted host cells, such as HeLa cells, HEK293 cells, HEK293-derived cells (e.g., HEK293T cells, HEK293F cells), Vero cells, CHO cells, CHO-K1 cells, CHO-derived cells, EB66 cells, BSC cells, HepG2 cells, LLC-MK cells, CV-1 cells, COS cells, MDBK cells, MDCK cells, CRFK cells, RAF cells, RK cells, TCMK-1 cells, LLPK cells, PK15 cells, LLC-RK cells, MDOK cells, BHK cells, BHK-21 cells, NS-1 cells, MRC-5 cells, WI-38 cells, BHK cells, 3T3 cells, 293 cells, RK cells, Per.C6 cells, chicken embryo cells and SF-9 cells, which can be cultured in a variety of ways, including (for example) spinner flasks, stirred tank bioreactors and disposable systems (e.g., Wave bag systems). A variety of suspension cultures are known in the art for producing rAAV particles, including, for example, those disclosed in U.S. Patent Nos. 6,995,006, 9,783,826, and U.S. Patent Application Publication No. 20120122155, each of which is herein incorporated by reference in its entirety.

[0150] Packaging cells

[0151] Any cell or cell line known in the art to produce rAAV particles can be used in any of the methods disclosed herein. In some embodiments, the methods for producing rAAV particles or increasing rAAV particle production disclosed herein use HeLa cells, HEK293 cells, HEK293-derived cells (e.g., HEK293T cells, HEK293F cells), Vero cells, CHO cells, CHO-K1 cells, CHO-derived cells, EB66 cells, BSC cells, HepG2 cells, LLC-MK cells, CV-1 cells, COS cells, MDBK cells, MDCK cells, CRFK cells, RAF cells, RK cells, TCMK-1 cells, LLPK cells, PK15 cells, LLC-RK cells, MDOK cells, BHK cells, BHK-21 cells, NS-1 cells, MRC-5 cells, WI-38 cells, BHK cells, 3T3 cells, 293 cells, RK cells, Per.C6 cells, chicken embryo cells, or SF-9 cells. In some embodiments, the methods disclosed herein use mammalian cells. In some embodiments, the methods disclosed herein use insect cells, such as SF-9 cells. In some embodiments, the methods disclosed herein use HEK293 cells. In some embodiments, the methods disclosed herein use HEK293 cells suitable for suspension culture growth.

[0152] In some embodiments, the cell culture disclosed herein is a suspension culture. In some embodiments, the cell culture disclosed herein is a suspension culture comprising HEK293. In some embodiments, the cell culture disclosed herein is a suspension culture comprising HEK293 cells suitable for suspension culture growth. In some embodiments, the cell culture disclosed herein comprises a serum-free medium, an animal component-free medium, or a chemically defined medium. In some embodiments, the cell culture disclosed herein comprises a serum-free medium. In some embodiments, the suspension-adapted cells are cultured in a shake flask, a spinner flask, a cell bag, or a bioreactor.

[0153] In some embodiments, the cell cultures disclosed herein include cells attached to a substrate (eg, microcarriers), which are themselves suspended in a culture medium. In some embodiments, the cells are HEK293 cells.

[0154] In some embodiments, the cell culture disclosed herein is an adherent culture. In some embodiments, the cell culture disclosed herein is an adherent culture comprising HEK293. In some embodiments, the cell culture disclosed herein comprises a serum-free medium, an animal component-free medium, or a chemically defined medium. In some embodiments, the cell culture disclosed herein comprises a serum-free medium.

[0155] In some embodiments, the cell culture disclosed herein comprises a high-density cell culture. In some embodiments, the total cell density of the culture is between about 1x10E+06 cells / ml and about 30x10E+06 cells / ml. In some embodiments, more than about 50% of the cells are living cells. In some embodiments, the cell is a HeLa cell, a HEK293 cell, a HEK293 derived cell (e.g., a HEK293T cell, a HEK293F cell), a Vero cell or a SF-9 cell. In a further embodiment, the cell is a HEK293 cell. In a further embodiment, the cell is a HEK293 cell suitable for suspension culture growth.

[0156] Cell lines used as packaging cells include insect cell lines. According to the present invention, any insect cell that allows AAV replication and can be maintained in culture can be used. Examples include fall armyworm (e.g., Sf9 or Sf21 cell lines), Drosophila cell lines, or mosquito cell lines, such as Aedes albopictus derived cell lines. The preferred cell line is the fall armyworm Sf9 cell line. The following references are incorporated herein for their teachings on the use of insect cells to express heterologous polypeptides, methods for introducing nucleic acids into such cells, and methods for maintaining such cells in culture: Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., 1989, J. Virol. 63: 3822-3828; Kajigaya et al., 1991, Proc. Nat'l. Acad. Sci. USA 88:4646-4650; Ruffing et al., 1992, J. Virol. 66:6922-6930; Kimbauer et al., 1996, Virol. 219:37-44; Zhao et al., 2000, Virol. 272:382-393; and Samulski et al., U.S. Patent No. 6,204,059.

[0157] For example, the viral capsids used in the embodiments described herein can be produced using any method known in the art, such as by baculovirus expression (Brown et al., (1994) Virology 198: 477-488). Alternatively, the viral vectors of the invention can be produced in insect cells using baculovirus vectors to deliver the rep / cap genes and rAAV templates, for example, as described in Urabe et al., 2002, Human Gene Therapy 13: 1935-1943.

[0158] On the other hand, methods for producing rAAV in insect cells are provided herein, wherein a baculovirus packaging system or vector can be constructed to carry AAV Rep and Cap coding regions by the following methods: these genes are transformed into the polyhedral coding region of the baculovirus vector, and viral recombinants are produced by transfection into host cells. It is noteworthy that when baculovirus is used to produce AAV (preferably, AAV DNA), the vector product is a self-complementary AAV-like molecule without using AAV ITR mutations. This appears to be a byproduct of the ineffective AAV rep nicking in insect cells, resulting in self-complementary DNA molecules due to the lack of functional Rep enzyme activity. The host cell is a baculovirus-infected cell, or additional nucleic acids encoding baculovirus helper functions have been introduced into it, or these baculovirus helper functions are contained therein. These baculoviruses can express AAV components and then promote the production of capsids.

[0159] During the production process, packaging cells typically include one or more viral vector functions and auxiliary functions and packaging functions sufficient to cause viral vector replication and packaging. These various functions can be provided to packaging cells together or separately using genetic constructs (e.g., plasmids or amplicons), and they can exist outside the chromosomes of the cell line or integrated into the chromosomes of the cell.

[0160] The cell may have any one or more of the functions integrated, for example, a cell line with one or more vector functions integrated extrachromosomally or into the chromosomal DNA of the cell, a cell line with one or more packaging functions integrated extrachromosomally or into the chromosomal DNA of the cell, or a cell line with helper functions integrated extrachromosomally or into the chromosomal DNA of the cell.

[0161] rAAV purification

[0162] The rAAV particles produced can be separated using methods known in the art. In some embodiments, the method of separating rAAV particles includes downstream processing, for example, harvesting cell culture, clarifying harvested cell culture (for example, by centrifugation or deep filtration), tangential flow filtration, affinity chromatography, anion exchange chromatography, cation exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography, sterile filtration or any combination thereof. In some embodiments, downstream processing includes at least 2, at least 3, at least 4, at least 5 or at least 6 of the following: harvesting cell culture, clarifying harvested cell culture (for example, by centrifugation or deep filtration), tangential flow filtration, affinity chromatography, anion exchange chromatography, cation exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography and sterile filtration. In some embodiments, downstream processing includes harvesting cell culture, clarifying harvested cell culture (for example, by deep filtration), sterile filtration, tangential flow filtration, affinity chromatography and anion exchange chromatography. In some embodiments, downstream processing includes clarifying the harvested cell culture, sterile filtration, tangential flow filtration, affinity chromatography, and anion exchange chromatography. In some embodiments, downstream processing includes clarifying the harvested cell culture by depth filtration, sterile filtration, tangential flow filtration, affinity chromatography, and anion exchange chromatography. In some embodiments, clarifying the harvested cell culture includes sterile filtration. In some embodiments, downstream processing does not include centrifugation.

[0163] In some embodiments, the method of isolating rAAV particles comprises harvesting a cell culture, clarifying the harvested cell culture (e.g., by depth filtration), a first sterile filtration, a first tangential flow filtration, an affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), a second tangential flow filtration, and a second sterile filtration. In some embodiments, the method of isolating rAAV particles disclosed herein comprises harvesting a cell culture, clarifying the harvested cell culture (e.g., by depth filtration), a first sterile filtration, an affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), tangential flow filtration, and a second sterile filtration. In some embodiments, the method of isolating rAAV particles comprises clarifying the harvested cell culture, a first sterile filtration, a first tangential flow filtration, an affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), a second tangential flow filtration, and a second sterile filtration. In some embodiments, the method for separating rAAV particles disclosed herein includes clarifying the harvested cell culture, a first sterile filtration, affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), tangential flow filtration, and a second sterile filtration. In some embodiments, the method for separating rAAV particles includes clarifying the harvested cell culture by deep filtration, a first sterile filtration, a first tangential flow filtration, affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), a second tangential flow filtration, and a second sterile filtration. In some embodiments, the method for separating rAAV particles disclosed herein includes clarifying the harvested cell culture by deep filtration, a first sterile filtration, affinity chromatography, anion exchange chromatography (e.g., monolithic anion exchange chromatography or AEX chromatography using a quaternary amine ligand), tangential flow filtration, and a second sterile filtration. In some embodiments, the method does not include centrifugation. In some embodiments, clarifying the harvested cell culture includes sterile filtration.

[0164] Recombinant AAV particles can be harvested from rAAV production cultures by harvesting production cultures containing host cells or by harvesting spent culture medium from production cultures, provided that the cells are cultured under conditions known in the art to promote the release of rAAV particles from intact host cells into the culture medium. Recombinant AAV particles can also be harvested from rAAV production cultures by lysing host cells of the production culture. Suitable methods for lysing cells are also known in the art and include, for example, multiple freeze-thaw cycles, sonication, microfluidization, and treatment with chemicals (e.g., detergents and / or proteases).

[0165] At harvest, the rAAV production culture may contain one or more of the following: (1) host cell proteins; (2) host cell DNA; (3) plasmid DNA; (4) helper virus; (5) helper virus proteins; (6) helper virus DNA; and (7) culture medium components, including, for example, serum proteins, amino acids, transferrin, and other low molecular weight proteins. The rAAV production culture may also contain product-related impurities, such as inactivated vector forms, empty viral capsids, aggregated viral particles or capsids, misfolded viral capsids, and degraded viral particles.

[0166] In some embodiments, the rAAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtering through a series of depth filters. Clarification can also be achieved by various other standard techniques known in the art, for example, centrifugation or filtering through any cellulose acetate filter with a pore size of 0.2 mm or greater known in the art. In some embodiments, clarifying the harvested cell culture comprises sterile filtration. In some embodiments, the production culture harvest is clarified by centrifugation. In some embodiments, clarifying the production culture harvest does not include centrifugation.

[0167] In some embodiments, the harvested cell culture is clarified using filtration. In some embodiments, clarifying the harvested cell culture comprises depth filtration. In some embodiments, clarifying the harvested cell culture further comprises depth filtration and sterile filtration. In some embodiments, the harvested cell culture is clarified using a filter set comprising one or more different filter media. In some embodiments, the filter set comprises a depth filtration medium. In some embodiments, the filter set comprises one or more depth filtration media. In some embodiments, the filter set comprises two depth filtration media. In some embodiments, the filter set comprises a sterile filtration medium. In some embodiments, the filter set comprises 2 depth filtration media and one sterile filtration medium. In some embodiments, the depth filtration medium is a porous depth filter. In some embodiments, the filter set comprises 20MS, COHC and sterile grade filter media. In some embodiments, the filter set comprises 20MS, COHC and 2XLG 0.2pm. In some embodiments, the harvested cell culture is pretreated before contacting it with the depth filter. In some embodiments, the pretreatment comprises adding salt to the harvested cell culture. In some embodiments, the pretreatment comprises adding a chemical flocculant to the harvested cell culture. In some embodiments, the harvested cell culture is not pretreated before contacting it with the depth filter.

[0168] In some embodiments, the clarified feed is concentrated by tangential flow filtration ("TFF") before being applied to a chromatography medium (e.g., an affinity chromatography medium). Paul et al., Human Gene Therapy 4:609-615 (1993) describes the large-scale concentration of viruses using TFF ultrafiltration. The TFF concentration of the clarified feed enables the clarified feed to be chromatographed with a technically controllable volume, and allows the size of the column to be determined more rationally without a long recirculation time. In some embodiments, the clarified feed is concentrated at least twice to at least ten times. In some embodiments, the clarified feed is concentrated at least ten times to at least twenty times. In some embodiments, the clarified feed is concentrated at least twenty times to at least fifty times. In some embodiments, the clarified feed is concentrated about twenty times. Those of ordinary skill in the art will also recognize that TFF can also be used to remove small molecule impurities (e.g., cell culture contaminants comprising culture medium components, serum albumin or other serum proteins) from the clarified feed by diafiltration. In some embodiments, the clarified feed is diafiltered to remove small molecule impurities. In some embodiments, the diafiltration comprises using between about 3 and about 10 diafiltration volumes of buffer. In some embodiments, the diafiltration comprises using about 5 diafiltration volumes of buffer. One of ordinary skill in the art will also recognize that TFF can also be used for any step in the purification process where it is necessary to exchange the buffer prior to performing the next step in the purification process. In some embodiments, the methods disclosed herein for separating rAAV from a clarified feed comprise using TFF to exchange the buffer.

[0169] Affinity chromatography can be used to separate rAAV particles from a composition. In some embodiments, affinity chromatography is used to separate rAAV particles from a clarified feed. In some embodiments, affinity chromatography is used to separate rAAV particles from a clarified feed that has been subjected to tangential flow filtration. Suitable affinity chromatography media are known in the art and include, but are not limited to, AVB Sepharose. TM 、POROS TM CaptureSelect TM AAVX affinity resin, POROS TM CaptureSelect TM AAV9 affinity resin and POROS TM CaptureSelect TM AAV8 affinity resin. In some embodiments, the affinity chromatography medium is POROS TM CaptureSelect TM AAV9 affinity resin. In some embodiments, the affinity chromatography medium is POROS TM CaptureSelectTM AAV8 affinity resin. In some embodiments, the affinity chromatography medium is POROS TM CaptureSelect TM AAVX Affinity Resin.

[0170] Anion exchange chromatography can be used to separate rAAV particles from the composition. In some embodiments, anion exchange chromatography is used as the final concentration and refining step after affinity chromatography. Suitable anion exchange chromatography media are known in the art, including but not limited to: Unosphere Q (Biorad, Hercules, Calif.) and N-charged amino or imino resins, such as POROS 50PI, or any DEAE, TMAE, tertiary amine or quaternary amine, or PEI-based resins known in the art (U.S. Patent No. 6,989,264; Brument et al., Mol. Therapy 6 (5): 678-686 (2002); Gao et al., Hum. Gene Therapy 11: 2079-2091 (2000)). In some embodiments, the anion exchange chromatography medium comprises a quaternary amine. In some embodiments, the anion exchange medium is a monolithic anion exchange chromatography resin. In some embodiments, the monolithic anion exchange chromatography medium comprises glycidyl methacrylate-ethylene dimethacrylate or styrene-divinylbenzene polymer. In some embodiments, the monolithic anion exchange chromatography medium is selected from CIMmultus TM QA-l advanced composite column (quaternary amine), CIMmultus TM DEAE-1 advanced composite column (diethylamino), QA Disk (quaternary amine), DEAE and In some embodiments, the monolithic anion exchange chromatography medium is CIMmultus TM QA-1 Advanced Composite Column (Quaternary Amide). In some embodiments, the monolithic anion exchange chromatography medium is QA Disk (quaternary amine). In some embodiments, the anion exchange chromatography medium is CIM QA (BIA Separations, Slovenia). In some embodiments, the anion exchange chromatography medium is BIA QA-80 (column volume 80 ml). One of ordinary skill in the art will appreciate that a wash buffer having an appropriate ionic strength can be identified so that the rAAV remains bound to the resin while removing impurities (including but not limited to impurities that may have been introduced by upstream purification steps).

[0171] In additional embodiments, the present disclosure provides a composition comprising an isolated rAAV particle produced according to the methods disclosed herein. In some embodiments, the composition is a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

[0172] The term "pharmaceutically acceptable" as used herein refers to a biologically acceptable gaseous, liquid or solid formulation, or a mixture thereof, which is suitable for one or more routes of administration, in vivo delivery or contact. A "pharmaceutically acceptable" composition is a material that has no adverse effects biologically or otherwise, for example, the material can be applied to a subject without causing significant adverse biological effects. Therefore, such a pharmaceutical composition can be used, for example, to apply rAAV separated according to the disclosed method to a subject. Such a composition comprises a solvent (aqueous or non-aqueous), a solution (aqueous or non-aqueous), an emulsion (e.g., water-in-oil or oil-in-water), a suspension, a syrup, an elixir, a dispersion and suspension medium, a coating, an isotonic and absorption promoter or a delaying agent that is compatible with drug administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions and suspensions may contain suspending agents and thickening agents. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard capsules or soft capsules), microbeads, powders, granules and crystals. Supplementary active compounds (e.g., preservatives, antibacterials, antivirals, and antifungals) may also be added to the composition. The pharmaceutical composition may be formulated to be compatible with a particular administration or delivery route, as described herein or known to those skilled in the art. Therefore, the pharmaceutical composition comprises a carrier, diluent, or excipient suitable for administration by a variety of routes.

[0173] Pharmaceutical compositions and delivery systems suitable for use with rAAV particles and methods and uses of the invention are known in the art (e.g., see Remington: The Science and Practice of Pharmacy (2003) 20th ed., Mack Publishing Co., Easton, Pa.; Remington's Pharmaceutical Sciences (1990) 18th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12th ed., Merck Publishing Group, Whitehouse, NJ; Pharmaceutical Principles of Solid Dosage Forms (1993), Technonic Publishing Co., Inc., Lancaster, Pa.; Ansel and Stoklosa, Pharmaceutical Calculations (2001) 11th ed., Lippincott Williams & Wilkins, Baltimore, Md.; and Poznansky et al., Drug Delivery Systems (2003) 11th ed., Lippincott Williams & Wilkins, Baltimore, Md.; and Poznansky et al., Drug Delivery Systems (2003) 11th ed., Lippincott Williams & Wilkins, Baltimore, Md.). Systems (1980), RL Juliano, ed., Oxford, NY, pp. 253-315).

[0174] As described herein, recombinant polynucleotide constructs and rAAV can be used as gene therapy to treat fragile X disorders or related disorders associated with a lack of FMRP. The method of treatment comprises injecting any rAAV described herein into a subject in need thereof. One skilled in the art will appreciate the amount required to treat a subject, as it depends on a variety of factors, including the size, age, and sex of the subject.

[0175] Treatment

[0176] In another aspect, a method of treatment is provided, which comprises administering to a patient in need thereof an effective amount of a pharmaceutical composition comprising any desired construct or rAAV virion described above.

[0177] In some embodiments, the effective amount is at least 1×10 8 viral genomes / dose. In some embodiments, the effective amount is at least 5×10 8 Viral genomes / dose, 7.5×10 8 Viral genomes / dose, at least 1×10 9Viral genomes / dose, at least 2.5×10 9 Viral genomes / dose, at least 5×10 9 Viral genomes / dose.

[0178] In some embodiments, the effective amount is at least 1×10 11 viral genomes / kg patient weight, at least 5×10 11 viral genomes / kg, at least 1×10 12 viral genomes / kg, at least 5×10 12 Viral genomes / kg, at least 1×10 13 viral genomes / kg, at least 1×10 14 viral genomes / kg, or at least 5×10 14 In some embodiments, rAAV is dosed based on brain weight rather than body weight. In some embodiments, rAAV doses are contemplated to be low doses and are particularly beneficial for CNS indications.

[0179] In some embodiments, the rAAV is administered intravenously. In some embodiments, the rAAV is administered intrathecally. In some embodiments, the rAAV is administered by intraventricular injection. In some embodiments, the rAAV is administered by intracisternal administration. In some embodiments, the rAAV is administered by intravitreal injection.

[0180] In various embodiments, a method of treating FXS and related disorders in a subject is disclosed, wherein the method comprises administering to the subject an effective amount of any polynucleotide construct described herein, or a vector, or a rAAV comprising a vector, or a virion, or any pharmaceutical composition comprising any of these elements described herein. Example

[0181] The following are examples of specific embodiments of the present invention. These examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should certainly be allowed.

[0182] The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, which are within the skill of the art and are fully explained in the literature.

[0183] Example 1 Optimization of recombinant FMR1 construct

[0184] Figure 1 shows the Figure 1A) an FMR1 construct driven by expression of the constitutive CBh promoter (SEQ ID NO: 7), and ( Figure 1B ) Low-level transgenic FMRP expression observed by immunohistochemistry analysis 70 days after injection into P0-2 wild-type mice by ICV delivery. AAV9-CBh-hFMR1-Myc-bGHpA was delivered at two different doses and FMRP levels compared to vehicle-treated wild-type mice.

[0185] Figure 2-3 An exemplary FMR1 construct design and plasmid containing the endogenous promoter and 3'UTR fragment are shown. The sequence of the FMR1 construct containing hFMP1050-hFMR1-Myc-FMpA1 is SEQ ID NO: 2. The sequence of the plasmid containing the hFMP1050-hFMR1-Myc-FMpA1 construct is SEQ ID NO: 1.

[0186] It is predicted that a 1050 bp fragment of the human FMR1 promoter and 5'UTR located just upstream of the ATG codon in exon 1 contains most of the key genetic regulatory elements required for near endogenous regulation of FMR1 transgenic expression. The 1050 bp fragment (SEQ ID NO: 3) includes: CpG islands in the core promoter region, transcription factor binding sites, cis-regulatory elements identified by ENCODE, H3K27Ac, ​​and regulatory elements from the Open Regulatory Annotation Database (ORegAnno) ( Fig.13 ). The H3K27Ac mark represents an epigenetic modification of the DNA packaging protein histone H3 and is therefore defined as an active enhancer mark. The regulatory elements from ORegAnno represent the main DNase clusters and key conserved transcription factor binding sites in this genomic region. No such elements were found in the genomic region upstream of the 1050 bp promoter fragment. In addition, the 1050 bp promoter fragment (SEQ ID NO: 3) is well conserved between humans and mice, indicating that this region contains important conserved sequences ( Fig.14 ). Therefore, the 1050 bp fragment in the FMR1 promoter region (SEQ ID NO: 3) is able to recapitulate the endogenous FMR1 promoter in driving the expression of FMR1 in the brain. Fig. 9A -H shows FMR1 expression detected in various brain regions (cortex, hippocampus, thalamus, hypothalamus) under the control of the hFMP1050 promoter fragment (hFMP1050-hFMR1-Myc-FMpA1) (SEQ ID NO: 2).

[0187] Example 2 Data from evaluation of behavioral phenotypes and immunoblotting to localize FMRP in brain tissue samples

[0188] Figure 4 Shown is the result of testing FMR1 after administration with AAV9-hFMP1050-hFMR1-Myc-FMpA1. - / y Schematic diagram of the experimental design and various phenotypic analyses in FMR1 mice - / y FMR1 expression in mice is controlled by the hFMP1050 promoter fragment (SEQ ID NO: 2). At week 0, AAV9-hFMP1050-hFMR1-Myc-FMpA1 was administered to each mouse by intracerebroventricular injection (ICV). The mice were allowed to develop for 8 weeks. Starting from week 3, the mice were monitored for general weight changes. At week 8, the mice were evaluated by various behavioral assays: open field assay on day 1; marble burying assay on day 2; elevated plus maze (EPM) assay on day 3; audiogenic epilepsy assay on day 5. Tissues from individual mice were collected for histological evaluation. The results are shown in Figures 5-6.

[0189] Figure 5A -B shows FMR1 in cells receiving different doses of AAV9-hFMP1050-hFMR1-Myc-FMpA1 - / y Significant therapeutic effect on marble burying in mice. Figure 5A As shown, compared with wild-type (WT) mice, FMR1 - / y The mutant mice showed a significantly higher (p < 0.0001, Mann-Whitney test) tendency to marble burying behavior. The expression of hFMR1 in the mutant mice significantly reduced the marble burying behavior in a dose-dependent manner ( Figure 5B The data showed that AAV9-hFMP1050-hFMR1-Myc-FMpA1 at a dose of 1e11 vg / mouse (p value) was sufficient to significantly reduce marble behavior (p = 0.0004, Kruskal-Wallis test with Dunn's post hoc analysis), and the therapeutic effect was further enhanced at a higher dose (3e11 vg / mouse) (p = 0.0024, Kruskal-Wallis test with Dunn's post hoc analysis).

[0190] Fig. 6A -C indicates ( Fig. 6A ) in FMR1 - / y Strong genotype effects observed in mouse models of audiogenic epilepsy; Figure 6B -C) Therapeutic effect of treatment with AAV9-hFMP1050-hFMR1-Myc-FMpA1 (virus). Figure 6B It is shown that in FMR1 - / yIn mutant mice, treatment with AAV9-hFMP1050-hFMR1-Myc-FMpA1 at a dose of 5e10 vg / mouse significantly reduced the incidence of epileptic seizures (p=0.0554, Fisher's exact test). The therapeutic effect was more pronounced at higher doses of 1e11 or 3e11 vg / mouse (p<0.0001, Fisher's exact test). Figure 6C It was shown that at the highest dose (3e11 vg / mouse) of AAV9-hFMP1050-hFMR1-Myc-FMpA1, clonic and tonic seizures disappeared, while the seizure rate in the control group (animals treated with vehicle) was 81%.

[0191] Figure 7 Wild-type (WT) and FMR1 mice dosed with vehicle or 5E10 vg / mouse of AAV9-AAV9-hFMP1050-hFMR1-Myc-FMpA1 are shown. - / y Immunoblot data of the cortex, hippocampus, and thalamus of (KO) mice. Transgenic FMRP was detected in the cortex and hippocampus after administration of 5E10 vg / mouse of AAV9-AAV9-hFMP1050-hFMR1-Myc-FMpA1. Myc expression was used as a positive control.

[0192] Fig. 8A -B shows wild-type (WT) and FMR1 treated with increasing doses of AAV9-hFMP1050-hFMR1-Myc-FMpA1. - / y Quantification of FMRP expression levels in the cortex of WT (KO) mice. At a dose of 1e11 vg / mouse, FMRP expression levels were significantly higher in the cortex of WT treated mice ( Fig. 8A ) and in FMR1 - / y FMRP expression was detected in (KO) treated mice ( Figure 8B ).

[0193] Fig. 9A -H shows immunohistochemical analysis of transgenic FMRP expression in different brain regions of mice 170 days after injection with AAV9-hFMP1050-hFMR1-myc-FMpA. Wild-type (WT) and FMR1 mice were treated by ICV delivery of 1E11 vg / mouse at P0-2. - / y Mouse. In the cortex ( Fig. 9B ) and hippocampus ( Fig.9D FMRP expression was detected in the Figure 7 The detection of FMRPex in the immunoblot data is consistent.

[0194] Fig. 10A -D shows the FMR1 - / yIncreased FMRP expression in mice delivered with AAV9-hFMP1050-hFMR1-Myc-FMpA1 containing SEQ ID NO: 2. Representative sagittal whole-brain micrographs immunolabeled for FMRP (green) from ( Fig. 10A ) vehicle-treated WT mice, ( Fig. 10B ) Vehicle-treated FMR1 - / y Mouse, ( Fig. 10C -D) AAV9-hFMP1050-hFMR1-Myc-FMpA1 was used at 1E11 vg / mouse ( Fig. 10C ) or 3E11vg / mouse ( Fig. 10D ) doses of FMR1 - / y Mouse. Scale bar represents 1 mm.

[0195] Example 3: Further modified FMR1 constructs and elements

[0196] Fig.11 Schematic of an FMR1 construct design that combines a 1050 bp fragment of the endogenous FMR1 promoter (hFMP1050), a fragment of the human wild-type FMR1 sequence encoding isoform 7 (hFMR1), and the endogenous 3'UTR fragment of human FMR1 (FMpA1). This construct lacks a Myc tag and is an exemplary therapeutic FMR1 construct. Fig.12 Schematic representation of the plasmid FMR1 construct comprising the hMP1050-FMR1-FMpA1 construct flanked by wild-type AAV2 inverted terminal repeats (ITRs).

[0197] Modified FMR1 gene therapy constructs were designed to include additional regulatory elements identified in the 3'UTR of human FMR1. The new 3'UTR fragment designated FMpA2 (SEQ ID NO: 13) is an extended version of FMpA1 containing an additional 181 bp of human 3'UTR sequence (including putative CNS enhancer elements).

[0198] To generate a construct that can still be packaged in single-stranded AAV, a 1050 bp fragment of the FMR1 promoter was truncated. Most of the key transcription factor binding sites and CNS-associated DNAse sites showing enhancer-like activity are present in a 734 bp fragment of the FMR1 promoter (SEQ ID NO: 12; also including the 5'UTR just upstream of the FMR1 coding sequence). Fig.13 The FMR1 promoter region in the UCSC genome browser is shown. The 1050 bp fragment contains most of the key genetic regulatory elements required for endogenous expression and regulation of FMR1 in this genomic region. Fig.14Shown is a dot plot generated by EMBOSS Dotmatcher comparing human (hum) and mouse (mus) sequences in the genomic region upstream of the FMR1 coding region, including a 1050 bp fragment of the promoter.

[0199] The selected truncated FMR1 promoter region was the hMP734 promoter fragment, which was combined with the FMpA2 3'UTR sequence to generate the hFMP734-hFMR1-FMpA2 construct (SEQ ID NO: 11) to drive and regulate the expression of FMRP. Fig.15 As shown, the hFMP734-hFMR1-FMpA2 construct (SEQ ID NO: 11) contains a 734 bp fragment of the endogenous FMR1 promoter (hFMP734), the human wild-type FMR1 sequence encoding isoform 7 (hFMR1), and a fragment of the endogenous 3'UTR of human FMR1 (FMpA2). Fig.16 Shown is the hMP734-FMR1-FMpA2 plasmid (SEQ ID NO: 10), which contains the hMP734-FMR1-FMpA2 construct flanked by wild-type AAV2 inverted terminal repeats (ITRs).

[0200] Example 4: Comparison of hFMP1050-hFMR1-FMpA1 and hFMP734-hFMR1-FMpA2 constructs

[0201] To compare the FMRP expression of these two constructs, the hFMP1050-hFMR1-FMpA1 construct ( Fig.11 , SEQ ID NO: 9) in the FMRP plasmid (SEQ ID NO: 8) and the expression of hFMP734-hFMR1-FMpA2 construct ( Fig.15 , SEQ ID NO: 11) was transfected into HEK293A cells, and the FMRP expression level was analyzed by immunoblotting.

[0202] For transfection, HEK293A cells maintained in supplemented Dulbecco's Modified Eagle's Medium (DMEM) were cultured to 80-90% confluence the day before transfection and trypsinized (TrypLE TMExpress, Life Technologies, Carlsbad, CA) and seeded into 24-well plates coated with poly-L-ornithine and fibronectin. Cells were transfected with 2000 ng, 1000 ng, 500 ng, 250 ng, or 125 ng of plasmid DNA mixed with Opti-MEM (ThermoFisher Scientific) per well using Lipofectamine 2000 (Life Technologies) following the manufacturer's protocol. 48 hours after transfection, the medium was removed and the cells were transferred to NE1 buffer (20 mM HEPES, 10 mM KCl, 1 mM MgCl 2 Cells were prepared for immunoblotting in 5% Triton X-100, 0.1% Triton X-100, 20% glycerol, 0.5 mM DTT, Pierce protease inhibitor tablets, EDTA-free [A32965, Thermo Fisher Scientific]). Genomic DNA was removed by treatment with benzonase nuclease digestion solution (E1014, Merck, Rockville, Maryland, USA) for 15 minutes at room temperature. Protein concentration was quantified using a FLUOstar Omega plate reader (BMG Labtech, Cary, North Carolina, USA) in microtiter plates using a DC BioRad II (5000112, BioRad, Hercules, California, USA). Samples were diluted in one-third volume of 4x Laemmli buffer (0.5 M Tris-HCl, 8% SDS, 0.01% bromophenol blue, 40% glycerol, 10% β-mercaptoethanol) and denatured at 95°C for 10 minutes and then stored at -80°C. Protein samples (20 μg / lane) were separated and transferred to nitrocellulose membranes (BioRad). Total protein was measured using Revert 700 Total Protein Stain (926-11010, LI-COR, Lincoln, NB, USA), and the membrane was blocked in Intercept (TBS) blocking buffer (927-60001, LI-COR) for 1 hour at room temperature. Rabbit anti-FMRP primary antibody (ab17722; Abcam; 1:1,000) was incubated overnight at 4°C. Secondary antibody (IRDye800CW donkey anti-rabbit IgG secondary antibody (926-32213; LI-COR); 1:10,000) was incubated at room temperature for 1 hour, and then data was captured on LI-CORO dyssey Classic. Data were analyzed using Image Studio Lite (LI-COR) and Microsoft Excel.

[0203] Fig.17 Immunoblot data for FMRP expression from plasmids containing hFMP1050-hFMR1-FMpA1 (SEQ ID NO:8) or hFMP734-hFMR1-FMpA2 (SEQ ID NO:10) are shown. FMRP expression from hFMP1050-hFMR1-FMpA1 (SEQ ID NO:9) was not detected significantly above background FMRP expression (endogenous FMRP levels in HEK293A cells) at any DNA input level tested. FMRP expression from hFMP734-hFMR1-FMpA2 (SEQ ID NO:11) was detected significantly above background FMRP expression when DNA input levels were 250 ng per 24 wells and above. The healthy expression observed in vivo from the hFMP1050-hFMRP-FMpA1 construct illustrates an important expression test for therapeutic use (see Figure 4-11 ). However, in vitro expression in cell lines such as HEK293A also predicts expression of the therapeutic transgene cassette. FMRP expression from the smaller hFMP734 promoter (from the hMFP734-hFMR1-FMpA2 construct) resulted in more robust expression in vitro relative to the larger hFMP1050 promoter (from the hFMP1050-hFMRP-FMpA1 construct) ( Fig.17 This stronger expression provided by the smaller promoter fragment ( Fig.17 ) were unexpected and provide an alternative, more efficient and more robust expression cassette sequence.

[0204] Sequence Listing and Characteristics

[0205]

[0206]

[0207] Sequence of plasmid FMP1050-hFMR1-Myc-FMpA1

[0208] The hFMP1050 promoter sequence is in bold

[0209] hFMR1 GOI sequence is bold and underlined

[0210] Myc tag sequences are bold, italic, and underlined

[0211] FMpA1 sequence is underlined

[0212] >hFMP1050-hFMR1-Myc-FMpA1(SEQ ID NO:1)

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] >hFMP1050-hFMR1-Myc-FMpA1(SEQ ID NO:2)

[0219]

[0220] >hFMP1050 (human core promoter, SEQ ID NO: 3)

[0221]

[0222] >hFMR1 (human isoform 7, SEQ ID NO: 4)

[0223]

[0224] >FMpA1 (endogenous human 3'UTR and poly A, SEQ ID NO: 5)

[0225]

[0226] SEQ ID NO: 6 Human FMRP Amino Acid Sequence

[0227] MEELVVEVRGSNGAFYKAFVKDVHEDSITVAFENNWQPDRQIPFHDVRFPPPVGYNKDINESDEVEVYSRANEKEPCCWWLAKVRMIKGEFYVIEYAACDATYNEIVTIERLRSVNPNKPATKDTFHKIKLDVPEDLRQMCAKEAAHKDFKKAVGAFSVTYDPENYQLVILSINEVTSKRAHMLIDMHFRSLRTKLSLIMRNEEASKQLESSRQLASRFHEQFIVREDLMGLAIGTHGANIQQARKVPGVTAIDLDEDTCTFHIYGEDQDAVKKARSFLEFAEDVIQVPRNLVGKVIGKNGKLIQEIVDKSGVVRVRIEAENEKNVPQEEEIMPPNSLPSNNSRVGPNAPEEKKHLDIKENSTHFSQPNSTKVQRGMVPFVFVGTKDSIANATVLLDYHLNYLKEVDQLRLERLQIDEQLRQIGASSRPPPNRTDKEKSYVTDDGQGMGRGSRPYRNRGHGRRGPGYTSGTNSEASNASETESDHRDELSDWSLAPTEEERESFLRRGDGRRRGGGGRGQGGRGRGGGFKGNDDHSRTDNRPRNPREAKGRTTDGSLQIRVDCNNERSVHTKTLQNTSSEGSRLRTGKDRNQKKEKPDSVDGQQPLVNGVP

[0228] >CBh-hFMR1-bGHpA (SEQ ID NO: 7)

[0229]

[0230] >hFMP1050-hFMR1-FMpA1 plasmid (SEQ ID NO:8)

[0231] ·hFMP1050 promoter is in bold

[0232] hFMR1 GOI sequence is bold and underlined

[0233] FMpA1 sequence is underlined

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241] >hFMP1050-hFMR1-FMpA1(SEQ ID NO:9)

[0242]

[0243] >hFMP734-hFMR1-FMpA2 plasmid (SEQ ID NO: 10)

[0244] The hFMP734 promoter sequence is in bold

[0245] hFMR1 GOI sequence is bold and underlined

[0246] FMpA2 sequence is underlined

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253] >hFMP734-hFMR1-FMpA2 (SEQ ID NO:11)

[0254]

[0255]

[0256]

[0257]

[0258] >hFMP734, human core promoter (SEQ ID NO: 12)

[0259] TTCTGTCTAATCCTTCACCCCTATTCTCGCCTTCCACTCCACCTCCCGCTCAGTCAGACTGCGCTACTTTGAACCGGACCAAACCAAACCAAACCAAACCAAACCAAACCAGACCAGACACCCCCTCCCGCGGAATCCCAGAGAGGCCGAACTGGGATAACCGGATGCATTTGATTTCCCACGCCACTGAGTGCACCTCTGCAGAAATGGGCGTTCTGGCCCTCGCGAGGCAGTGCGACCTGTCACCGCCCTTCAGCCTTCCCGCCCTCCACCAAGCCCGCGCACGCCCGGCCCGCGCGTCTGTCTTTCGACCCGGCACCCCGGCCGGTTCCCAGCAGCGCGCATGCGCGCGCTCCCAGGCCACTTGAAGAGAGAGGGCGGGGCCGAGGGGCTGAGCCCGCGGGGGGAGGGAACAGCGTTGATCACGTGACGTGGTTTCAGTGTTTACACCCGCAGCGGGCCGGGGGTTCGGCCTCAGTCAGGCGCTCAGCTCCGTTTCGGTTTCACTTCCGGTGGAGGGCCGCCTCTGAGCGGGCGGCGGGCCGACGGCGAGCGCGGGCGGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTGGGCCTCGAGCGCCCGCAGCCCACCTCTCGGGGGCGGGCTCCCGGCGCTAGCAGGGCTGAAGAGAAG

[0260] > Endogenous human FMR1 3'UTR and polyA (FMpA2) (SEQ ID NO:13)

[0261] GTCATTTCATGTCCTGTGTCAGTTTATGTTTTGGTCCACTTTTCCAGTATTTTAGTGGACCCTGAAATGTGTGTGATGTGACATTTGTCATTTTCATTAGCAAAAAAAGTTGTATGATCTGTGCCTTTTTTATATCTTGGCAGGTAGGAATATTATATTTGGATGCAGAGTTCAGGGGAAGATAAGTTGGAAACACTAAATGTTAAAGATGTAGCAAACCCTGTCAAACATTAGTACTTTATAGAAGAATGCATGCTTTCCATATTTTTTTCCTTACATAAACATCAGGTTAGGCAGTATAAAGAATAGGACTTGTTTTTGTTTTTTGTTGCACTGAAGTTTGATAAATAGTG TTATTGAGAGAGATGTGTAATTTTTCTGTATAGACAGGAGAAGAAAGAACTATCTTCATCTGAGAGAGGCTAAAATGTTTTCAGCTAGGAACAAATCTTCCTGGTCGAAAGTTAGTAGGATATGCCTGCTCTTTGGCCTGATGACCAATTTTAACTTAGAGCTTTTTTTTTTTTTAATTTTGTCTGCCCCAAGTTTTGTGAAATTTTTCATATTTTAATTTCAACCTTATTTTGGAGAGATAGGAAGGTCATTTCCATGTATGCATAATAATCCTGCAAAGTACAGGTACTTTGTCTAAGAAACATTGGAAGCAGGTTAAATGTTTTGTAAACTTTGAAATATATGGTCTAATGTTTA

[0262] AGCAGAATTGGAAGACTAAGATCGGTTAACAAATAACAACTTTTTTTTCTTT

[0263] TTTTCTTTTGTTTTTTGAAGTGTTGGGGTTTGGTTTTGTTTTTTGAGTCTTTTTTT

[0264] TTTAAGTGAAATTTATTGAGGAAAAATATGTGAAGGACCTTCACTCTAAGATGT

[0265] TATATTTTTCTTAAAAAGTAACTCCTAGTAGGGGTACCACTGAATCTGTACAGA

[0266] GCCGTAAAAACTGAAGTTCTGCCTCTGATGTATTTTGTGAGTTTGTTTCTTTGA

[0267] ATTTTCATTTTACAGTTACTTTTCCTTGCATACAAACAAGCATATAAAATGGCAA

[0268] CAAACTGCACATGATTTCACAAATATTAAAAAGTCTTTTAAAAAGTATTGCCAA

[0269] ACATTAATGTTGATTTCTAGTTATTTATTCTGGGAATGTATAGTATTTGAAAACAG

[0270] AAATTGGTACCTTGCACACATCATCTGTAAGCTGTTTGGTTTTAAAATACTGTAG

[0271] ATAATTAACCAAGGTAGAATGACCTTGTAATGTAACTGCTCTTGGGCAATATTCT

[0272] CTGTACATATTAGCGACAACAGATTGGATTTTATGTTGACATTTGTTTGGTTATA

[0273] GTGCAATATATTTTGTATGCAAGCAGTTTCAATAAAGTTTGATCTTCCTCTGCTA

[0274] AATTGATGTTGATGCAATCCTTACAAATGATTGCTTTTAAAATTTTAAGCTAGGA

[0275] AAAGAAATCTATAGAAAGTGTTCTGTTACAAAATGTAACTGTTACCATTGGAAA

[0276] TTTCACGTCATAGGAAGTTAGCCTTTATCTACCAACTTTCAAGAACTTGTTTAAT

[0277] AAAGCGAAAAACTCAACCAAATGGTACAAAACCACAGTGTACCATTAAAATAT

[0278] GCACTAAGTCTCTTTTTTACAAAGGCTGT

[0279] Equivalents and Incorporation by Reference

[0280] All documents mentioned herein are incorporated by reference in their entirety for any purpose to the same extent as if each individual publication, database entry (e.g., Genbank sequence or GeneID entry), patent, or patent application was specifically and individually noted as being incorporated by reference in its entirety. This incorporation by reference statement is made by applicant pursuant to 37 CFR with respect to each individual publication, database entry (e.g., Genbank sequence or GeneID entry), patent application, or patent (each of which is expressly identified pursuant to 37 CFR §1.57(b)(2)), even if such reference is not immediately adjacent to a specific incorporation by reference statement. The inclusion of a specific incorporation by reference statement in the specification does not in any way impair the general statement of such incorporation by reference, if any. Citation of a reference herein does not constitute an admission that the reference is relevant prior art, nor does it constitute any admission as to the contents or date of such publication or document.

[0281] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternative embodiments, it will be understood by those skilled in the relevant art that various changes in form and details may be made without departing from the spirit and scope of the invention.

Claims

1. A therapeutic polynucleotide construct comprising: Human endogenous FMR1 promoter fragment; human FMR1 coding sequence, endogenous human 3' regulatory elements and polyadenylation signal.

2. The polynucleotide of claim 1, wherein the human FMR1 coding sequence comprises any of the following sequences: a sequence having at least 80% identity to SEQ ID NO: 4, a sequence having at least 90% identity to SEQ ID NO: 4, a sequence having at least 95% identity to SEQ ID NO: 4, SEQ ID NO: 4, or an FMR1 isoform 7 sequence.

3. The polynucleotide of claim 1 or 2, wherein the human endogenous FMR1 promoter fragment comprises any of the following nucleotide sequences: a nucleotide sequence that is at least 80% identical to SEQ ID NO: 3 or SEQ ID NO: 12, a nucleotide sequence that is at least 90% identical to SEQ ID NO: 3 or SEQ ID NO: 12, a nucleotide sequence that is at least 95% identical to SEQ ID NO: 3 or SEQ ID NO: 12, SEQ ID NO: 3 or SEQ ID NO:

12.

4. The polynucleotide of any of the preceding claims, wherein the 3' regulatory element comprises any of the following nucleotide sequences: a nucleotide sequence that is at least 80% identical to SEQ ID NO: 5 or SEQ ID NO: 13, a nucleotide sequence that is at least 90% identical to SEQ ID NO: 5 or SEQ ID NO: 13, a nucleotide sequence that is at least 95% identical to SEQ ID NO: 5 or SEQ ID NO: 13, SEQ ID NO: 5 or SEQ ID NO:

13.

5. A polynucleotide according to any of the preceding claims, wherein the polynucleotide construct comprises any of the following sequences: a polynucleotide sequence having at least 90% identity to SEQ ID NO: 2, a polynucleotide sequence having at least 90% identity to SEQ ID NO: 9, a polynucleotide sequence having at least 90% identity to SEQ ID NO: 11, SEQ ID NO: 2, SEQ ID NO: 9 or SEQ ID NO:

11.

6. The polynucleotide of any of the above claims, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR).

7. The polynucleotide of claim 6, wherein the polynucleotide comprises two AAV ITRs. A vector comprising the polynucleotide according to any one of the above claims.

9. The vector of claim 8, wherein the vector is a viral vector.

10. The vector of claim 8 or 9, wherein the vector is an adeno-associated virus (AAV) vector.

11. The vector of claim 10, wherein the AAV vector is an AAV9 vector.

12. A recombinant adeno-associated virus (rAAV) comprising the polynucleotide of any one of claims 1 to 7 or the vector of any one of claims 8 to 11.

13. The rAAV of claim 12, wherein the rAAV is AAV9.

14. A virion comprising the rAAV of claim 12 or 13.

15. A transformed cell comprising the polynucleotide of any one of claims 1 to 7, the vector of any one of claims 8 to 11, the rAAV of claim 12 or 13, or the virion of claim 14.

16. A pharmaceutical composition comprising the polynucleotide of any one of claims 1 to 7, the vector of any one of claims 8 to 11, the rAAV of claim 12 or 13 or the virion of claim 14, and a pharmaceutically acceptable carrier.

17. A method of treating fragile X syndrome and related disorders in a subject, the method comprising administering to the subject an effective amount of the polynucleotide of any one of claims 1 to 7, the vector of any one of claims 8 to 11, the rAAV of claim 12 or 13, the virion of claim 14, or the pharmaceutical composition of claim 16.

18. The method of claim 17, wherein the administering is by intracerebroventricular injection or by intracisternal administration to the subject.

19. Use of the polynucleotide of any one of claims 1 to 7, the vector of any one of claims 8 to 11, the rAAV of claim 12 or 13, the virion of claim 14, or the pharmaceutical composition of claim 16 in a method for treating fragile X syndrome and related disorders in a subject.

20. The polynucleotide, vector, rAAV, virosome or pharmaceutical composition for use according to claim 19, wherein the polynucleotide, vector, rAAV, virosome or pharmaceutical composition is administered to the subject by intracerebroventricular injection or by intracisternal administration.

Images