Biological preparation capable of removing tumor cell DNA methylation and application of biological preparation

Abstract

The invention discloses a biological agent capable of removing tumor cell DNA methylation and application of the biological agent. The biological preparation comprises engineered immune cells and a DNA methylated transferase inhibitor. The biological agent comprises the engineered immune cells expressing the chimeric antigen receptor and the DNA methyltransferase inhibitor, and the DNA methyltransferase inhibitor is combined with CAR-T to induce activation of a congenital immune signal channel so as to induce generation of I FN-beta and promote up-regulation of I FN-beta expression in tumor cells, so that the effect of killing the tumor cells is achieved.

Description

Technical Field

[0001] The present invention relates to the field of biological cell technology, and in particular to a biological preparation capable of removing tumor cell DNA methylation and application thereof. Background Art

[0002] DNA methylation is one of the main means of epigenetic modification, which is catalyzed by DNA methyltransferase (DNMT). Its abnormality is closely related to the occurrence and development of tumors, as well as tumor resistance and poor prognosis. Currently, two types of DNA methyltransferase inhibitors (DNMTi) have been developed, also known as demethylation drugs: nucleoside and non-nucleoside DNA methyltransferase inhibitors. Among them, nucleoside DNA methyltransferase inhibitors (DNMTi) include: 5-azacytidine (azacitidine, 5-azacytidine, azacytidine) and its derivatives 5-nitro-2′-deoxycytidine (decitabine, 5-aza-2′-deoxycytidine, Decitabine, Dac); non-nucleoside DNA methyltransferase inhibitors (DNMTi) include: N-phthaloyl-L-tryptophan, etc.

[0003] In recent years, a large number of studies have reported the regulatory effects of DNA methyltransferase inhibitors on the immune system. DNMTi is involved in the regulation of tumor-associated antigen expression and antigen presentation mechanisms, and promotes the enhancement of T cell recognition of tumors. DNMTi can induce immune signals and upregulate the expression of a series of genes involved in immune regulation in a variety of cancer cells, especially the expression of interferon (IFN) and its response pathway genes. Interferon can enhance the expression of major histocompatibility antigens and tumor-associated antigens, enhance the maturation and antigen presentation of dendritic cells, enhance the cytotoxic effect of natural killer cells, enhance the cytotoxic effect of antibody-dependent cells, etc. Therefore, it plays an important role in the immune regulation of cancer cells.

[0004] The rapid development of tumor immunotherapy, especially CAR-T therapy in adoptive cell therapy (ACT), has achieved certain remarkable results in the treatment of hematological tumors; but the treatment of solid tumors is difficult because cancer cells in solid tumors can form a tumor microenvironment around them to support the growth and metastasis of cancer cells. The immunosuppressive cytokines such as IL-4, IL-10, TGF-β, etc., which are expressed in large quantities in the tumor microenvironment, inhibit the anti-tumor activity of engineered immune cells (such as CAR-T cells). Therefore, how to improve the efficacy of immune cells against solid tumors is a major dilemma of current cell therapy. Summary of the invention

[0005] Based on the above problems, the problem to be solved by the present invention is to provide a biological preparation with the ability to remove tumor cell DNA methylation and its application, and to utilize the immunostimulatory molecules contained in the biological preparation in combination with immune cells (such as CAR-T cells) to enhance the killing ability of immune cells against tumor cells.

[0006] The technical solution of the present invention is as follows:

[0007] A biological preparation with the ability to remove tumor cell DNA methylation, comprising engineered immune cells and a DNA methyltransferase inhibitor; wherein the immune cells include any one of T cells, macrophages, dendritic cells, monocytes, NK cells and NKT cells; and the T cells include any one of CD4+ / CD8+T cells, CD4+ helper T cells, CD8+T cells, tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells and αβ-T cells; and the DNA methyltransferase inhibitor includes one or more of 4-deoxyuridine, 5-azacytidine, 5-aza-2′-deoxycytidine and their derivatives.

[0008] This biological preparation can be widely used in the preparation of drugs for treating tumors or cancers (such as gastric cancer).

[0009] The biological preparation provided by the present invention comprises engineered immune cells expressing chimeric antigen receptors (such as CAR-T cells) and DNA methyltransferase inhibitors. The methylation degree of tumor cells is "weakened" by the DNA methyltransferase inhibitor, while inducing the activation of the innate immune signaling pathway and then inducing the production of IFN-β, thereby enhancing the killing ability of engineered immune cells against target cells and increasing the release level of cytokines (such as IFN-β, IL-2, etc.), thereby softening the immunosuppressive microenvironment of tumor cells, and then enhancing the killing ability of engineered immune cells against tumor cells, thereby achieving the effect of DNA methyltransferase inhibitors enhancing the synergistic killing of tumor cells by engineered immune cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 This is a bar graph showing the up-regulation fold of type I interferon IFNβ mRNA expression after AGS cells were treated with Zebularine in Example 1;

[0011] Figure 2 This is a growth curve of Anti-Claudin18.2-CAR-T cells and Normal T cells in Example 2;

[0012] Figure 3The figure is the expression flow cytometric graph of CAR detected by Anti-Claudin18.2-CAR-T cells and Normal T cells simultaneously in Example 2; wherein, Figure a represents the expression flow cytometric graph of CAR detected by Normal T cells; Figure b represents the expression flow cytometric graph of CAR detected by Anti-Claudin18.2-CAR-T cells;

[0013] Figure 4 This is a bar graph of Luciferase release detection of the AGS-Luciferase stably transfected cell line in Example 3;

[0014] Figure 5 This is a bar graph showing the in vitro killing rate of AGS-Luciferase cells after treatment with 5-azacytidine, 5-aza-2′-deoxycytidine, Zebularine, Anti-claudin18.2 CAR-T, and the combination of Zebularine and Anti-claudin18.2 CAR-T in Example 3;

[0015] Figure 6 This is a bar graph of the IL-2 concentration released by each cell after AGS-Luciferase cells were treated with Zebularine, Anti-Claudin18.2 CAR-T, and the combination of Zebularine and Anti-claudin18.2 CAR-T in Example 4;

[0016] Figure 7 This is a bar graph of the IFN-γ concentration released by each cell after AGS-Luciferase cells were treated with Zebularine, Anti-Claudin18.2 CAR-T, and the combination of Zebularine + and Anti-Claudin18.2 CAR-T in Example 4. DETAILED DESCRIPTION

[0017] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0018] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificially constructed hybrid polypeptide, which generally includes a ligand binding domain (e.g., an antigen binding portion of an antibody), a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain, each of which is connected by a linker. CAR can redirect the specificity and reactivity of T cells and other immune cells to the selected target in a non-MHC restricted manner using the antigen binding properties of monoclonal antibodies. Non-MHC restricted antigen recognition gives CAR-expressing T cells the ability to recognize antigens unrelated to antigen processing, thereby bypassing the main mechanism of tumor escape. In addition, when expressed in T cells, CAR advantageously does not dimerize with the α and β chains of endogenous T cell receptors (TCRs).

[0019] As used herein, "ligand binding domain" refers to any structure or functional variant thereof that can bind to a ligand. The ligand binding domain can be an antibody structure, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, mouse antibodies, chimeric antibodies and functional fragments thereof. For example, the ligand binding domain includes but is not limited to Fab, Fab', Fv fragment, F(ab')2, single chain antibody (Single Chain Antibody Fragment, scFv), single domain antibody (Single Domain Antibody, sdAb), nanobody (Nanobody, Nb), antigen binding ligand, recombinant fibronectin domain, anticalin and DARPIN, etc., preferably selected from Fab, scFv, sdAb and nanobody. In the present invention, the ligand binding domain can be monovalent or divalent, and can be a monospecific, bispecific or multispecific antibody.

[0020] The biological preparation with tumor cell DNA methylation removal provided by the present invention comprises engineered immune cells expressing chimeric antigen receptors and DNA methyltransferase inhibitors; this biological preparation, when used in combination with engineered immune cells expressing chimeric antigen receptors, can enhance the killing effect of engineered immune cells on tumor cells.

[0021] The above-mentioned immune cells are selected from T cells, macrophages, dendritic cells, monocytes, NK cells or NKT cells; preferably, T cells are CD4+ / CD8+T cells, CD4+ helper T cells, CD8+T cells, tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells or αβ-T cells.

[0022] The chimeric antigen receptor (CAR) contains a ligand binding domain, a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain.

[0023] In the chimeric antigen receptor, the ligand binding domain can be selected from scFv, Fab, single domain antibody, nanobody, antigen binding ligand, recombinant fibronectin domain, anticalin and DARPIN; preferably, the ligand binding domain is selected from scFv, Fab, single domain antibody and nanobody. The ligand binding domain binds to a target selected from the following: MUC1, EGFRvIII, mesothelin and, CLDN18.2, HER2, TAA, GD2, MSLN, EGFR, NY-ESO-1, MUC1, PSMA and EBV, or any combination thereof.

[0024] In the chimeric antigen receptor, the transmembrane domain is selected from the transmembrane domain of a protein, such as TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3ζ subunit, CD3ε subunit, CD3γ subunit, CD3δ subunit, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137 and CD154; preferably, the transmembrane domain is selected from the transmembrane domain of CD8α, CD4, CD28 and CD278.

[0025] In the chimeric antigen receptor, the intracellular signaling domain is selected from the signaling domain of a protein, such as FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b and CD66d; preferably, the intracellular signaling domain comprises the signaling domain of CD3ζ.

[0026] In the chimeric antigen receptor, the costimulatory domain is one or more costimulatory signaling domains selected from proteins, such as TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD7, CD8, CD18 (LFA-1), CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4 -1BB), CD270 (HVEM), CD272 (BTLA), CD276 (B7-H3), CD278 (ICOS), CD357 (GITR), DAP10, LAT, NKG2C, SLP76, PD-1, LIGHT, TRIM, ZAP70 and combinations thereof; preferably, the co-stimulatory domain is a co-stimulatory signaling domain of CD27, CD28, CD134, CD137 or CD278 or a combination thereof.

[0027] The chimeric antigen receptor (CAR) comprises: (a) a 4-1BB co-stimulatory domain and a CD3ζ intracellular signaling domain, (b) a CD27 co-stimulatory domain and a CD3ζ intracellular signaling domain, (c) a CD28 co-stimulatory domain and a CD3ζ intracellular signaling domain, (d) an OX40 co-stimulatory domain and a CD3ζ intracellular signaling domain, (e) a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain and a CD3ζ intracellular signaling domain, (f) an OX40 co-stimulatory domain, a 4-1BB co-stimulatory domain and a CD3ζ intracellular signaling domain, or (g) a CD28 co-stimulatory domain, an OX40 co-stimulatory domain and a CD3ζ intracellular signaling domain.

[0028] The DNA methyltransferase inhibitor in the above-mentioned biological preparation includes one or more of 4-deoxyuridine (Zebularine, abbreviated as Zeb, the same below), 5-azacytidine (5-aza, abbreviated as 5-aza, the same below), 5-aza-2′-deoxycytidine (5-aza-2′-deoxycytidine, abbreviated as 5-aza-2'-deo, the same below) and their derivatives; preferably, the DNA methyltransferase inhibitor is 4-deoxyuridine (Zebularine), 5-azacytidine (5-azacytidine) or a combination thereof.

[0029] The biological preparation provided by the present invention can be used as a drug to improve the efficacy of engineered immune cells in treating solid tumors, including the combined use of a DNA methyltransferase inhibitor and an engineered immune cell expressing a chimeric antigen receptor in vitro; for example, sequentially administering the engineered immune cell and the DNA methyltransferase inhibitor in vitro; or, administering the engineered immune cell and the DNA methyltransferase inhibitor in vitro. Therefore, the DNA methyltransferase inhibitor and the engineered immune cell expressing the chimeric antigen receptor can be present in the same composition biological preparation, or in different composition biological preparations.

[0030] The above-mentioned biological agents are used as drugs to treat solid tumors mainly including: brain glioma, germ cell tumor, sarcoma, biliary tract cancer, bladder cancer, bone cancer, brain and CNS cancer, breast cancer, peritoneal cancer, cervical cancer, choriocarcinoma, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer, glioblastoma (GBM), liver cancer, hepatoma, intraepithelial neoplasia, kidney cancer, laryngeal cancer, liver tumor, lung cancer, lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, respiratory system cancer, salivary gland cancer, skin cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, uterine or endometrial cancer, malignant tumors of the urinary system and other cancers and sarcomas.

[0031] The DNA methyltransferase inhibitor DNMTi described in the present invention combined with engineered immune cells (such as CAR-T cells) can significantly enhance the effect of engineered immune cells: the combined therapy has better in vitro killing activity than a single engineered immune cell; at the same time, the secretion level of cytokines is also higher; in addition, the combined drug therapy can significantly enhance the immunoregulatory ability of tumor cells and promote the upregulation of IFN-β expression in tumor cells, thereby achieving the effect of killing tumor cells.

[0032] The technical solution of the present invention is further described in detail below through specific embodiments.

[0033] Example 1

[0034] Zebularine treatment of AGS cells (Human Gastric Adenocarcinoma Cells) can upregulate the expression level of IFN-β mRNA.

[0035] The experimental method is as follows:

[0036] 1.1. On day 0, AGS cells were cultured at 5.0×10 5 The number of cells / well was inoculated into a 6-well plate and cultured in a cell culture incubator at 37°C with 5% CO2 for 12 h;

[0037] 1.2. On the second day, cells were removed from the 6-well plate, treated with DPBS and 25 μM Zebularine, and continued to be cultured;

[0038] 1.3. On the 5th day, take out the cells from the 6-well plate again, discard the spent culture medium, add 1 ml of Trizol solution, and collect the cells in a 1.5 ml centrifuge tube;

[0039] 1.4. Add 200 μl of chloroform to the centrifuge tube, shake vigorously for 25 seconds, let stand at room temperature for 5 minutes, and then centrifuge at 12000g for 15 minutes at 4°C;

[0040] 1.5. Carefully discard the supernatant, add isopropanol of the same volume as the cell pellet, mix well, let stand at 4°C for 10 min, and then centrifuge at 4°C and 12,000 g for 10 min.

[0041] 1.6. After centrifugation, discard the supernatant and add 1 ml of freshly prepared 75% anhydrous ethanol to the centrifuge tube to suspend the cell pellet in anhydrous ethanol; then centrifuge at 7500g for 5 minutes at 4°C; discard the supernatant again and dry the cell pellet; finally, add water to dissolve and obtain total cellular RNA;

[0042] 1.7. According to the requirements of PrimeScript RT reagent Kit with gDNA Eraser (takala, RR047A), total cell RNA was reverse transcribed to prepare cDNA;

[0043] 1.8. Using the obtained cDNA as a template, amplification reaction was performed by real-time quantitative polymerase chain reaction (qPCR), as follows:

[0044] 1) The polymerase chain reaction (qPCR) amplification system is shown in Table 1 below;

[0045] Table 1 Polymerase chain reaction (qPCR) amplification system

[0046]

[0047] The nucleotide sequence of the interferon IFN-β gene forward primer is shown in SEQ ID NO: 1: TGGGTGGAATGAGACTATTGTTG; the nucleotide sequence of the interferon IFN-β gene reverse primer is shown in SEQ ID NO: 2: CTCCCACGTCAATCTTTCCTC;

[0048] 2) The PCR amplification reaction stages are as follows:

[0049] (1) Pre-denaturation at 95°C for 10 minutes;

[0050] (2) Denaturation at 95°C for 30 seconds;

[0051] (3) Anneal at 60°C for 30 seconds;

[0052] (4) Execute steps (2) to (3) 35 times to perform PCR amplification;

[0053] 3) Detect the expression of interferon IFN-β mRNA, and calculate the expression level of each sample based on the ct value and the standard curve determined by the SCG standard; the results of the standard test are shown in Table 2.

[0054] Table 2 Raw data of SCG standard serial dilution

[0055] SCG standard (pg / ml) ct value 10 30.43 100 27.15 1000 23.82 10000 20.42 100000 17.03 1000000 13.48

[0056] The following formula is obtained based on the concentration of the SCG standard and the detected ct value:

[0057] y=-3.386x+33.906; where x represents the concentration of the standard and y represents the ct value of the test. 2 =0.998>0.99, indicating that the formula calculated from the data in Table 2 is credible.

[0058] According to the ct value and the standard curve determined by SCG standard, the expression levels of each sample were calculated as shown in Table 3 and Figure 1 As shown; among them, Figure 1 It is drawn based on the data in Table 3.

[0059] Table 3 The difference in IFNβ expression in AGS cells after zebularine treatment and DPBS treatment

[0060]

[0061] As shown in Table 3 and Figure 1 As shown, in AGS cells, compared with the DPBS control group, after 3 days of treatment with Zebularine, the mRNA expression level of interferon IFN-β was upregulated by more than 23 times (1054.80 / 45.36=23.25). This shows that DNA methyltransferase inhibitors can activate interferon-mediated immune responses to a certain extent.

[0062] Example 2

[0063] CAR-T cells (Anti-Claudin18.2-CAR-T cells) and control group cells (Normal T cells) were prepared, and the expression levels of CAR in the two groups of cells were detected simultaneously; the experimental operation was as follows.

[0064] 2.1. Acquisition of T cells

[0065] Mononuclear cells are isolated from donor peripheral blood, density gradient centrifugation is performed using the Ficoll method, and T cells are enriched using a T cell sorting kit, such as CD3 MicroBeads, Human-Lyophilized, and magnetic beads coupled to Anti-CD3 / Anti-CD28 are used to activate, culture and expand T cells. This part is a routine technique and will not be described in detail here.

[0066] 2.2. Transduction and expansion of T cells

[0067] When culturing T cells, XVIVO (LONZA, Catalog #0001052349) medium was used, which contained 10% FBS (Gibco), 2mM L-glutamine (Thermofisher) and 100IU / ml rhIL2 (Sigma). Cells were cultured in a constant temperature incubator at 37°C and 5% CO2.

[0068] The concentrated recombinant lentivirus LV-EF1α-CAR was used to infect activated T cells to obtain Anti-CAR-T-CLAUDIN18.2 cells that only expressed CAR; at the same time, another group of T cells without lentivirus infection served as the control group Normal T cells.

[0069] After T cell infection, the number of cells was sampled and counted on the 2nd, 4th, 6th, 8th, 10th, and 12th days (the specific cell proliferation is shown in Table 4), and the corresponding cell growth expansion times were calculated, as shown in Table 4 and Figure 2 shown. Figure 2 is a curve of the expansion multiples of Claudin18.2-CAR-T and Normal T cells; Table 4 is the expansion multiples calculated after counting the number of expansion of Claudin18.2-CAR-T and NormalT cells, and Figure 2 be consistent.

[0070] Table 4 T cell expansion multiples

[0071] Experimental Grouping Day 0 Day 2 Day 4 Day 6 Day 8 Day 10 Day 12 Anti-Claudin18.2-CAR-T 1 10.7 59.1 196.8 512 786 1575.12 Normal T 1 13.65 67.4 238 561 934 1880.68

[0072] From Table 4 and Figure 2 It can be seen that on the 12th day, the proliferation expansion times of the Anti-Claudin18.2-CAR-T and Normal T cell groups were 1575 times and 1880 times, respectively.

[0073] After T cell infection, samples were taken on the 12th day to detect the expression of CAR in Anti-Claudin18.2-CAR-T and Normal T cells, as shown in Table 5 and Figure 3 . Figure 3Figure 5 is a flow cytometric graph of the CAR positive expression rate of T cells; Figure a is a flow cytometric graph of the CAR positive expression rate of Normal T, and Figure b is a flow cytometric graph of the CAR positive expression rate of Anti-Claudin18.2-CAR-T; Table 5 is

[0074] The positive expression rate of CAR in Anti-Claudin18.2-CAR-T cells and Normal T cells Figure 3 be consistent.

[0075] Table 5 T cell CAR expression detection results

[0076] Experimental Grouping CAR expression (%) Anti-Claudin18.2-CAR-T 85.02 Normal T 1.04

[0077] From Table 5 and Figure 3 It can be seen that the CAR positive rates of Anti-Claudin18.2-CAR-T and Normal T cells are 85.02% and 1.04%, respectively. Therefore, the CAR positive expression rate of Anti-Claudin18.2-CAR-T cells far exceeds the CAR positive rate of Normal T cells; therefore, Anti-Claudin18.2-CAR-T cells were selected for subsequent experiments.

[0078] Example 3

[0079] In this example, Anti-Claudin18.2-CAR-T cells were prepared according to Example 2.

[0080] After treating AGS-Luciferase cells with 5-azacytidine, 5-aza-2′-deoxycytidine, Zebularine, CAR-T-CLAUDIN18.2 cells, and Zebularine and CAR-T-CLAUDIN18.2 cells, the in vitro killing rate of AGS-Luciferase cells was detected; the specific operations are as follows.

[0081] 3.1. Preparation and culture of AGS-Luciferase cell line

[0082] Establishment of a cell line stably expressing Luciferase: The base sequence expressing Luciferase was cloned into the PHBLV lentiviral vector backbone and placed under the promoter of EF1α (EF-1α) to form PHBLV-EF1α-Luciferase. The three plasmids PHBLV-EF1α-Luciferase, lentiviral envelope pMD2.G (Addgene, Plasmid#12259) and lentiviral packaging plasmid psPAX2 (Addgene Plasmid#12260) were transferred into 293T using Lipofectamine3000 to prepare a lentiviral vector; the viral supernatant was collected at 48h and 72h and concentrated by ultracentrifugation (Merck Millipore); the concentrated virus can be used to infect AGS, and the AGS cell line stably expressing Luciferase is finally obtained through monoclonal cloning, named AGS-Luciferase.

[0083] 3.2. Detection of cell killing rate of AGS-Luciferase

[0084] 3.2.1. Day 0: AGS-Luciferase cells and AGS cells were cultured at 1.0×10 per well. 4 The number of cells / 50 μL was inoculated in a 24-well plate, where AGS-Luciferase cells were divided into 7 groups (as shown in Table 5), each group had 3 replicates, and AGS cells were only in 1 group, 3 replicates, and cultured in a cell culture incubator at 37°C with 5% CO2 for 24 h;

[0085] 3.2.2. Day 2: Take out the 24-well plate, and perform the following operations in the following wells of the 24-well plate inoculated with AGS-Luciferase cells:

[0086] Group 3: Wells 1 to 3 were treated with 25 μM Zebularine and cultured for 3 more days;

[0087] Group 4: CAR-T cells were added to wells 4 to 6, and the effector-target ratio of CAR-T cells and target cell AGS-Luciferase was set to 1:1, and culture was continued for 3 days;

[0088] Group 5: Wells 7 to 9 were treated with 25 μM Zebularine first, and then with CAR-T cells. The effector-target ratio of CAR-T cells and target cell AGS-Luciferase was set to 1:1, and culture was continued for 3 days.

[0089] Group 6: wells 10 to 12 were treated with 25 μM 5-aza-2′-deoxycytidine and cultured for 3 more days;

[0090] Group 7: Wells 13 to 15 were treated with 25 μM 5-azacytidine and cultured for 3 more days;

[0091] In the above groups 3 to 7, the final volume of each well was 100 μL;

[0092] 3.2.3. Set up the background group, i.e., Group 1 (RPMI1640+10% FBS, 100 μL), and the control group, i.e., Group 2 (only target cells AGS-Luciferase cells, 100 μL);

[0093] 3.2.4. At the same time, the three replicate wells inoculated with AGS cells were also supplemented with culture medium (RPMI1640 + 10% FBS) to 100 μL;

[0094] 3.2.5. On the 5th day, take out the 24-well plate, add 100 μL of GMOne-Step luciferase reagent to each well, and incubate in the dark for 7 min.

[0095] 3.2.6. Turn on the microplate reader and detect the Luciferase value (abbreviated as Luc value, the same below) of each group in steps 3.2.3 and 3.2.4. The test results are shown in Table 6 and Table 7 respectively; and the cell killing rate is calculated according to the following killing efficiency calculation formula;

[0096] Killing efficiency = {1-(Luc value of effect release group-Luc value of background group) / (Luc value of maximum release group-Luc value of background group)}*100%;

[0097] Where:

[0098] Maximum release group fluorescence detection value (Luc value): refers to the wells of the 24-well plate with only target cell AGS-Luciferase added;

[0099] Fluorescence detection value (Luc value) of background group: refers to the wells of 24-well plate containing only basal culture medium 1640;

[0100] Fluorescence detection value (Luc value) of effector release group: refers to the wells of a 24-well plate mixed with target cells treated with AGS-Luciferase and Zebularine alone, AGS-Luciferase and 5-aza-2′-deoxycytidine alone, AGS-Luciferase and 5-azacytidine alone, CAR-T alone, and Zebularine and CAR-T combined.

[0101] The fluorescence detection value of the maximum release group, the fluorescence detection value of the background group and the fluorescence detection value of the effector release group; these three groups of fluorescence detection values ​​(Luc) are independently detected by targeting target cell AGS-Luciferase (without lysis), medium containing 100% 1640 or target cell AGS-Luciferase mixed with effector cells, that is, the respective detection data are obtained by independently detecting these three groups of cell samples, as shown in Table 7; then the average is substituted into the above killing efficiency calculation formula to calculate the killing rate of each group, as shown in Table 7 and Figure 5 shown.

[0102] The Luc values ​​(per 10,000 cells) of the lysate (1640 culture medium), AGS cells, and AGS-Luciferase cells were detected by an ELISA reader. The data obtained are shown in Table 6; Figure 4 It is a bar graph of Luc values ​​drawn based on the data in Table 6.

[0103] Table 6 Luc value detection statistics of AGS-Luciferase

[0104] Experimental Grouping Luc value 1640 medium 2530 AGS 8415 AGS-Luciferase 3408200

[0105] From Table 6 and Figure 4 It can be seen that the Luc value of AGS-Luciferase cells is as high as 3.4E+06, while the background value of Luc of wild-type AGS cells is only 8415, indicating that the AGS-Luciferase cell line was successfully constructed.

[0106] In addition, the statistical table of the killing rate of target cells after treatment with 5-azacytidine, 5-aza-2′-deoxycytidine or Zebularine for groups 3 to 7, respectively, is shown in Table 7 ; Figure 5 Based on Table 7, a bar graph is drawn showing the killing rate of target cells under various treatment conditions.

[0107] Table 7 Experimental group killing data and killing results statistics

[0108]

[0109] As shown in Table 7 and Figure 5 As shown, three different methylation inhibitors were used to treat the target cells, see Group 3, Group 6 and Group 7. From the killing results of the three groups of cells, it can be seen that there is no obvious difference between the three methylation inhibitors, so Zebularine with a medium killing rate was finally selected for subsequent combination testing.

[0110] From Table 7 and Figure 5It can also be seen that the killing rate of target cells by Zebularine treatment can reach about 12%, and the killing rate of target cells by Anti-Claudin18.2-CAR-T treatment alone can reach about 41%. However, after combined treatment with Zebularine and Anti-Claudin18.2-CAR-T, the killing rate of target cells can reach more than 88%.

[0111] This shows that the biological agent combined with Zebularine and Anti-Claudin18.2-CAR-T can significantly enhance the killing ability of CAR-T cells against tumor cells.

[0112] Example 4

[0113] After AGS-Luciferase cells were treated with Zebularine, Anti-Claudin18.2-CAR-T, and a combination of Zebularine and Anti-Claudin18.2-CAR-T, the secretion levels of cytokines IL-2 and IFN-γ were detected; the specific operations are as follows.

[0114] 4.1. Detection of the concentrations of cytokines IL-2 and IFN-γ secreted by AGS-Luciferase cells under different treatment conditions

[0115] 4.1.1. On day 0, AGS-Luciferase cells were plated at 1.0×10 per well. 4 The number of cells / 50 μL was inoculated in a 96-well plate and cultured overnight in a cell culture incubator at 37°C with 5% CO2;

[0116] 4.1.2. On the second day, the AGS-Luciferase cells were cultured in groups as follows:

[0117] 4.1.2.1. Take out the 96-well plate pre-inoculated with AGS-Luciferase cells and group the wells in the 96-well plate for experiments:

[0118] Experimental group 1: treated with 25 μM Zebularine and cultured for 3 days;

[0119] Experimental group 2: Anti-Claudin18.2-CAR-T cells were added at a ratio of 1:1 and cultured for 3 days;

[0120] Experimental group 3: first treated with 25 μM Zebularine, then added effector CAR-T cells at a ratio of 1:1, and cultured for 3 days;

[0121] In the above experimental groups 1 to 3, the final volume per well of all groups was 100 μL;

[0122] 4.1.3. On the 5th day, after the co-culture time was over, the 96-well plate was taken out and centrifuged at 500g for 5 minutes. The co-culture supernatant was separated and the expression of IL-2 and IFN-γ in each group of cells in the supernatant was detected using Human IL-2 Quantikine QuicKit ELISA (Catalog#: QK202) and Human IFN-γ Quantikine ELISA Kit (Catalog#: DIF50C). The test results are shown in Tables 9 and 11.

[0123] The original data of cytokine release detection are shown in Table 8, Table 9, Table 10, and Table 11; among which:

[0124] Table 8 shows the OD values ​​of IL-2 standard after gradient dilution. 540 value;

[0125] Table 9 shows the OD of IL-2 detected in the experimental group 540 Value and IL-2 secretion calculated according to the standard formula; among them, Figure 6 A bar graph of IL-2 secretion concentration was drawn based on Table 9;

[0126] Table 10 shows the OD values ​​of IFN-γ standard after gradient dilution. 540 value;

[0127] Table 11 shows the OD of IFN-γ detected in the experimental group 540 The values ​​and the secretion of IFN-γ calculated according to the standard formula; Figure 7 Based on Table 11, a bar graph of IFN-γ secretion concentration was drawn.

[0128] Table 8 Human IL-2 standard gradient dilution raw data

[0129]

[0130] According to the concentration of IL-2 standard and the OD of detection 540 The following formula is obtained:

[0131] y=0.0013x+0.0381; where x represents the concentration of the standard and y represents the OD of the test 540 value.

[0132] Calculate R 2 =0.9963>0.99, indicating that the formula calculated from the data in Table 6 using the IL-2 standard is credible.

[0133] Table 9 IL-2 detection data of experimental group

[0134]

[0135] Table 10 Original data table of IFN-γ standard gradient dilution

[0136]

[0137] According to the concentration of IFN-γ standard and the OD of detection 540 The following formula is obtained:

[0138] y=0.0027x+0.0421, where x represents the concentration of the standard and y represents the OD of the test. 540 value.

[0139] Calculate R 2 =0.9948>0.99, indicating that the formula calculated from the data in Table 6 using the IFN-γ standard is credible.

[0140] Table 11 IFN-γ detection data of experimental group

[0141]

[0142] As shown in Tables 9 and 11, and Figure 6 and Figure 7 As shown, in experimental group 1, the release of IL-2 and IFN-γ was almost undetectable when the target cells were treated with Zebularine alone; in experimental group 2, the release of IL-2 and IFN-γ could be detected when the target cells were treated with Anti-Claudin18.2-CAR-T alone, such as the concentration of IL-2 in the supernatant was 566pg / ml, and the concentration of IFN-γ in the supernatant was 966pg / ml; in experimental group 3, after the cells were treated with Zebularine and Anti-Claudin18.2-CAR-T in combination, the release concentrations of IL-2 and IFN-γ in the supernatant were almost doubled compared with those in experimental group 2, such as the concentration of IL-2 could reach 1120pg / ml, and the concentration of IFN-γ in the supernatant was 3220pg / ml; this shows that the biological preparation of Zebularine combined with Anti-Claudin18.2-CAR-T can significantly improve the killing ability of CAR-T cells against tumor cells.

[0143] It should be understood that the above description of the preferred embodiments of the present invention is relatively detailed and cannot be regarded as limiting the scope of patent protection of the present invention. The scope of patent protection of the present invention shall be based on the attached claims.

Claims

1. A biological agent capable of removing DNA methylation from tumor cells, characterized in that: The biological agents include engineered immune cells and DNA methyltransferase inhibitors.

2. The biological agent according to claim 1, characterized in that The immune cells include any one of T cells, macrophages, dendritic cells, monocytes, NK cells and NKT cells.

3. The biological agent according to claim 2, characterized in that The T cells include any one of CD4+ / CD8+T cells, CD4+ helper T cells, CD8+T cells, tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells and αβ-T cells.

4. The biological agent according to claim 1, characterized in that The DNA methyltransferase inhibitor includes one or more of 4-deoxyuridine, 5-azacytidine, 5-aza-2′-deoxycytidine and derivatives thereof.

5. Use of the biological agent as claimed in claim 1 in the preparation of drugs for treating tumors or cancer.

Images