Genetically modified non-human animals expressing human EPO

Abstract

The present invention relates to genetically modified non-human animals expressing human EPO. Genetically modified non-human animals that express human EPO from an animal genome are provided. Also provided are methods for generating a non-human animal that expresses human EPO from a non-human animal genome, and methods for using a non-human animal that expresses human EPO from a non-human animal genome. These animals and methods have many uses in the art, including, for example, modeling of human erythropoiesis and erythrocyte function; modeling of human pathogen infection of red blood cells; in vivo screening of agents that modulate erythropoiesis and / or erythrocyte function, for example in a healthy or diseased state; screening agents which are toxic to the red blood cells or red blood cell ancestors; in vivo screening of agents that prevent, mitigate, or reverse toxic effects of toxic agents on red blood cells or red blood cell ancestors; in vivo screening of red blood cells or red blood cell ancestors from an individual to predict responsiveness of the individual to disease therapy.

Description

[0001] This application is a re-divisional application of the divisional application of the invention application with the application date of May 18, 2015, the Chinese application number of 202110382598.5, and the invention name of "Genetically modified non-human animals expressing human EPO" (the original application number is 201580028410.X).

[0002] Cross-references

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 000,460, filed May 19, 2014, the disclosure of which is incorporated herein by reference in its entirety. Field of the Invention

[0004] The present invention is in the field of genetically modified non-human animals. Background of the Invention

[0006] Genetically modified mice, modified and transplanted mice, and their use in modeling human diseases are known in the art. However, to date, there has been little success in generating genetically modified mice that mimic human infection with pathogens that target cells of the human erythroid lineage. Such pathogens (e.g., protozoa of the genus Plasmodium, Babesia, and Theileria) can cause life-threatening diseases in humans.

[0007] For example, protozoa of the genus Plasmodium cause malaria. In 2010, a total of 106 countries worldwide were considered to be endemic for malaria, with an estimated 3.3 billion people at risk for the disease. The burden of the disease worldwide in 2010 was estimated at 216 million cases and 655,000 estimated deaths, 86% of which were children under the age of 5. Currently, drugs and vaccines for the prevention and treatment of malaria are still very limited. In addition, parasite resistance to commonly used malaria therapeutics has emerged and presents a continuing challenge. Therefore, there is an urgent need to develop new drugs and vaccines for the control and treatment of pathogens that target human red blood cells.

[0008] Because many of these pathogens do not infect erythrocytes of laboratory rodents, in vivo studies have traditionally been limited to studies of malaria caused by the rodent parasite Plasmodium berghei ANKA or NOD / SCID, NOD / SCID / IL2rg, which are acutely engrafted by daily injection of large numbers of human erythrocytes and coincidentally or subsequently infected by injection of parasite-infected erythrocytes. 无效(NSG), or BXN mouse studies (Angulo-Barturen et al. (2008) Amurine model of falciparum-malaria by in vivo selection of competent strains in non-myelodepleted mice engrafted with human erythrocytes. PLoS One 3:e2252; Jimenez-Diaz et al. (2009) Improved murine model of malaria using Plasmodiumfalciparum competent strains and non-myelodepleted NOD-scid IL2Rgnull miceengrafted with human erythrocytes. Antimicrob Agents Chemother53:4533-4536; Badell et al. (2000) Human malaria in immunocompromised mice: an in vivo model to study defense mechanisms against Plasmodium falciparum. JEM 192(11):1653-1660; Moreno et al. (2006) The course of infections and pathology inimmunomodulated NOD / LtSz-SCID mice inoculated with Plasmodium falciparumlaboratory lines and clinical isolates. Int. J. Parasitol. 36:361-369). In order to study the effects of Plasmodium and other pathogens on humans, and to test the efficacy of vaccines and drugs to prevent infection and treat humans infected with these and other pathogens, it would be useful to have non-human animals such as mice that have been genetically modified to be susceptible to infection with such pathogens or to better support acute transplantation of human red blood cells into the animals prior to infection (as performed in traditional rodent models). SUMMARY OF THE INVENTION

[0010] Provided are genetically modified non-human animals expressing human EPO from the animal genome. Also provided are methods for generating non-human animals expressing human EPO from non-human animal genomes, and methods for using non-human animals expressing human EPO from non-human animal genomes. These animals and methods have many uses in the art, including, for example, modeling of human erythropoiesis and erythrocyte function; modeling of human pathogen infection of erythrocytes; in vivo screening of agents regulating erythropoiesis and / or erythrocyte function, for example, in a healthy or diseased state; in vivo screening of agents toxic to erythrocytes or erythrocyte ancestors; in vivo screening of agents that prevent, mitigate, or reverse the toxic effects of toxic agents on erythrocytes or erythrocyte ancestors; in vivo screening of erythrocytes or erythrocyte ancestors from individuals to predict the responsiveness of individuals to disease therapies.

[0011] In some aspects of the present invention, a genetically modified non-human animal is provided, which expresses human EPO from the genome of the non-human animal. In other words, the non-human animal comprises a nucleic acid sequence encoding a human EPO protein.

[0012] In some embodiments, the nucleic acid sequence encoding human EPO protein is operably connected to the EPO gene promoter. In some embodiments, the EPO gene promoter is a human EPO promoter. In other embodiments, the EPO promoter is endogenous, i.e., non-human, EPO promoter. In some such embodiments, the endogenous EPO promoter is at a non-human animal EPO gene locus. In other words, in some embodiments, the nucleic acid sequence encoding human EPO protein is operably connected to a non-human animal EPO promoter at a non-human animal EPO locus. In some such embodiments, the operably connected leads to an invalid mutation in a non-human EPO gene at a non-human EPO gene locus.

[0013] In some embodiments, the subject non-human animal is heterozygous for an allele comprising the nucleic acid sequence encoding a human EPO protein. In other embodiments, the non-human animal is homozygous for an allele comprising the nucleic acid sequence encoding a human EPO protein.

[0014] In some embodiments, the nucleic acid sequence encoding human EPO protein comprises human EPO genomic coding and non-coding sequences. In other embodiments, the nucleic acid sequence encoding human EPO protein comprises human EPO cDNA sequence.

[0015] In some embodiments, the subject non-human animal expresses one or more additional human proteins selected from the group consisting of: an M-CSF protein encoded by a nucleic acid under the control of an M-csf promoter, an IL-3 protein encoded by a nucleic acid under the control of an Il-3 promoter, a GM-CSF protein encoded by a nucleic acid under the control of a Gm-csf promoter, a TPO protein encoded by a nucleic acid under the control of a TPO promoter, and a Sirpa protein encoded by a nucleic acid under the control of a Sirpa promoter. In some such embodiments, the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and the non-human animal is heterozygous null for the non-human gene. In other embodiments, the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and the non-human animal is homozygous null for the non-human gene. In certain embodiments, the non-human animal expresses a human protein, e.g., a humanized protein, selected from the group consisting of: human TPO, e.g., humanized TPO; human IL-3, e.g., humanized IL-3; human GM-CSF, e.g., humanized GM-CSF; human EPO, e.g., humanized EPO; and human Sirpa, e.g., humanized Sirpa; and combinations thereof.

[0016] In some embodiments, the subject genetically modified non-human animal is a mouse having a genome comprising a nucleic acid sequence encoding a human protein, e.g., a humanized protein, e.g., a nucleic acid encoding human EPO, e.g., humanized EPO; human Sirpa, e.g., humanized Sirpa; human IL-3, e.g., humanized IL-3; human GM-CSF, e.g., humanized GM-CSF; human M-CSF, e.g., humanized M-CSF; human TPO, e.g., humanized TPO; human IL-6, e.g., humanized IL-6; etc., which is operably linked to its corresponding non-human animal promoter, e.g., Sirpa, IL-3, GM-CSF, M-CSF, TPO, or IL-6 promoter, respectively, wherein the animal expresses the encoded human protein and the native mouse protein. In other embodiments, the subject genetically modified non-human animal is a mouse having a genome comprising a nucleic acid sequence encoding a human protein, such as a humanized protein, such as a nucleic acid encoding human EPO, such as humanized EPO; human Sirpa, such as humanized Sirpa; human IL-3, such as humanized IL-3; human GM-CSF, such as humanized GM-CSF; human M-CSF, such as humanized M-CSF; human TPO, such as a nucleic acid encoding humanized TPO, which is operably linked to its corresponding non-human animal promoter, such as Sirpa, IL-3, GM-CSF, M-CSF, or TPO promoter, respectively, wherein the animal expresses the encoded human protein and does not express native mouse protein. Thus, in some embodiments, the genetically modified non-human animal is a mouse and the mouse is heterozygous for some or all of the human genes disclosed herein, such as humanized genes. In some embodiments, the genetically modified non-human animal is a mouse and the mouse is homozygous for some or all of the human genes disclosed herein, such as humanized genes.

[0017] In some embodiments, the subject non-human animal is immunodeficient with respect to the endogenous immune system. In some such embodiments, the immunodeficiency is caused by a deficiency in one or both of Rag2 and IL2rg.

[0018] In some embodiments, the subject genetically modified immunodeficient non-human animal further comprises an implantation of human hematopoietic cells. In some such embodiments, the human hematopoietic cells comprise one or more cells selected from the group consisting of human CD34 positive cells, human hematopoietic stem cells, human myeloid cell precursor cells, human erythroid precursor cells, human myeloid cells, human dendritic cells, human monocytes, human granulocytes, human erythrocytes, human neutrophils, human mast cells, human thymocytes, and human B lymphocytes.

[0019] As demonstrated in the examples herein, genetically modified immunodeficient non-human animals transplanted with human hematopoietic cells comprising nucleic acid sequences encoding human EPO proteins operably linked to the EPO promoter at the endogenous locus exhibit high levels of human erythropoiesis in the bone marrow and 2 to 5 times higher human cells of the erythroid lineage in the bone marrow compared to control mice that do not express human EPO. In some embodiments, genetically modified immunodeficient non-human animals transplanted with human hematopoietic cells comprising nucleic acid sequences encoding human EPO proteins operably linked to the EPO promoter at the endogenous locus exhibit high levels of human erythropoiesis in the bone marrow and about 2 to about 10 times higher human cells of the erythroid lineage in the bone marrow compared to control mice that do not express human EPO, such as about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times, or about 10 times higher human cells of the erythroid lineage in the bone marrow compared to control mice that do not express human EPO. As such, in some embodiments, the subject is engrafted, the genetically modified immunodeficient animal comprises a bone marrow in which 20% or more of the erythroid cells (CD235+) are human erythroid cells. In some embodiments, the subject is engrafted, the genetically modified immunodeficient animal comprises a bone marrow in which about 10% or more, e.g., about 20% or more, about 30% or more, about 40% or more, or about 50% or more of the erythroid cells (CD235+) are human erythroid cells.

[0020] In some such embodiments, the subject genetically modified animal is an immunodeficient mouse comprising a nucleic acid encoding a human EPO protein operably linked to a non-human animal EPO promoter at a non-human animal EPO locus, a nucleic acid encoding a human TPO protein operably linked to a non-human animal TPO promoter at a non-human animal TPO locus, a nucleic acid encoding a human Il-3 protein operably linked to a non-human animal Il-3 promoter at a non-human animal Il-3 locus, a nucleic acid encoding a human GM-CSF protein operably linked to a GM-CSF promoter at a non-human animal GM-CSF locus, and a nucleic acid encoding a human M-CSF protein operably linked to a non-human animal M-CSF promoter at a non-human animal M-CSF locus, e.g., Rag2. - / - IL y / - Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h ("MITER-G") mice.

[0021] In some such embodiments, the subject genetically modified animal is an immunodeficient mouse comprising a nucleic acid encoding a human EPO protein operably linked to a non-human animal EPO promoter at a non-human animal EPO locus, a nucleic acid encoding a human TPO protein operably linked to a non-human animal TPO promoter at a non-human animal TPO locus, a nucleic acid encoding a human 11-3 protein operably linked to a non-human animal 11-3 promoter at a non-human animal 11-3 locus, a nucleic acid encoding a human GM-CSF protein operably linked to a GM-CSF promoter at a non-human animal GM-CSF locus, and a nucleic acid encoding a human M-CSF protein operably linked to a non-human animal M-CSF promoter at a non-human animal M-CSF locus, and a nucleic acid encoding a human SIRPα protein operably linked to a non-human animal SIRPα promoter randomly integrated into the genome of the non-human animal, e.g., Rag2. - / - IL y / - Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h hSIRPα + In other such embodiments, a nucleic acid encoding a human SIRPα protein, e.g., a humanized SIRPα protein, is operably linked to a non-human animal SIRPα promoter at a non-human animal locus, e.g., Rag2 - / - IL y / - Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h SIRPα h / h ("SupER-G") mice.

[0022] In some such embodiments, the subject genetically modified animal is an immunodeficient mouse comprising one allele of a nucleic acid encoding a human EPO protein operably linked to a non-human animal EPO promoter at a non-human animal EPO locus (i.e., the mouse is heterozygous for human EPO), a nucleic acid encoding a human SIRPα protein, e.g., a humanized SIRPα protein, operably linked to a non-human animal SIRPα promoter at a non-human animal SIRPα locus, a nucleic acid encoding a human TPO protein operably linked to a non-human animal TPO promoter at a non-human animal TPO locus, a nucleic acid encoding a human Il-3 protein operably linked to a non-human animal Il-3 promoter at a non-human animal Il-3 locus, and a nucleic acid encoding a human GM-CSF protein, e.g., Rag2, operably linked to a GM-CSF promoter at a non-human animal GM-CSF locus. - / - IL y / - Tpo h / h Il3 h / h Gm-csf h / h Epo h / m SIRPα h / h ("TIES") mice.

[0023] In some embodiments, genetically modified immunodeficient non-human animals transplanted with human hematopoietic cells comprising a nucleic acid sequence encoding a human EPO protein operably linked to an EPO promoter at an endogenous locus can exhibit better survival and human erythrocyte engraftment when they contain only one copy of a nucleic acid sequence encoding an EPO protein, and when they contain endogenous M-csf. This is because the high level of human myeloid cell engraftment supported by the human M-CSF in the knock-in leads to the destruction of mouse red blood cells, which in turn causes anemia and death in the transplanted mice. In addition, heterozygosity for human EPO alleles improves fertility, developmental capacity, and survival relative to mice that are homozygous for human EPO and null for mouse EPO. As such, in some embodiments, the subject transplanted, genetically modified immunocompromised animals are superior to mice that constitutively express EPO, such as transgenic mice, or mice that contain two copies of human EPO, such as EPO h / h In some such embodiments, the genetically modified immunodeficient non-human animal is a TIES mouse (Rag2 - / - IL y / - Tpo h / h Il3 h / h Gm-csf h / h Epo h / m SIRPα h / h ).

[0024] In some embodiments, a genetically modified immunodeficient non-human animal injected with clodronate liposomes and engrafted with human hematopoietic cells shows a 1000-fold increase in the number of human red blood cells (CD235+) in the peripheral blood compared to an uninjected animal. In some embodiments, a genetically modified immunodeficient non-human animal injected with clodronate liposomes and engrafted with human hematopoietic cells shows an increase of about 10 times or more, about 50 times or more, about 100 times or more, about 500 times or more, or about 1000 times or more in the number of human red blood cells (CD235+) in the peripheral blood compared to an uninjected animal. Of these human red blood cells, 10% or more, 20% or more, 30% or more, 40% or more, or 50% or more can be reticulocytes (erythroid precursors, CD71+). As such, in some embodiments, the subject engrafted, genetically modified immunodeficient animal comprises peripheral blood in which 1% or more, e.g., 5% or more or 10% or more of the erythroid cells (CD235+) are human erythrocytes, and 10% or more, e.g., 20% or more, 30% or more, 40% or more, or 50% or more of those human erythrocytes are human reticulocytes (CD71+). In some such embodiments, the subject engrafted, genetically modified immunodeficient non-human animal is a MISTER-G mouse, a SupER-G mouse, or a TIES mouse.

[0025] In some embodiments, the non-human animal further comprises a pathogen infection of a human cell of a targeted erythroid lineage. In some such embodiments, the pathogen is selected from Plasmodium sp., Babesia sp., and Theileri sp. In some embodiments, the infection is produced by injecting a parasite into a non-human animal. In some embodiments, the infection is produced by injecting a human red blood cell infected by a parasite into a non-human animal. In some embodiments, the infection is produced by injecting a human red blood cell infected by a parasite and a healthy human red blood cell into a non-human animal.

[0026] In some aspects of the invention, methods are provided for identifying agents that inhibit infection by pathogens that target human cells of the erythroid lineage.

[0027] In some embodiments, the method comprises administering a candidate agent to a genetically modified non-human animal, wherein the animal comprises a nucleic acid sequence encoding a human EPO protein operably linked to an EPO gene promoter, one or more gene mutations that cause immunodeficiency in the non-human animal, engraftment of human hematopoietic cells, and infection with a pathogen that targets human cells of the erythroid lineage; and determining whether the agent reduces the amount of the pathogen in the pathogen-infected non-human animal.

[0028] In some embodiments, the method comprises contacting a genetically modified immunodeficient non-human animal implanted with human hematopoietic cells comprising a nucleic acid sequence encoding a human EPO protein operably linked to an EPO gene promoter with clodronate; administering a candidate agent to the non-human animal contacted with clodronate; injecting the genetically modified non-human animal with parasite-infected reticulocytes or erythrocytes; and determining whether the agent prevents infection of human reticulocytes and / or erythrocytes in the non-human animal.

[0029] In some embodiments, the pathogen is selected from Plasmodium, Babesia, and Theileria. In some such embodiments, the pathogen is selected from Plasmodium falciparum and Plasmodium vivax. In some embodiments, the non-human animal is a mammal. In some such embodiments, the mammal is a rodent. In certain such embodiments, the rodent is a mouse.

[0030] In some aspects of the present invention, a method for generating a mouse expressing human EPO is provided. In some embodiments, the method includes contacting mouse pluripotent stem cells with a nucleic acid sequence comprising a coding sequence of a human EPO protein or its fragment operably connected to an EPO promoter sequence, wherein the coding sequence and the EPO promoter sequence form a box flanked by a sequence homologous to an endogenous mouse EPO locus; The pluripotent stem cells are cultivated under conditions that promote the integration of the nucleic acid sequence into the mouse genome at the endogenous mouse EPO locus by homologous recombination; and mice are generated from mouse pluripotent stem cells comprising a nucleic acid sequence encoding human EPO protein.

[0031] In some embodiments, the mouse pluripotent stem cells are embryonic stem (ES) cells or induced pluripotent stem (iPS) cells. In some embodiments, the mouse pluripotent stem cells are defective for Rag2 and / or IL2rg. In some embodiments, the EPO promoter sequence is the sequence of the human EPO promoter. In other embodiments, the EPO promoter sequence is the sequence of the endogenous non-human EPO promoter. In some embodiments, the integration results in the replacement of the non-human EPO gene at the non-human EPO gene locus. In some embodiments, the nucleic acid sequence encoding human EPO protein comprises human EPO genome coding and non-coding sequences. In some embodiments, the nucleic acid sequence encoding human EPO protein comprises human EPO cDNA sequence.

[0032] In some aspects of the present invention, a method for generating a mouse expressing human EPO protein and comprising a human hematopoietic system is provided. In some embodiments, the method comprises transplanting a cell colony comprising human hematopoietic progenitor cells into a genetically modified immunodeficient mouse generated by the method of the present disclosure. In some embodiments, the transplant comprises tail vein injection, fetal liver injection, or retroorbital injection. In some embodiments, the genetically modified immunodeficient mouse is subjected to sublethal irradiation before transplantation. In some embodiments, the transplanted human hematopoietic progenitor cells are CD34+ cells. In some embodiments, the human hematopoietic progenitor cells are from fetal liver, adult bone marrow, or umbilical cord blood.

[0033] In some aspects of the present invention, a method for generating mice infected by human pathogens of human cells targeting erythroid lineage is provided. In some embodiments, the method comprises generating mice expressing human EPO protein and comprising a human hematopoietic system according to the method of the present disclosure, injecting clodronate into the transplanted mice, and injecting human red blood cells (PRBC) infected by parasites into the mice injected with clodronate. In some embodiments, the method further comprises injecting healthy human red blood cells into the mice. In some embodiments, the parasite is selected from Plasmodium, Babesia, and Theileria. In certain embodiments, the Plasmodium is selected from Plasmodium falciparum and Plasmodium vivax. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The present invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It should be emphasized that, in accordance with convention, the various features of the drawings are not to scale. On the contrary, the size of the various features is arbitrarily expanded or reduced for clarity. The following figures are included in the accompanying drawings.

[0036] Figure 1 A protein alignment of mouse EPO (SEQ ID NO: 2) and human EPO (SEQ ID NO: 4) is provided. The underlined residues are conserved between the two species.

[0037] Figure 2 A schematic diagram of the wild-type mouse EPO locus before and after knock-in of the nucleic acid sequence encoding human EPO is provided.

[0038] Figure 3 A schematic diagram of the human EPO knock-in allele is provided.

[0039] Figure 4 Schematic representation of the wild-type mouse Sirpa locus before (top) and after (bottom) knock-in of the nucleic acid sequence encoding humanized Sirpa is provided.

[0040] Figure 5, Panels A and B, show the frequency of human erythrocytes in HSC-engrafted mice. (Panel A) HSC-engrafted mice contain the indicated combinations of human EPO expressed from the mouse EPO locus ("hEPO+") and / or human SIRPa expressed as random integrants in the mouse genome ("hSIRPa+"), Rag2 - / - Iq - / - Tpo h / h IL3 h / h G h / h Mcsf h / h Human CD235a in the bone marrow of mice ("MITRG mice") after 6-8 weeks + (Panel B) Rag2 in HSCs in the presence of hEPO compared to in the absence of hEPO - / - Iq 无效 Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h SIRPα h / h ("SupER-G") mice compared to Rag2 - / - Iq 无效 Tpo h / h Il3 h / h G h / h Sirpa h / h Human CD235a in peripheral blood of ("RGSKI-TI") control mice 6-8 weeks later + The frequency of red blood cells.

[0041] Figure 6 , Panels A and B, demonstrate that clodronate treatment increases circulating human erythrocytes and reticulocytes in HSC-engrafted mice. Seven weeks after HSC engraftment, SupER-G mice were treated with daily retro-orbital injections of 50 μl of clodronate liposomes for 3-5 consecutive days. Human CD235 in peripheral blood was measured by FACS. + Cells (erythrocytes and reticulocytes) (Panel A) and CD235 + / CD71 + Frequency of cells (reticulocytes) (Panel B). Panel B: Three different mice after treatment with clodronate.

[0042] Figure 7, Panels AC, illustrate how human RBCs generated from engrafted mice are susceptible to P. falciparum infection. SupER-G mice were engrafted with fetal liver or adult HSCs. Seven weeks after engraftment, mice were treated with daily retro-orbital injections of 50 μl of clodronate liposomes for 3 consecutive days, after which blood was collected. The blood samples were then co-cultured with purified P. falciparum 3D7 blood-stage parasite-infected RBCs (99% purity). Fresh human RBCs were added to the cultures 48 hours after infection and the infected cultures were maintained for an additional 10 days. Giemsa staining and quantitative PCR were performed to quantify parasitemia. Human RBC control: human RBC; mouse RBC control: RBC from non-engrafted mice; mouse RBC spiking control: RBC from non-engrafted mice spiking with 0.1% hRBC. In panel A, red: anti-human Band3; blue: Hoechst. In panel C, the legend identifiers listed from top to bottom correspond to the bar chart x-axes from left to right.

[0043] Figure 8 Shown is the destruction of human RBCs in the peripheral blood of mice in the absence of clodronate. Untransplanted mice were treated with clodronate or PBS. For clodronate treatment, mice received daily retro-orbital injections of 50 μl clodronate for 3 consecutive days. For PBS treatment, 500 μl PBS was delivered just 1 hour before human RBC transfusion. Human RBCs were transfused into pre-treated mice and peripheral blood was collected at the indicated time points. Clodronate and PBS curves are shown. DETAILED DESCRIPTION OF THE INVENTION

[0045] Genetically modified non-human animals expressing human EPO from animal genomes are provided. Also provided are methods for generating non-human animals expressing human EPO from non-human animal genomes, and methods for using non-human animals expressing human EPO from non-human animal genomes. These animals and methods have many uses in the art, including, for example, modeling of human erythropoiesis and erythrocyte function; modeling of human pathogen infection of erythrocytes; in vivo screening of agents regulating erythropoiesis and / or erythrocyte function, for example, in a healthy or diseased state; in vivo screening of agents toxic to erythrocytes or erythrocyte ancestors; in vivo screening of agents that prevent, mitigate, or reverse the toxic effects of toxic agents on erythrocytes or erythrocyte ancestors; in vivo screening of erythrocytes or erythrocyte ancestors from individuals to predict individual responsiveness to disease therapy. These and other objects, advantages, and features of the present invention will become apparent to those skilled in the art after reading the details of the compositions and methods described more fully below.

[0046] Before describing the present methods and compositions, it should be understood that the present invention is not limited to the specific methods and compositions described, as such may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims. The present invention is not limited to the specific embodiments discussed, but is described by the claims that allow it.

[0047] Unless the context clearly indicates otherwise, where a numerical range is provided, it is understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed, with intervals of one-tenth of the unit of the lower limit. Each smaller range between any stated or intermediate value in the stated range and any other stated or intermediate value in the stated range is encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded in the range, and each range in which any, none or both of the upper and lower limits are included in the smaller range is also encompassed within the present invention, subject to any specifically excluded upper and lower limits in the stated range. In the case where the stated range includes one or both of the upper and lower limits, the range excluding one or both of the upper and lower limits is also encompassed in the present invention.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the invention belongs. Although any method and material similar or equivalent to the method and material described herein can be used in the implementation or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are included herein by reference to disclose and describe the methods and / or materials related to the publications cited. It should be understood that in the event of a conflict, the present disclosure replaces any conflicting disclosures of the publications collected.

[0049] As will be apparent to those skilled in the art after reading this disclosure, each individual embodiment described and illustrated herein has discrete components and features that can be readily separated or combined with the features of any other several embodiments without departing from the scope or spirit of the invention. Any recited method may be carried out in the order of events recited or in any other order that is logically possible.

[0050] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the peptide" includes reference to one or more peptides and equivalents thereof known to those skilled in the art, such as polypeptides, and so forth.

[0051] The publications discussed herein are provided only as of the date of their disclosure as of the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by virtue of prior invention. Furthermore, the publication dates provided may be different from the actual publication dates and may need to be independently confirmed.

[0052] Genetically modified non-human animals

[0053] In one aspect of the present invention, non-human animals are provided that are genetically modified and express one or more human proteins from their genome. In some aspects of the present invention, the human protein is human erythropoietin (hEPO) protein (SEQ ID NO:4). In other words, the genetically modified non-human animal comprises a nucleic acid sequence encoding human EPO (hEPO) protein in its genome. For example, the non-human animal can include a nucleic acid sequence comprising human EPO genome coding and non-coding sequences in its genome, such as a sequence or part thereof at chromosome 7 nucleotides 100318423-100321323. Alternatively, the non-human animal can include a nucleic acid sequence comprising human EPO cDNA sequence (SEQ ID NO:3) or part thereof in its genome. In some cases, the non-human animal is further genetically modified to express one or more other human proteins from the genome of the non-human animal. In some such embodiments, the one or more additional human proteins are human proteins that promote human hematopoietic cell development and / or function, such as human signal regulatory protein alpha (hSIRPa) protein (NCBI Gene ID: 140885, GenBank Accession Nos. NM_080792.2, NM_001040022.1, NM_001040023.1), human interleukin 3 (hIL-3) protein (NCBI Gene ID: 3562, GenBank Accession No. NM_000588.3), human colony stimulating factor 2 (granulocyte-macrophage) (hGM-CSF) protein (NCBI Gene ID: 1437, GenBank Accession No. NM_000758.3), human colony stimulating factor 1 (macrophage) (hM-CSF) protein (NCBI Gene ID: 1 435, GenBank accession numbers NM_000757.5, NM_172210.2, NM_172211.3, and NM_172212.2), human thrombopoietin (hTPO) protein (NCBI Gene ID: 7066, GenBank accession numbers NM_000460.3, NM_001177597.2, NM_001177598.2 , NM_001289997.1, NM_001290003.1, NM_001290022.1, NM_001290026.1, NM_001290027.1, NM_001290027.1), human interleukin 6 (hIL6) protein (NCBI gene ID: 3569, GenBank accession number NM_000600.3), etc.

[0054] The skilled artisan will appreciate that, in addition to "wild-type" or "natural" human nucleic acids and proteins, the terms "human nucleic acids" and "human proteins" also encompass variants of wild-type human nucleic acids and proteins. As used herein, the term "variant" defines an isolated naturally occurring genetic mutant of a human polypeptide or nucleic acid sequence or a recombinantly produced variation of a human polypeptide or nucleic acid sequence, each of which contains one or more mutations compared to the corresponding wild-type human nucleic acid or polypeptide sequence. For example, such mutations may be one or more amino acid substitutions, additions, and / or deletions. The term "variant" also includes human homologs and orthologs. In some embodiments, the variant polypeptides of the present invention have 70% or more identity, such as 75%, 80%, or 85% or more identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a wild-type human polypeptide.

[0055] The percent identity between two sequences can be determined using any convenient technique in the art (e.g., aligning sequences, using, for example, well-known and available software). Mutations can be introduced using standard molecular biology techniques (such as site-directed mutagenesis, PCR-mediated mutagenesis, directed evolution, etc.). One skilled in the art will recognize that one or more nucleic acid substitutions can be introduced without changing the amino acid sequence, and one or more amino acid mutations can be introduced without changing the functional properties of the human protein.

[0056] Conservative amino acid substitutions can be made in human proteins to generate human protein variants. Conservative amino acid substitutions refer to the recognized substitution of one amino acid for another amino acid with similar characteristics. For example, each amino acid can be described as having one or more of the following characteristics: electropositive, electronegative, aliphatic, aromatic, polar, hydrophobic, and hydrophilic. Conservative substitutions are substitutions of one amino acid with a specified structural or functional characteristic for another amino acid with the same characteristic. Acidic amino acids include aspartic acid, glutamic acid; basic amino acids include histidine, lysine, arginine; aliphatic amino acids include isoleucine, leucine, and valine; aromatic amino acids include phenylalanine, glycine, tyrosine, and tryptophan; polar amino acids include aspartic acid, glutamic acid, histidine, lysine, asparagine, glutamine, arginine, serine, threonine, and tyrosine; and hydrophobic amino acids include alanine, cysteine, phenylalanine, glycine, isoleucine, leucine, methionine, proline, valine, and tryptophan; and conservative substitutions include substitutions between amino acids within each group. Amino acids may also be described in terms of relative size, with alanine, cysteine, aspartic acid, glycine, asparagine, proline, threonine, serine, and valine generally considered to be smaller.

[0057] The human variant may comprise synthetic amino acid analogs, amino acid derivatives and / or non-standard amino acids, illustratively including but not limited to α-aminobutyric acid, citrulline, canavanine, cyanoalanine, diaminobutyric acid, diaminopimelic acid, dihydroxyphenylalanine, leucine, homoarginine, hydroxyproline, norleucine, norvaline, 3-phosphoserine, homoserine, 5-hydroxytryptophan, 1-methylhistidine, methylhistidine, and ornithine.

[0058] Human variants will typically be encoded by nucleic acids with a high degree of identity to nucleic acids encoding wild-type human proteins. In some embodiments, the complement of nucleic acids encoding human variants specifically hybridizes with nucleic acids encoding wild-type humans under high stringency conditions. Nucleic acids encoding human variants can be isolated or recombined or synthesized using known methods.

[0059] In addition to "wild-type" or "natural" human proteins and "variants" thereof, as used herein, for example, in the context of "human EPO protein (hEPO)", "human SIRPα protein (hSIRPα)", "human IL-3 protein (hIL-3)", "human GM-CSF protein (hGM-CSF)", "human M-CSF protein (hM-CSF)", "human TPO protein (hTPO)", and "human IL-6 protein (hIL-6)", the term "human protein" encompasses fusion proteins, i.e., chimeric proteins, which include one or more fragments of a wild-type human protein (or a variant thereof) and retain one or more functions of the wild-type human protein, such as one or more signaling and / or receptor functions. Fusion proteins comprising one or more fragments of a wild-type human protein (or a variant thereof) (e.g., in combination with one or more non-human peptides or polypeptides) may also be referred to herein as "humanized proteins". Thus, the term "human SIRPα protein" encompasses, for example, a protein comprising the amino acid sequence of the extracellular domain of a wild-type human SIRPα protein fused to the signaling domain of a wild-type mouse SIRPα protein.

[0060] Therefore, the nucleic acid sequence encoding a human protein is a polynucleotide comprising a human protein, such as a wild-type human protein, a variant of a wild-type human protein, a fragment of a wild-type human protein (or its variant) that retains one or more functions of the wild-type human protein, such as one or more signal transduction and / or receptor functions, or a fusion protein comprising one or more fragments of a wild-type human protein (or its variant) and retaining one or more functions of the wild-type human protein, such as one or more signal transduction and / or receptor functions, such as a chimeric protein.

[0061] Typically, in the genetically modified animals of the present disclosure, nucleic acids encoding human proteins, such as hEPO protein, hSIRPa protein, hIL-3 protein, hGM-CSF protein, hM-CSF protein, hTPO protein, hIL-6 protein, etc., are operably linked to one or more DNA regulatory elements. DNA regulatory elements include transcriptional and translational control sequences that provide and / or regulate the expression of coding sequences in host cells, such as promoters, enhancers, polyadenylation signals, terminators, and the like. For example, "promoter" or "promoter sequence" refers to a DNA regulatory region that is capable of binding to RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The promoter sequence is bounded at its 3' end by the transcription start site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. Within the promoter sequence will be found the transcription start site as well as the protein binding domain responsible for RNA polymerase binding. Eukaryotic promoters often, but not always, contain a "TATA" box and a "CAT" box. Of particular interest to the present disclosure are DNA regulatory elements such as promoters that drive transcription of human proteins with the same spatial and temporal expression pattern (ie, in the same cells and tissues and at the same time as observed for the corresponding endogenous protein).

[0062] In some embodiments, the nucleic acid sequence encoding human protein in the subject non-human animal is operably connected to the human promoter of the gene, for example, if the human promoter promotes the correct space and time expression of human protein in non-human animals. Alternatively, the nucleic acid sequence encoding human protein in the subject non-human animal is operably connected to the non-human animal promoter from the corresponding non-human animal gene. Thus, for example, with respect to the non-human animal expressing hEPO protein, in some embodiments, the nucleic acid encoding hEPO protein is operably connected to the human EPO promoter. In other cases, the nucleic acid encoding human EPO protein is operably connected to the non-human EPO promoter. In other cases, the nucleic acid encoding human EPO protein is operably connected to the endogenous non-human EPO promoter.

[0063] In some cases, human protein is expressed from the corresponding gene locus in non-human animals. In some cases, the nucleic acid sequence encoding human protein replaces the nucleic acid sequence encoding the corresponding non-human animal protein. In other cases, human protein is expressed from the genomic loci other than the locus of the corresponding non-human gene in non-human animals. So, for example, with respect to the non-human animals expressing hEPO protein, in some embodiments, hEPO protein is expressed from the EPO locus of the non-human animal genome. In certain embodiments, non-human animals include the replacement of the nucleic acid sequence encoding endogenous EPO by the nucleic acid sequence encoding hEPO protein. In other embodiments, hEPO is expressed from the genomic loci other than the non-human animal EPO locus in non-human animals.

[0064] In some cases, genetically modified non-human animals include a copy of the nucleic acid sequence encoding human proteins. For example, non-human animals can be heterozygous for the nucleic acid sequence encoding human proteins, that is, an allele at the locus is genetically modified, and another allele is an endogenous allele. In other cases, genetically modified non-human animals include two copies of the nucleic acid sequence encoding human proteins. For example, non-human animals can be homozygous for the nucleic acid sequence encoding human proteins, that is, two alleles of the locus in the diploid genome are all genetically modified and encoding human proteins, such as two alleles The replacement of the nucleic acid sequence encoding endogenous proteins by the nucleic acid sequence encoding human proteins. In this way, for example, with respect to non-human animals expressing hEPO proteins, as discussed above, the nucleic acid sequence encoding hEPO can be integrated into the non-human animal EPO locus. In some such embodiments, the genetically modified non-human animal is heterozygous for a nucleic acid sequence encoding an hEPO protein, i.e., the genetically modified non-human animal comprises one allele comprising a nucleic acid encoding hEPO and one allele encoding endogenous EPO. In other words, the animal is EPO h / m Animals, where "h" represents an allele comprising a human sequence and "m" represents an endogenous allele. In other such embodiments, the genetically modified non-human animal is homozygous for a nucleic acid sequence encoding a hEPO protein, i.e., both alleles of the locus in the diploid genome will contain a nucleic acid sequence encoding a hEPO protein. In other words, the animal is an EPO h / h animal.

[0065] In some cases, the non-human animal also expresses corresponding non-human animal protein.For example, the nucleic acid sequence encoding human protein (such as hEPO) can be located in the genome of the animal except the locus (such as mEPO locus) of non-human animal gene.As a second example, the nucleic acid sequence encoding human protein (such as hEPO) can be located at the corresponding animal gene locus (such as mEPO locus), wherein it is integrated into the animal gene locus in a manner that allows the continuous expression of the animal coding sequence, for example, the human coding sequence inserts the upstream or downstream of the animal coding sequence and includes 2A peptide sequence or IRES sequence between the two coding sequences.As a third example, the nucleic acid sequence encoding human protein (such as hEPO) can be located at the corresponding animal gene locus (such as mEPO locus) in a manner that destroys the expression of the animal coding sequence, for example, as a replacement of part or the entire animal coding sequence, but the non-human animal is for insertion, i.e., "knock-in" allele breeding is heterozygous, i.e., carrying a knock-in allele and a wild-type allele.In other cases, the non-human animal does not express corresponding non-human animal protein. For example, a nucleic acid sequence encoding a human protein (e.g., hEPO) can be located at a corresponding animal gene locus (e.g., an mEPO locus) in a manner that disrupts expression of the animal coding sequence, e.g., by replacing part or all of the animal coding sequence, e.g., by replacing a non-human animal coding sequence, and the animal is homozygous for the insertion, i.e., the "knock-in" allele.

[0066] Any non-human mammal can be genetically modified according to the subject disclosure. Non-limiting examples include laboratory animals, livestock, livestock, etc., such as species such as mice, rodents, dogs, cats, pigs, horses, cattle, sheep, non-human primates, etc.; For example, mice, rats, rabbits, hamsters, guinea pigs, cattle, pigs, sheep, goats, and other transgenic animal species, particularly mammalian species, as known in the art. In other embodiments, the non-human animal can be a bird, such as Galliformes, such as chickens, turkeys, quails, pheasants, or partridges; such as Anseriformes, such as ducks, geese, or swans, such as Columbiformes, such as pigeons or doves. In various embodiments, the subject genetically modified animal is a mouse, rat or rabbit.

[0067] In one embodiment, the non-human animal is a mammal. In some such embodiments, the non-human animal is a small mammal, such as Dipodoidea or Muroidea. In one embodiment, the genetically modified animal is a rodent. In one embodiment, the rodent is selected from mice, rats, and hamsters. In one embodiment, the rodent is selected from Muroidea. In one embodiment, the genetically modified animal is from a family selected from the group consisting of Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, white-tailed rat, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from the group consisting of true mouse or rat (family Muridae), gerbil, spiny mouse, and mane rat.

[0068] In one embodiment, the subject genetically modified non-human animal is a rat. In one such embodiment, the rat is selected from Wistar rats, LEA strains, Sprague Dawley strains, Fischer strains, F344, F6, and Dark Agouti. In another embodiment, the rat strain is a mixture of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0069] In another embodiment, the subject genetically modified non-human animal is a mouse, such as a mouse of the C57BL strain (e.g., C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, C57BL / Ola, etc.). ); 129 strains of mice (e.g., 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2); BALB strains of mice (e.g., BALB / c); etc. See, e.g., Festing et al. (1999) Mammalian Genome 10:836, and also Auerbach et al. (2000) Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines. In one embodiment, the genetically modified mouse is a mixture of the aforementioned 129 strain and the aforementioned C57BL / 6 strain. In another embodiment, the mouse is a mixture of the aforementioned 129 strain, or a mixture of the aforementioned BL / 6 strain. In another embodiment, the mouse is a mixture of the BALB strain and another aforementioned strain.

[0070] In some embodiments, the subject genetically modified non-human animal is also immunodeficient. "Immunodeficiency" includes defects in one or more aspects of the natural or endogenous immune system of the animal, for example, the animal is defective in one or more types of functioning host immune cells, such as non-human B cell number and / or function, non-human T cell number and / or function, non-human NK cell number and / or function, etc.

[0071] One method of achieving immunodeficiency in a subject animal is sublethal irradiation. Alternatively, immunodeficiency can be achieved by any of a variety of gene mutations known in the art, any of which can be used alone or in combination to breed the subject genetically modified non-human animals of this disclosure, or can be used as a source of genetically modified stem cells into which the subject disclosure is introduced. Non-limiting examples include X-linked SCID associated with IL2RG gene mutations and characterized by a lymphocyte phenotype of T(-)B(+)NK(-); autosomal recessive SCID associated with Jak3 gene mutations and characterized by a lymphocyte phenotype of T(-)B(+)NK(-); ADA gene mutations characterized by a lymphocyte phenotype of T(-)B(-)NK(-); IL-7Rα chain mutations characterized by a lymphocyte phenotype of T(-)B(+)NK(+); mutation; CD3δ or ε mutation characterized by lymphocyte phenotype T(-)B(+)NK(+); RAG1 and RAG2 mutation characterized by lymphocyte phenotype T(-)B(-)NK(+); Artemis gene mutation characterized by lymphocyte phenotype T(-)B(-)NK(+); CD45 gene mutation characterized by lymphocyte phenotype T(-)B(+)NK(+); and Prkdc gene mutation characterized by lymphocyte phenotype T(-)B(-) scid As such, in some embodiments, the genetically modified immunodeficient non-human animal has one or more selected from the group consisting of IL2 receptor gamma chain Deficiency, Jak3 deficiency, ADA deficiency, IL7R deficiency, CD3 deficiency, RAG1 and / or RAG2 deficiency, Artemis deficiency, CD45 deficiency, and Prkdc deficiency. The skilled artisan will be aware of these and other animal models of immunodeficiency, any of which can be used to generate immunodeficient animals of the present disclosure.

[0072] In some embodiments, the genetically modified non-human animals according to the present invention can be used as recipients of human hematopoietic cells capable of generating human immune cells from the transplanted human hematopoietic cells. As such, in some aspects of the present invention, the subject genetically modified animals are genetically modified, immunodeficient, non-human animals transplanted with human hematopoietic cells.

[0073] Any source of human hematopoietic cells, human hematopoietic stem cells (HSCs) and / or hematopoietic stem progenitor cells (HSPCs) known in the art or described herein can be transplanted into the genetically modified immunodeficient non-human animals of the present disclosure. One suitable source of human hematopoietic cells known in the art is human umbilical cord blood cells, particularly CD34 positive (CD34 +) cells. Another source of human hematopoietic cells is human fetal liver. Another source is human bone marrow. Also contemplated are induced pluripotent stem cells (iPSCs) and induced hematopoietic stem cells (iHSCs) generated by somatic cell dedifferentiation (e.g., by methods known in the art). Methods for transplanting human cells into non-human animals are well described in the art and elsewhere herein, and a person of ordinary skill can employ any of them to obtain the subject genetically modified, transplanted non-human animals.

[0074] The transplanted human hematopoietic cells produce one or more human cells selected from human CD34 positive cells, human hematopoietic stem cells, human hematopoietic cells, myeloid cell progenitor cells, erythroid progenitor cells, myeloid cells, dendritic cells, monocytes, neutrophils, mast cells, erythrocytes, and combinations thereof in the genetically modified non-human animal. In one embodiment, the human cells are present at 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months after transplantation. In a specific embodiment, the human cells comprise cells of the erythroid lineage.

[0075] In some embodiments, the transplanted human hematopoietic cells produce an engrafted human hematopoietic-lymphatic system in a genetically modified non-human animal comprising human hematopoietic stem cells and progenitor cells, human myeloid cell progenitor cells, human myeloid cells, human dendritic cells, human monocytes, human granulocytes, human neutrophils, human mast cells, human erythrocytes, human thymocytes, human T cells, human B cells, and human platelets. In one embodiment, the human hematopoietic-lymphatic system is present at 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months after engraftment. In a specific embodiment, the human hematopoietic-lymphatic system comprises cells of the erythroid lineage.

[0076] Cells of the erythroid lineage include red blood cells and cells that produce red blood cells. "Red blood cells" include mature red blood cells, also known as erythrocytes or erythrocytes. Cells that produce red blood cells include erythrocyte progenitor cells, i.e., proliferating pleiotropic cells, and erythrocyte precursors, i.e., proliferating or non-proliferating cells that are destined to become red blood cells.

[0077] Red blood cells are the main cellular component of circulating blood and transport oxygen as their main function. The number of red blood cells per cubic millimeter of blood is normally maintained at 4.5 to 5.5 million in men and 4.2 to 4.8 million in women. It varies with age, activity, and environmental conditions. For example, it rises to 8 million / mm 3Levels of erythrocytes normally occur at altitudes above 10,000 feet above sea level. Red blood cells normally survive 110 to 120 days, at which time they are removed from the bloodstream and destroyed by the reticuloendothelial system. New red blood cells are produced at a rate of slightly more than 1% per day; this level is usually maintained at a constant level. Acute blood loss, hemolytic anemia, or chronic oxygen deprivation can cause a greatly increased erythrocyte production.

[0078] Erythrocytes are derived from hematopoietic stem cells in the bone marrow of long bones and develop into erythrocytes through successive cell stages, including common myeloid cell progenitors (CD123+, CD34+, c-kit+, Flt3+); megakaryocyte-erythroid progenitors (CD34+, CD38+, CD45RA-); proerythroblasts (also called pronormoblasts (if normal) or promegablasts (if abnormal); large CD71+, EpoR+, c-kit+, Ter119+ progenitors) ; basophilic erythroblast (cytoplasm is basophilic, nucleus is large with clumped chromatin, and nucleolus has disappeared); polychromatic erythroblast (also called intermediate normoblast, in which nuclear chromatin shows increased clumping and the cytoplasm begins to acquire hemoglobin and takes on an eosinophilic color); normochromic normoblast (the final stage before loss of nucleus, in which the nucleus is small and eventually becomes a blue-black homogenous structureless mass); and reticulocyte (circulating CD235+, CD71+ cell; the cell is characterized by a reticular pattern of threads and granules where the nucleus used to be).

[0079] Mature erythrocytes appear on peripheral smears as biconcave, round or oval discs, approximately 6-8 μm in diameter. They contain hemoglobin and have a central pale area due to the concavity of the cell's bifacets, and can be easily identified by flow cytometry or immunohistochemistry-based methods by elevated expression of the cell surface markers CD235 and CD59 relative to non-erythroid cells.

[0080] For example, the content of this disclosure Figure 5 Small Figure A and Figure 5 As shown in panel B, expression of hEPO from the genome of the transplanted non-human animal of the present disclosure under the control of the EPO promoter increases the number of human cells of the erythroid lineage (CD235a+) in the bone marrow by an average of about 2-fold (e.g., from about 11% to about 22%). Expression of human Sirpa enhances this effect, resulting in an average increase of 3-fold or more (i.e., from about 11% to about 33%) in the proportion of human CD235a+ cells in the bone marrow compared to animals that do not express either human EPO or human Sirpa ( Figure 5 Panel A). As such, the hEPO-expressing engrafted, immunodeficient, genetically modified non-human animals of the present disclosure can be used to study human erythropoiesis and develop drugs that modulate (eg, promote or suppress) human erythropoiesis.

[0081] In addition, such as Figure 6 As shown in Figure 2, clodronate-treated animals engrafted with human HSC expressing hEPO showed a significant decrease in the number of CD235+ erythroid cells (including CD71+ reticulocytes, Figure 6 , panel B) increased 1000-fold, i.e. to about 1% of the total erythrocytes in the periphery. Importantly, as for example Figure 7 As shown in , human erythrocytes generated at these levels of engraftment in HSC-transplanted animals expressing human EPO are susceptible to infection with Plasmodium falciparum. As such, the genetically modified non-human animals expressing hEPO described herein are particularly useful for generating animal models of parasitic infections (e.g., pathogens that cause malaria or malaria-like diseases) that target human cells of the erythroid lineage.

[0082] Thus, in some aspects of the invention, the subject genetically modified animal is a non-human animal into which human hematopoietic cells are transplanted and which contains a human pathogen infection. Of particular interest in these embodiments are human pathogens that target human cells of the erythroid lineage. Non-limiting examples of such pathogens include protozoa of the genera Plasmodium, Babesia, Theileria, etc. As described in more detail below, any suitable method known in the art or described herein for infecting animals with pathogens of interest can be used to infect the subject genetically modified non-human animal transplanted with human hematopoietic cells with human pathogens. Animals so infected will typically show signs of parasitemia, including altered morphology shown in Giemsa-stained blood smears, and a dramatic reduction (e.g., 50%) in total red blood cell concentration and anemia.

[0083] Methods of generating subject genetically modified mice

[0084] In some aspects of the invention, methods for producing the subject non-human animals of this disclosure are provided. When implementing the subject method, a non-human animal comprising a nucleic acid sequence encoding hEPO protein operably connected to an EPO promoter (e.g., a non-human animal EPO promoter, e.g., at an EPO locus of a non-human animal genome) is generated.

[0085] The production of a non-human animal comprising a nucleic acid sequence encoding a hEPO protein operably linked to an EPO promoter can be achieved using any convenient method for producing genetically modified animals, e.g., as known in the art or as described herein.

[0086] For example, the nucleic acid encoding hEPO protein can be incorporated into a recombinant vector in the following form, and the form is suitable for inserting into the host cell genome and expressing the human protein in a non-human host cell. In various embodiments, the recombinant vector comprises one or more regulatory sequences operably connected to the nucleic acid encoding human protein in the following manner, and the manner allows the nucleic acid to be transcribed into mRNA and the mRNA to be translated into human protein, as described above. It should be understood that the design of the carrier can depend on factors such as the selection of the host cell to be transfected and / or the amount of the human protein to be expressed.

[0087] Then, any of a variety of methods can be used to introduce the human nucleic acid sequence into animal cells to generate a genetically modified animal expressing the human gene. Such techniques are well known in the art and include, but are not limited to, pronuclear microinjection, transformation of embryonic stem cells, homologous recombination and knock-in techniques. Methods for generating genetically modified animals that can be used include, but are not limited to, those described in Sundberg and Ichiki (2006, Genetically Engineered Mice Handbook, CRC Press), Hofker and van Deursen (2002, Genetically Modified Mouse Methods and Protocols, Humana Press), Joyner (2000, Gene Targeting: A Practical Approach, Oxford University Press), Turksen (2002, Embryonic stem cells: Methods and Protocols in Methods Mol Biol., Humana Press), Meyer et al. (2010, Proc. Nat. Acad. Sci. USA 107: 15022-15026), and Gibson (2004, A Primer Of Genome Science 2nd Edition Sunderland, Massachusetts: Sinauer), U.S. Pat. No. 6,586,251, Rathinam et al. (2011, Blood 118:3119-28), Willinger et al. (2011, Proc Natl Acad Sci USA, 108:2390-2395), Rongvaux et al. (2011, Proc Natl Acad Sci USA, 108:2378-83) and Valenzuela et al. (2003, Nat Biot 21:652-659).

[0088] For example, the subject genetically modified animal can be created by introducing nucleic acid encoding human protein into oocyte (for example, by microinjection), and allowing oocyte to grow in female pregnant animals. In a preferred embodiment, the expression construct is injected into the fertilized oocyte. The fertilized oocyte can be collected from the female of excessive ovulation on that day after mating, and the expression construct is injected. The oocyte after injection is cultured overnight or directly transferred into the oviduct of 0.5 day pc pseudo-pregnant female. For excessive ovulation, harvesting oocyte, expression construct injection and embryo transfer methods are known in the art, and are recorded in Manipulating the Mouse Embryo (2002, A Laboratory Manual, the 3rd edition, Cold Spring Harbor Laboratory Press). The presence of nucleic acid introduced can be assessed by DNA analysis (for example PCR, Southern blotting, DNA sequencing, etc.) or by protein analysis (for example ELISA, Western blotting, etc.) to offspring.

[0089] As another example, a construct comprising a nucleic acid sequence encoding a human protein can be transfected into stem cells (e.g., ES cells or iPS cells) using well-known methods (such as electroporation, calcium phosphate precipitation, lipofection, etc.). The cells can be evaluated for the presence of the introduced nucleic acid by DNA analysis (e.g., PCR, Southern blot, DNA sequencing, etc.) or by protein analysis (e.g., ELISA, Western blot, etc.). Then, the cells determined to have incorporated the expression construct can be introduced into preimplantation embryos. For detailed descriptions of methods known in the art that can be used in the compositions and methods of the present invention, see Nagy et al. (2002, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press), Nagy et al. (1990, Development 110:815-821), U.S. Pat. No. 7,576,259, U.S. Pat. No. 7,659,442, U.S. Pat. No. 7,294,754, and Kraus et al. (2010, Genesis 48:394-399).

[0090] Additionally, as described in some of the examples below, Genetic engineering techniques are used to construct nucleic acid constructs (see, for example, Valenzuela et al. (2003) High throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6): 652-59 and U.S. Pat. No. 6,586,251), which are introduced into stem cells (e.g., ES cells), and allele loss and allele gain assays are used to determine the correctly targeted clones (Valenzuela et al., supra); correctly targeted ES cells can be used as donor ES cells, and the clones can be used to generate the target gene. The method is introduced into 8-cell stage mouse embryos (see, for example, U.S. Patent No. 7,294,754 and Poueymirou et al. 2007, F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99).

[0091] Genetically modified founder animals can be used to breed other animals carrying genetic modifications. Genetically modified animals carrying nucleic acids encoding human proteins of the present disclosure can be further bred with other genetically modified animals carrying other genetic modifications, such as hSIRPa knock-in mice, hIL-3 knock-in mice, hGM-CSF knock-in mice, hM-CSF knock-in mice, hTPO knock-in mice, hIL-6 knock-in mice, etc., or bred with knockout animals (e.g., non-human animals that are deficient in one or more proteins, such as non-human animals that do not express one or more genes thereof, such as Rag2-deficient animals, Il2rg-deficient animals).

[0092] In another embodiment, stem cells, such as ES cells, can be generated such that they contain several genetic modifications, such as humanization or gene deletions described herein, and such stem cells can be introduced into embryos to generate genetically modified animals having several genetic modifications.

[0093] As discussed above, in some embodiments, the subject genetically modified non-human animal is an immunodeficient animal. Any convenient method for generating genetically modified animals can be used to generate immunodeficient and genetically modified non-human animals containing one or more human proteins (e.g., hEPO, hSIRPα, hIL-3, hGM-CSF, hM-CSF, and / or hTPO), such as those known in the art or as described herein. For example, the generation of genetically modified immunodeficient animals can be achieved by introducing nucleic acids encoding human proteins into oocytes or stem cells containing mutant SCID gene alleles, which can cause immunodeficiency when homozygous, such as those described above and in the embodiments of this article in great detail. Then, mice are generated using modified oocytes or ES cells using methods such as those described herein and known in the art, and mated to generate immunodeficient mice containing the desired genetic modifications. As another example, a genetically modified non-human animal can be generated in an immunocompetent background and crossed with an animal containing a mutant gene allele that causes immunodeficiency when hemizygous or homozygous, and the offspring mated to create an immunodeficient animal that expresses at least one human protein of interest.

[0094] In some embodiments, the genetically modified mouse is treated to eliminate endogenous hematopoietic cells that may be present in the mouse. In one embodiment, the treatment comprises irradiating the genetically modified mouse. In a specific embodiment, newborn genetically modified mouse pups are sublethally irradiated. In a specific embodiment, newborn pups are irradiated with 2x200 cGy at 4 hour intervals.

[0095] Various embodiments of the present invention provide genetically modified animals that include human nucleic acids in substantially all of their cells, and genetically modified animals that include human nucleic acids in some but not all of their cells. In some cases, such as targeted recombination, a copy of human nucleic acids can be integrated into the genome of the genetically modified animal. In other cases, such as random integration, multiple copies of human nucleic acids that are adjacent to or far away from each other can be integrated into the genome of the genetically modified animal.

[0096] Thus, in some embodiments, the subject genetically modified non-human animal can be an immunodeficient animal comprising a genome comprising a nucleic acid encoding a human polypeptide operably linked to a corresponding non-human animal promoter, wherein the animal expresses the encoded human polypeptide. In other words, the subject genetically modified immunodeficient non-human animal comprises a genome comprising a nucleic acid encoding at least one human polypeptide, wherein the nucleic acid is operably linked to a corresponding non-human promoter and a polyadenylation signal, and wherein the animal expresses the encoded human polypeptide.

[0097] As discussed above, in some embodiments, the subject genetically modified non-human animals are transplanted with human hematopoietic cells. Any source of human hematopoietic cells, human hematopoietic stem cells (HSCs) and / or hematopoietic stem progenitor cells (HSPCs) known in the art or discussed herein can be transplanted into the genetically modified non-human animals of the present disclosure, such as umbilical cord blood, fetal liver, bone marrow, iPSCs, etc. In one embodiment, the hematopoietic cells are selected from human umbilical cord blood cells and human fetal liver cells. The amount of cells to be transplanted will be well understood by the skilled person or can be determined empirically. In one embodiment, about 1-2 x 10 5 Personal CD34+ cells. The cells may be transplanted into the host subject non-human animal using any convenient technique known in the art, such as tail vein injection, retro-orbital injection, injection into the neonatal liver, and the like. The cells may be transplanted into the host in any convenient buffer solution, such as PBS, Dulbecco's modified medium, Iscove's modified medium, and the like. In some cases, the animal may be irradiated prior to transplantation, such as described above, to enhance immunodeficiency.

[0098] The human hematopoietic cells thus transplanted produce one or more human cells selected from CD34+ cells, hematopoietic stem cells, hematopoietic cells, myeloid cell precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, thymocytes, T cells, B cells, platelets, erythrocytes, and combinations thereof. In one embodiment, the human cells are present at 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months after transplantation. Any of a variety of assays can be implemented to confirm that transplantation is successful, including, for example, flow cytometry assays for various human hematopoietic cells of interest, blood smears, and immunohistochemistry.

[0099] As discussed above, in some embodiments, the subject genetically modified non-human animal into which human hematopoietic cells are transplanted is infected with a human pathogen. Of particular interest in these embodiments are human pathogens that target human cells of the erythroid lineage. Non-limiting examples of such pathogens include protozoa of the genera Plasmodium, Babesia, Theileria, etc. In some embodiments, the strain of the pathogen used is a naturally occurring strain. In certain embodiments, the strain used has been selected in vivo for its ability to grow fertilely in immunodeficient mice transplanted with human erythrocytes, such as Plasmodium falciparum Pf3D7. 0087 / N9 or Pf3D7 0087 / N5 strain.

[0100] The subject transplanted immunodeficient animals can be infected using any method known in the art for infecting animals with pathogens that target cells of the erythroid lineage. For example, the subject transplanted immunodeficient animals can be inoculated intraperitoneally with parasitic infected red blood cells (PRBCs). See, for example, Badell et al. (2000) Human malaria in immunocompromised mice: an in vivo model to study defense mechanisms against Plasmodium falciparum. JEM 192 (11): 1653-1660; and Moreno et al. (2006) The course of infections and pathology in immunomodulated NOD / LtSz-SCID mice inoculated with Plasmodium falciparum laboratory lines and clinical isolates. Int. J. Parasitol. 36: 361-369. For another example, the subject transplanted immunodeficient animals can be inoculated intravascularly with parasitic infected red blood cells. See, for example, Angulo-Barturen et al. (2008) A murine model of falciparum-malaria by in vivo selection of competent strains in non-myelodepleted mice engrafted with human erythrocytes. PLoS One 3:e2252; and Jimenez-Diaz et al. (2009) Improved murine model of malaria using Plasmodiumfalciparum competent strains and non-myelodepleted NOD-scid IL2Rg nullmiceengrafted with human erythrocytes.Antimicrob Agents Chemother53:4533-4536. In some embodiments, the infection is produced by injecting the parasite into a non-human animal, i.e., not in the context of erythroid cells. In some embodiments, the subject is chemically depleted of phagocytic cells in the subject's transplanted immunodeficient animal before and / or during infection. In such embodiments, any chemotherapeutic agent that selectively depletes host phagocytic cells can be administered to the subject animal, including, for example, clodronate, e.g., as described in the Examples herein; dichloromethylene diphosphonates, e.g., as described in Badell et al., supra and Moreno et al., supra; monoclonal antibodies specific for polymorphonuclear neutrophils, e.g., NIMP-R14, as described in Badell et al., supra and Moreno et al., supra; etc.

[0101] The percent parasitemia in the infected genetically modified non-human animals of the present disclosure can be assessed by any convenient method in the art, such as microscopic examination of Giemsa-stained blood smears, for example 3 days after injection; or by flow cytometry, for example by measuring the emission of the nucleic acid dye YOYO-1 or the cell permeable dye SYTO-16, for example in the presence or absence of TER-119 monoclonal antibody. See, for example, Jimenez-Diaz et al. Quantitative measurement of Plasmodium-infected erythrocytes in murine models of malaria by flow cytometry using bidimensional assessment of SYTO-16 fluorescence. Cytometry A 2009, 75: 225-235.

[0102] Uses of the subject genetically modified mice

[0103] The ability to study human tissue in vivo in mice has opened a series of possible research avenues.Major limitations have hindered the application of the method, and one of the most important defects is that mouse factors do not have the ability to support human cells.Indeed, in the immune system, many necessary factors required for human immune cell development and function are species-specific and cannot be effectively provided by mice.Therefore, it is decided to follow the strategy of replacing mouse genes with their human counterparts, so that better human cell development and function can be achieved and corresponding mouse cell development and function cannot be achieved.By applying this concept to human cytokine EPO, it is shown herein that the nucleotide sequence encoding mouse EPO protein is replaced with the nucleotide sequence encoding human EPO protein to improve the development and function of the cell of erythroid lineage in the human immune system transplanted in mice.

[0104] For example, Figure 5 The embodiments at the present invention demonstrate that the expression of hEPO from a nucleic acid sequence under the control of the EPO promoter at the genome of a non-human animal increases the number of human cells (CD235a+) of the erythroid lineage developed in the bone marrow of the animal into which the human HSC is transplanted by about 2-fold (i.e., from about 11% to about 22%). The expression of human Sirpa enhances this effect, resulting in a total increase of 3-fold (i.e., from about 11% to about 33%) in the proportion of human CD235a+ cells in the bone marrow compared to animals that do not express either human EPO or human Sirpa ( Figure 5 , panel A). In addition, as for example Figure 6 As shown in Figure 2, clodronate-treated animals engrafted with human HSC expressing human EPO showed a significant decrease in the number of CD235+ erythroid cells (including CD71+ reticulocytes, Figure 6 , panel B) increased 1000-fold, i.e. to about 1% of the total red blood cells. Importantly, as for example Figure 7 As shown in , human erythrocytes generated at these engraftment levels in HSC-engrafted animals expressing human EPO are susceptible to infection with malarial parasites such as Plasmodium falciparum. Thus, the genetically modified non-human animals expressing human EPO described herein are particularly useful for generating animals susceptible to malarial parasite infection, or will better support animals that are acutely engrafted with human erythrocytes prior to infection in current rodent models.

[0105] As such, the genetically modified non-human animals of the present disclosure find many uses in the art. For example, the genetically modified animals of the present disclosure are useful for studying human erythropoiesis and the function of human erythrocytes. As another example, the genetically modified mice of the present disclosure provide a system that can be used to screen candidate agents for desired in vivo activity, such as to identify agents that can, for example, regulate (i.e., promote or inhibit) human erythropoiesis and / or human erythrocyte function in a healthy or diseased state (e.g., as cancerous cells), during pathogen infection, etc., such as to identify novel therapeutic agents; or as another example, to identify agents that are toxic to human cells of the erythroid lineage; and to identify agents that prevent, mitigate, or reverse the toxic effects of toxic agents on human cells of the erythroid lineage; and the like. As yet another example, the engrafted genetically modified animals of the present disclosure provide a system useful for predicting an individual's responsiveness to a disease therapy, e.g., by providing an in vivo platform for screening an individual's immune system's responsiveness to an agent (e.g., a therapeutic agent) to predict an individual's responsiveness to the agent.

[0106] As a non-limiting example, the engrafted genetically modified mice of the present disclosure can be used to generate mouse models of pathogen infection with parasites that target human erythrocytes (e.g., Plasmodium, Babesia, Theileria, etc.). Such mouse models of infection can be useful in both research (e.g., to better understand the progression of infection in humans) and drug discovery (e.g., to identify candidate agents that provide protection against or treat infection with such parasites).

[0107] Protozoa of the genus Plasmodium are the cause of malaria in humans. Malaria begins with the bite of an infected Anopheles mosquito, which introduces the protozoa into the circulatory system via its saliva and eventually reaches the liver, where they mature and multiply. The protozoa then enter the bloodstream and infect cells of the erythroid lineage at various stages of maturation.

[0108] Five species of Plasmodium can infect humans and spread through humans. The vast majority of deaths are caused by Plasmodium falciparum, while Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae cause generally milder forms of malaria that are rarely fatal. This is thought to be due, at least in part, to the type of cells targeted by each species: Plasmodium falciparum grows in all mature stages of red blood cells (RBCs), while, for example, Plasmodium vivax is restricted to growth in reticulocytes, which account for only about 1%-2% of the total RBCs in the periphery. In addition, Plasmodium falciparum causes severe malaria through a unique property not shared with any other human malaria, namely sequestration. During the 48-hour asexual blood stage cycle, the mature form changes the surface properties of infected red blood cells, causing them to adhere to blood vessels (a process called cell adhesion). This causes microcirculatory obstruction and leads to multiple organ dysfunction.

[0109] Symptoms of malaria include fever, chills, headache, sweating, fatigue, anemia, nausea, dry (non-productive) cough, muscle and / or back pain, and splenomegaly. Other symptoms and complications associated with malaria include brain infection (encephalitis), hemolytic anemia, renal failure, liver failure, meningitis, pulmonary edema, and splenic hemorrhage. Generally speaking, individuals at risk of developing malaria will begin to show symptoms 7 days or longer after infection, such as 9 to 14 days after initial infection with Plasmodium falciparum, 12 to 18 days after initial infection with Plasmodium vivax or Plasmodium ovale, 18 to 40 days after initial infection with Plasmodium malariae, or 11 to 12 days after initial infection with Plasmodium knowlesi. Antimalarial drugs used in the art for treating or preventing malaria include chloroquine, quinidine, doxycycline, tetracycline, clindamycin, atovaquone plus proguanil (Malarone), mefloquine, artesunate, pyrimethamine plus sulfadoxine (Fansidar).

[0110] Methods for determining whether a subject has been infected with Plasmodium are well known in the art and include, for example, blood microscopy using blood films, antigen-based rapid diagnostic tests (RDTs), such as immunochromatography-based RDTs, detection of parasite DNA by polymerase chain reaction (PCR), etc. Any convenient method may be used to determine whether a subject's human red blood cells have been infected with a pathogen.

[0111] Another example of a pathogen of interest is a protozoan of the genus Babesia. Babesia infection results in a malaria-like disease called babesiosis. Babesiosis is a vector-borne disease, usually transmitted by ticks of the species Ixodes scapularis. The disease is usually caused by B. microti in humans, B. canis rossi and B. canis canis in dogs, B. bovis in cows, and B. bigemina in cattle. B. microti infects humans using the same tick vectors as Lyme disease and ehrlichiosis, and can occur in conjunction with these other diseases. The protozoan can also be transmitted by blood transfusions.

[0112] In humans, babesiosis can be asymptomatic or characterized by symptoms ranging from mild fever and diarrhea to high fever, chills, and severe anemia. Organ failure can occur in severe cases, including active distress syndrome. Severe cases occur mostly in people who have had a splenectomy, or in people with immune deficiencies, such as HIV / AIDS patients. Treatment usually includes a two-drug regimen of quinine and clindamycin or atovaquone and azithromycin. In cases where babesiosis appears to be life-threatening, exchange transfusions are performed in which infected red blood cells are removed and replaced with uninfected red blood cells.

[0113] Babesia infection is definitively diagnosed by identification of the parasite on Giemsa-stained thin blood smears. The parasite appears as pairs of merozoites in erythrocytes that form a "Maltese cross formation" in humans or "two pears hanging together" in animals. Other diagnostic methods include peripheral blood PCR, and serological tests for antibodies (IgG, IgM) to Babesia.

[0114] Yet another malaria-like disease, Theileriosis, is caused by protozoa of the genus Theileria. In humans, Theileriosis is caused by T. microti; in horses, by T. equi ("equine piroplasmosis"); in sheep and goats, by T. lestoquardi; and in cattle, African buffalo, water buffalo, and water buck, by T. annulata ("tropical Theileriosis," also called "Mediterranean Theileriosis") or T. parva ("East Coast fever," also called "Collido's disease"). Theileriosis is transmitted to the host by a variety of tick species, including Ixodes scapularis, Rhipicephalus, Dermacentor, Haemaphysalis, and Hyalomma. The organism reproduces in the tick, i.e., it progresses through its life stages and matures and enters the saliva after the tick attaches to the host. Typically, the tick must attach for several days before it becomes infective. However, if the ambient temperature is high, infective sporozoites can develop in ticks on the ground and can enter the host within hours of attachment.

[0115] Theileriosis in humans usually presents with fever and hemolysis. Theileriosis infection is definitively diagnosed by identification of the parasite on a Giemsa-stained thin blood smear.

[0116] The engrafted genetically modified animals of the present disclosure can be used to screen candidate agents to identify those that will prevent (e.g., vaccines) or treat infections with Plasmodium, Babesia, Theileria, and other parasitic organisms that target human erythrocytes. The terms "treat," "treat," and the like are used herein to generally include obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms and / or may be therapeutic in terms of partially or completely curing a disease and / or adverse effects attributable to a disease. As used herein, "treatment" includes any treatment of a disease in a mammal, and includes: (a) preventing a disease from occurring in a subject who may be predisposed to the disease but has not yet been diagnosed as having the disease; (b) inhibiting the disease, i.e., blocking its occurrence; or (c) alleviating the disease, i.e., causing regression of the disease. Candidate agents of interest as antiparasitic therapeutics include those that can be administered before, during, or after a parasitic infection, and those that, when administered in an effective amount, inhibit the effects of the parasite on the individual (i.e., host), for example by killing the parasite or cells infected by the parasite, by preventing the reproduction of the parasite, by preventing the production or action of factors (i.e., toxins) produced by the parasite that are toxic to the individual, etc. The terms "individual," "subject," "host," and "patient" are used interchangeably herein and include any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired.

[0117] In a screening assay for a biologically active agent, a genetically modified non-human animal of the disclosure that has been engrafted with human hematopoietic cells (e.g., an engrafted Rag2 - / - Iq 无 Epo h / m Mouse, transplanted Rag2 - / - Iq 无 Tpo h / h Il3 / Gmcsf h / h Epo h / m SIRPα h / h ("TIES") mice, with transplanted Rag2 - / - IL y / - Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h hSIRPα+ (“MISTER-G”) mice, with transplanted Rag2 - / - Iq 无 Tpo h / h Mcsf h / h Il3 / Gmcsf h / h Epo h / hSIRPα-tg+ ("SupER-G") mice, etc.) are contacted with a candidate agent of interest, and the effect of the candidate agent is evaluated by monitoring one or more output parameters. According to methods known in the art, these output parameters can reflect the viability of the cells, such as the total number of hematopoietic cells or the number of cells of a specific hematopoietic cell type, or the apoptotic state of the cells, such as the amount of DNA fragmentation, the amount of cell vacuolization, the amount of phosphatidylserine on the cell surface, etc. Alternatively or in addition, the output parameters can reflect the differentiation ability of the cells, such as the proportion of differentiated cells and the type of differentiated cells. Alternatively or in addition, the output parameters can reflect the function of the cells, such as cytokines and chemokines produced by the cells, antibodies (e.g., amount or type) produced by the cells, the ability of the cells to home and overflow to the attack site, the ability of the cells to regulate (i.e., promote or inhibit) the activity of other cells in vitro or in vivo, the ability to absorb hemoglobin, etc. Depending on the relevance to the implemented research, some other parameters can reflect the effect of the agent on infection, such as pathogen infection in animals, such as the titer of pathogens in mice, etc.

[0118] Parameter is the quantifiable component of cell, particularly the component that can be accurately measured (being desired in high-throughput system). Parameter can be any cell component or cell product, including cell surface determinant, receptor, protein or its conformation or post-translational modification, lipid, carbohydrate, organic or inorganic molecule, nucleic acid (such as mRNA, DNA, etc.) or part or its combination derived from such cell component. Although most parameters can provide quantitative readout, in some cases, semi-quantitative or quantitative result can be acceptable. Readout can include single determination value, or can include mean, median or variance, etc. Characteristically, due to the multiplicity of same determination method, parameter readout value of a range can be obtained for each parameter. Expected variability, and can use standard statistical method and the common statistical method for providing single value to obtain the numerical range of each in test parameter set.

[0119] Candidate agents of interest for screening include known and unknown compounds covering many chemical classes, primarily organic molecules (which may include organometallic molecules), inorganic molecules, genetic sequences, vaccines, antibiotics or other agents suspected of having antibiotic properties, peptides, polypeptides, antibodies, agents that are already approved drugs for human use, etc. An important aspect of the present invention is the evaluation of candidate drugs, including toxicity testing; etc.

[0120] Candidate agents include organic molecules containing functional groups necessary for structural interactions (particularly hydrogen bond formation), and typically contain at least amine, carbonyl, hydroxyl or carboxyl groups, typically at least two functional chemical groups. Candidate agents often contain cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found in biomolecules (including peptides, polynucleotides, sugars, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof). Included are pharmacologically active drugs, genetically active molecules, etc. Interested compounds include chemotherapeutic agents, hormones or hormone antagonists, etc. Exemplary agents suitable for the present invention are those recorded in "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, NY, 1996, 9th edition. Also included are toxins, and biological and chemical warfare agents, see, e.g., Somani, SM (ed.), "Chemical Warfare Agents," Academic Press, New York, 1992.

[0121] The candidate agent of interest for screening also includes nucleic acid, for example, encoding siRNA, shRNA, antisense molecules, or miRNA nucleic acid, or nucleic acid encoding polypeptide. It is available that many vectors that can be used for nucleic acid transfer into target cells. The vector can be maintained as an episome, for example as a plasmid, minicircle DNA, virus-derived vectors such as cytomegalovirus, adenovirus, etc., or they can be integrated into the target cell genome via homologous recombination or random integration, for example retrovirus-derived vectors such as MMLV, HIV-1, ALV, etc. The subject cell can be directly provided with a vector. In other words, pluripotent cells are contacted with a vector comprising nucleic acid of interest so that the vector is taken up by cells.

[0122] Methods for contacting cells (e.g., cells in culture or cells in mice) with nucleic acid vectors (such as electroporation, calcium chloride transfection, and lipofection) are well known in the art. Alternatively, the nucleic acid of interest can be provided to the cell via a virus. In other words, the cell is contacted with a viral particle containing the nucleic acid of interest. Retroviruses (e.g., lentiviruses) are particularly suitable for the method of the present invention. Commonly used retroviral vectors are "defective", i.e., they cannot produce the viral proteins required for productive infection. Instead, the replication of the vector requires growth in a packaging cell line. In order to generate viral particles containing the nucleic acid of interest, the retroviral nucleic acid containing the nucleic acid is packaged into a viral capsid by a packaging cell line. Different packaging cell lines provide different envelope proteins to be incorporated into the capsid, which determine the specificity of the viral particles to the cell. Envelope proteins belong to at least three types, namely ecotropic, amphotropic, and xenotropic. Retroviruses packaged with isotropic envelope proteins (e.g., MMLV) are capable of infecting most mouse and rat cell types and are produced using isotropic packaging cell lines such as BOSC23 (Pear et al. (1993) PNAS 90:8392-8396). Retroviruses carrying amphotropic envelope proteins (e.g., 4070A (Danos et al., supra)) are capable of infecting most mammalian cell types, including humans, dogs, and mice and are produced using amphotropic packaging cell lines such as PA12 (Miller et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6:2895-2902); GRIP (Danos et al. (1988) PNAS 85:6460-6464). Retroviruses packaged with heterotropic envelope proteins (e.g., AKR env) are able to infect most mammalian cell types, with the exception of murine cells. Appropriate packaging cell lines can be used to ensure that cells of interest (in some cases, transplanted cells, in some cases, cells of the host (i.e., genetically modified animals)) are targeted by packaged viral particles.

[0123] The vector for providing the subject cell with the nucleic acid of interest will generally include a promoter suitable for driving the expression of the nucleic acid of interest (i.e., transcriptional activation). This can include ubiquitous promoters, such as CMV-β-actin promoters, or inducible promoters, such as promoters that are active in a specific cell population or that respond to drugs such as tetracycline. Transcriptional activation means that transcription will be elevated at least about 10 times, at least about 100 times, and more generally at least about 1000 times above the basal level in the target cell. In addition, the vector for providing the subject cell with reprogramming factors can include genes that must be removed later (e.g., using a recombinase system such as Cre / Lox), or genes that destroy the cells that express them (e.g., by incorporating genes that allow selective toxicity, such as herpes virus TK, bcl-xs, etc.).

[0124] Candidate agents of interest for screening also include polypeptides. Optionally, such polypeptides can be fused to polypeptide domains that improve product solubility. The domain can be connected to the polypeptide via a defined protease cleavage site (e.g., a TEV sequence that is cleaved by a TEV protease). The linker can also include one or more flexible sequences, such as 1 to 10 glycine residues. In some embodiments, the cleavage of the fusion protein is implemented in a buffer that maintains product solubility, such as in the presence of 0.5 to 2M urea, in the presence of polypeptides and / or polynucleotides that improve solubility, and so on. Domains of interest include endosomal cleavage domains, such as influenza HA domains; and other polypeptides that help generate, such as IF2 domains, GST domains, GRPE domains, etc. In addition / or, such polypeptides can be formulated to achieve improved stability. For example, a peptide can be PEGylated, wherein the polyethyleneoxy group provides an extended lifespan in the bloodstream. A polypeptide can be fused to another polypeptide to provide added functionality, such as improving in vivo stability. Generally, such fusion partners are stable plasma proteins that, when present as fusions, can, for example, extend the in vivo plasma half-life of a polypeptide, particularly where such stable plasma proteins are immunoglobulin constant domains. In most cases (where stable plasma proteins are typically found in multimeric form, such as immunoglobulins or lipoproteins, where identical or different polypeptide chains are typically disulfide and / or non-covalently linked to form assembled multi-chain polypeptides), fusions herein containing polypeptides will also be generated and employed as multimers having substantially the same structure as stable plasma protein precursors. These multimers will be homogenous with respect to the polypeptide agents they contain, or they may contain more than one polypeptide agent.

[0125] Candidate polypeptide agents can be produced from eukaryotic cells, or can be produced by prokaryotic cells. It can be further processed by unfolding (e.g., heat denaturation, DTT reduction, etc.), and can be further refolded using methods known in the art. Interested modifications that do not change the primary sequence include chemical derivatization of the polypeptide, such as acylation, acetylation, carboxylation, amidation, etc. Glycosylation modifications are also included, such as those performed by modifying the glycosylation pattern of the polypeptide during its synthesis and processing or in further processing steps; for example, by exposing the polypeptide to an enzyme that affects glycosylation, such as a mammalian glycosylation or deglycosylation enzyme. Sequences with phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, or phosphothreonine) are also included. Ordinary molecular biology techniques and synthetic chemistry can be used to modify polypeptides to improve their resistance to proteolytic degradation or optimize solubility properties or make them more suitable as therapeutic agents. Analogs of such polypeptides include those containing residues different from naturally occurring L-amino acids (e.g., D-amino acids or non-naturally occurring synthetic amino acids). Some or all amino acid residues can be replaced with D-amino acids.

[0126] Candidate polypeptide agents can be prepared by in vitro synthesis using conventional methods known in the art. A variety of commercial synthesis devices are available, such as automated synthesizers from Applied Biosystems, Inc., Beckman, etc. By using a synthesizer, naturally occurring amino acids can be replaced with non-natural amino acids. The specific sequence and preparation method will be determined by convenience, economic effect, required purity, etc. Alternatively, candidate polypeptide agents can be separated and purified according to conventional methods of recombinant synthesis. Lysates of the expression host can be prepared and purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. To a large extent, with regard to contaminants associated with the method for preparing the product and its purification, the composition used will contain at least 20% of the desired product by weight, more usually at least about 75% by weight, preferably at least about 95% by weight, and for therapeutic purposes, usually at least about 99.5% by weight. Typically, the percentage will be based on total protein.

[0127] In some cases, the candidate polypeptide agent to be screened is an antibody. The term "antibody" or "antibody module" is intended to include any molecular structure containing a polypeptide chain with a specific shape that is suitable for and recognizes an epitope, wherein one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. The specificity or selectivity of a given structure and its specific epitope is sometimes referred to as a "key" fit. The prototype antibody molecule is an immunoglobulin, and all types of immunoglobulins (IgG, IgM, IgA, IgE, IgD, etc.) from all sources (such as humans, rodents, rabbits, cattle, sheep, pigs, dogs, other mammals, chickens, other birds, etc.) are considered to be "antibodies". The antibodies utilized in the present invention can be polyclonal antibodies or monoclonal antibodies. Antibodies are usually provided in a culture medium for cultured cells. Antibody generation and screening are discussed in great detail below.

[0128] Candidate agents can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. For example, many means can be used for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including oligonucleotides and oligopeptides that express randomization. Alternatively, libraries of natural compounds in the form of bacteria, fungi, plants, and animal extracts are available or easily generated. In addition, libraries and compounds generated naturally or synthetically are easily modified via conventional chemistry, physics, and biochemistry, and can be used to generate recombinant libraries. Known pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidation, etc. to generate structural analogs.

[0129] Candidate agents are screened for biological activity as follows, i.e., at least one and usually multiple samples are administered with agents, sometimes together with samples lacking agents. The parameter changes of the response agent are measured, and the results are evaluated by comparing with reference samples obtained with other agents, etc. (e.g., in the presence and absence of agents). In the case of implementing screening to identify the candidate agents that can prevent, mitigate or reverse the effect of pathogens, screening is usually implemented in the presence of virulence factors, wherein the virulence factors are added at the time that is most suitable for the result to be measured. For example, in the case of testing the protection / prevention ability of candidate agents, candidate agents can be added before pathogens, at the same time as pathogens, or after being infected by pathogens. As another example, in the case of testing the ability of candidate agents to reverse the effect of pathogens, candidate agents can be added after being infected by pathogens. As mentioned above, in some cases, "sample" is a genetically modified non-human animal into which cells have been transplanted, for example, a candidate agent is provided to an immunodeficient animal (e.g., mouse) into which human hematopoietic cells have been transplanted, and the immunodeficient animal comprises a nucleic acid encoding human EPO operably connected to an EPO promoter. In some instances, the sample is human hematopoietic cells to be transplanted, ie, the candidate agent is provided to the cells (eg, reticulocytes, erythrocytes, etc.) prior to transplantation into an immunodeficient genetically modified animal.

[0130] If the candidate agent is to be administered directly to the genetically modified animal after the implantation, the agent can be administered by any of the many well-known methods in the art for administering peptides, small molecules and nucleic acids to mice. For example, the agent can be administered orally, mucosally, topically, intradermally, or by injection, such as intraperitoneally, subcutaneously, intramuscularly, intravenously, or intracranial injection. The agent can be administered in a buffer, or it can be incorporated into any of a variety of formulations, such as by combining with a suitable pharmaceutically acceptable vehicle. A "pharmaceutically acceptable vehicle" can be a vehicle approved by a regulatory agency of a federal or state government or listed in the U.S. Pharmacopeia or other recognized pharmacopoeia for mammals (such as humans). The term "vehicle" refers to a diluent, adjuvant, excipient, or carrier for preparing the compound of the invention for administration to a mammal. Such pharmaceutical vehicles can be lipids, such as liposomes, such as liposome dendrimers, liquids, such as water and oils, including petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc., saline; gum arabic, gelatin, starch paste, talc, keratin, colloidal silica, urea, etc. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents can be used. The pharmaceutical composition can be formulated into solid, semisolid, liquid or gaseous preparations, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. The medicament can be systemic after administration or can be localized by using regional administration, intramural administration, or using an implant that acts to retain an active dose at the implant site. The active agent can be formulated to achieve immediate activity or it can be formulated to achieve sustained release. For some conditions, particularly central nervous system conditions, it may be necessary to formulate the medicament to cross the blood-brain barrier (BBB). A strategy for drug delivery across the blood-brain barrier (BBB) ​​requires disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin. When the composition is administered by intravascular injection, a BBB disruptor may be co-administered with the agent. Other strategies for crossing the BBB may require the use of endogenous transport systems, including caveolin-1-mediated transcytosis, carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated insulin or transferrin transcytosis, and active efflux transporters such as p-glycoprotein. Active transport modules may also be conjugated to the therapeutic compounds used in the present invention to facilitate transport across the endothelial wall of the blood vessel.Alternatively, drug delivery of the agent behind the BBB can be by local delivery, such as by intrathecal delivery, for example, via an Ommaya reservoir (see, e.g., U.S. Pat. Nos. 5,222,982 and 5,385,582, which are incorporated herein by reference); by bolus injection, such as by syringe, such as intravitreal or intracranial; by continuous infusion, such as by cannulation, such as with convection (see, e.g., U.S. Application No. 20070254842, which is incorporated herein by reference); or by implantation of a device to which the agent has been reversibly attached (see, e.g., U.S. Application Nos. 20080081064 and 20090196903, which are incorporated herein by reference).

[0131] If the cell is provided with a medicament before being moved in, the medicament is conveniently added to the culture medium of the cell in the culture in a solution or an easily soluble form. The medicament can be added to an otherwise static solution as a stream (intermittent or continuous) in a flow-through system, or by adding a compound push (single or incremental). In a flow-through system, two fluids are used, one of which is a physiologically neutral solution, and the other is a solution identical to the test compound added. The first fluid is passed through the cell, followed by the second. In a single solution method, the push of the test compound is added to the culture medium volume around the cell. The overall concentration of the components of the culture medium should not change significantly with the addition of the push or between the two solutions in the flow-through method.

[0132] Multiple assays can be run in parallel with different concentrations of different agents to obtain differential responses to various concentrations. As known in the art, the effective concentration of the assay agent is usually derived from 1:10, or a concentration range of other logarithmic ratio dilutions. If necessary, the concentration can be further refined with a second dilution series. Typically, one of these concentrations serves as a negative control, i.e., at 0 concentration or below the detection level of the agent or at or below the agent concentration that does not provide a detectable change in phenotype.

[0133] The analysis of the response of the cells in the genetically modified animals to the candidate agent can be implemented at any time after the treatment with the agent. For example, the cells can be analyzed 1, 2, or 3 days, sometimes 4, 5, or 6 days, sometimes 8, 9, or 10 days, sometimes 14 days, sometimes 21 days, sometimes 28 days, sometimes 1 month or more, such as 2 months, 4 months, 6 months or more after contacting the candidate agent. In some embodiments, the analysis is included in the analysis at multiple time points. For analysis, selecting the time point can be based on the analysis type to be implemented, as those of ordinary skill will readily understand.

[0134] Analysis can include measuring any parameter described herein or known in the art to measure cell viability, cell proliferation, cell identity, cell morphology, and cell function, particularly when they can belong to cells of immune cells. For example, flow cytometry can be used to determine the total number of hematopoietic cells or the number of cells of a specific hematopoietic cell type. Histochemistry or immunohistochemistry can be implemented to determine the apoptotic state of the cell, such as terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to measure DNA fragmentation, or immunohistochemistry to detect the binding of annexin V to phosphatidylserine on the cell surface. Flow cytometry can also be used to assess the ratio of differentiated cell types and differentiated cells, such as to measure the ability of hematopoietic cells to survive and / or differentiate in the presence of an agent. ELISA, Western, and Northern blotting can be implemented to measure the levels of cytokines, chemokines, immunoglobulins, etc. expressed in the genetically modified mice that are transplanted, such as to assess the function of transplanted cells, assess the survival of erythrocytes, etc. In vivo assays to test immune cell function can also be performed, as well as assays related to a particular disease or condition of interest, such as anemia, e.g., sickle cell anemia, etc. See, e.g., Current Protocols in Immunology (Richard Coico, ed., John Wiley & Sons, Inc. 2012) and Immunology Methods Manual (I. Lefkovits, ed., Academic Press 1997), the disclosures of which are incorporated herein by reference.

[0135] Thus, for example, a method for determining the effect of an agent on erythroid cells infectible or infected by a pathogen is provided, comprising: subjecting a human EPO mouse (e.g., Rag2) into which human reticulocytes and / or erythrocytes have been transplanted. - / - IL - / - EPO m / h The invention relates to a method for treating a mouse with a human EPO transplanted into a mouse (a human hematopoietic cell transplanted into a mouse); measuring a parameter of the viability of the transplanted cells over time in the presence of the agent; and comparing the measurements with measurements from a transplanted human EPO mouse that was not exposed to the agent. If the agent reduces infection and / or death of human red blood cells in the peripheral blood of the mouse by at least 20%, 30%, 40% or more, in some cases 50%, 60%, 70% or more, such as 80%, 90% or 100%, i.e., to an undetectable amount, after a single administration or two or more administrations of the agent at a selected time, it is determined to be anti-pathogenic. In a specific embodiment, the drug or drug combination is administered at least 3 days, at least 1 week, at least 10 days after transplantation of human hematopoietic cells, such as 2 weeks, 3 weeks, or 4 weeks after transplantation of human hematopoietic cells, such as 6 weeks, 8 weeks, 10 weeks or more after transplantation of human hematopoietic cells.

[0136] Other examples of uses of the subject mice are provided elsewhere herein.Additional applications of the genetically modified and engrafted mice described in this disclosure will be apparent to those of skill in the art upon reading this disclosure.

[0137] Examples of non-limiting aspects of the present disclosure

[0138] The various aspects of the subject matter described above (including various embodiments) may be beneficial alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the present disclosure numbered 1-58 are provided below. As will be apparent to those skilled in the art upon reading this disclosure, each individually numbered aspect may be used or combined with any preceding or succeeding individually numbered aspect. This is intended to provide support for all such combinations of the various aspects and is not limited to the combinations of the various aspects explicitly provided below:

[0139] 1. A genetically modified non-human animal comprising:

[0140] A nucleic acid sequence encoding human EPO protein (hEPO) operably linked to an EPO gene promoter.

[0141] 2. The non-human animal according to 1, wherein the EPO gene promoter is an endogenous non-human EPO promoter.

[0142] 3. A non-human animal according to 1, wherein the operable linkage is with an endogenous non-human EPO promoter at the EPO locus of the non-human animal.

[0143] 4. A non-human animal according to 3, wherein the operable connection results in an invalid mutation in the non-human EPO gene at the non-human EPO gene locus.

[0144] 5. A non-human animal according to 4, wherein the non-human animal is heterozygous for an allele comprising the nucleic acid sequence encoding hEPO.

[0145] 6. A non-human animal according to 4, wherein the non-human animal is homozygous for an allele comprising the nucleic acid sequence encoding hEPO.

[0146] 7. A non-human animal according to any one of items 1-6, wherein the nucleic acid sequence encoding hEPO comprises human EPO genome coding and non-coding sequences.

[0147] 8. The non-human animal according to any one of 1-6, wherein the nucleic acid sequence encoding hEPO comprises a human EPO cDNA sequence.

[0148] 9. A non-human animal according to any one of 1-8, wherein the non-human animal expresses one or more additional human proteins selected from the group consisting of:

[0149] an hM-CSF protein encoded by a nucleic acid under the control of an M-csf promoter,

[0150] a hIL3 protein encoded by a nucleic acid under the control of the IL-3 promoter,

[0151] hGM-CSF protein encoded by a nucleic acid under the control of a Gm-csf promoter,

[0152] hTPO protein encoded by a nucleic acid under the control of a TPO promoter, and

[0153] The hSirpa protein is encoded by a nucleic acid under the control of the Sirpa promoter.

[0154] 10. A non-human animal according to 9, wherein the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and wherein the non-human animal is heterozygous null for the non-human gene.

[0155] 11. A non-human animal according to 9, wherein the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and wherein the non-human animal is homozygous null for the non-human gene.

[0156] 12. The non-human animal according to 9, wherein the human proteins include at least hTPO, hIL3, hGM-CSF, and hSirpa.

[0157] 13. A non-human animal according to any one of 1-12, wherein the non-human animal is immunodeficient.

[0158] 14. The non-human animal according to 13, wherein the immunodeficiency is caused by a deficiency in one or both of Rag2 and Il2rg.

[0159] 15. A non-human animal according to any one of 1-14, wherein the non-human animal is a mammal.

[0160] 16. The non-human animal according to 15, wherein the mammal is a rodent.

[0161] 17. The non-human animal according to 16, wherein the rodent is a mouse.

[0162] 18. A non-human animal according to any one of 1-17, wherein the non-human animal further comprises an infusion of human hematopoietic cells.

[0163] 19. A non-human animal according to 18, wherein the human hematopoietic cells comprise one or more cells selected from the following group: human CD34-positive cells, human hematopoietic stem cells, human myeloid cell precursor cells, human erythroid precursor cells, human myeloid cells, human dendritic cells, human monocytes, human granulocytes, human erythrocytes, human neutrophils, human mast cells, human thymocytes, and human B lymphocytes.

[0164] 20. The non-human animal according to 19, wherein the non-human animal comprises clodronate.

[0165] 21. The non-human animal according to 20, wherein the non-human animal further comprises an infection with a pathogen that targets human cells of the erythroid lineage.

[0166] 22. The non-human animal according to 21, wherein the pathogen is selected from Plasmodium sp., Babesia sp., and Theileri sp.

[0167] 23. A method for identifying an agent that inhibits infection by a pathogen that targets human cells of the erythroid lineage, the method comprising:

[0168] a. administering a candidate agent to a genetically modified non-human animal, wherein the animal comprises:

[0169] i. a nucleic acid sequence encoding human EPO protein (hEPO) operably linked to an EPO gene promoter,

[0170] ii. one or more genetic mutations that cause immunodeficiency in said non-human animal,

[0171] iii. Engraftment of human hematopoietic cells, and

[0172] iv. infection by pathogens targeting human cells of the erythroid lineage, and

[0173] b. Determining whether the agent reduces the amount of the pathogen in a non-human animal infected with the pathogen.

[0174] 24. A method for identifying an agent for preventing infection by a pathogen targeting human cells of the erythroid lineage, the method comprising:

[0175] a. contacting a genetically modified non-human animal with clodronate, wherein the non-human animal comprises:

[0176] i. a nucleic acid sequence encoding human EPO protein (hEPO) operably linked to an EPO gene promoter,

[0177] ii. one or more genetic mutations that cause immunodeficiency in said non-human animal, and

[0178] iii. Transplantation of human hematopoietic cells,

[0179] b. administering a candidate agent to a genetically modified non-human animal,

[0180] c. administering to the genetically modified non-human animal reticulocytes or erythrocytes infected with a parasite, and

[0181] d. Determining whether the agent prevents infection of human reticulocytes and / or erythrocytes of said non-human animal.

[0182] 25. The method according to 23 or 24, wherein the EPO gene promoter is an endogenous non-human promoter.

[0183] 26. A method according to 23 or 24, wherein the operable linkage is to an endogenous non-human EPO promoter at the EPO locus of a non-human animal.

[0184] 27. The method according to 26, wherein the operable linkage results in an invalid mutation in the non-human EPO gene at the non-human EPO gene locus.

[0185] 28. The method according to 27, wherein the non-human animal is heterozygous for an allele comprising the nucleic acid sequence encoding hEPO.

[0186] 29. The method according to 27, wherein the non-human animal is homozygous for an allele comprising the nucleic acid sequence encoding hEPO.

[0187] 30. The method according to any one of items 23-29, wherein the nucleic acid sequence encoding hEPO comprises human EPO genome coding and non-coding sequences.

[0188] 31. The method according to any one of 23-29, wherein the nucleic acid sequence encoding hEPO comprises a human EPO cDNA sequence.

[0189] 32. The method according to any one of 23-31, wherein the non-human animal expresses one or more additional human proteins selected from the group consisting of:

[0190] an hM-CSF protein encoded by a nucleic acid under the control of an M-csf promoter,

[0191] a hIL3 protein encoded by a nucleic acid under the control of the IL-3 promoter,

[0192] hGM-CSF protein encoded by a nucleic acid under the control of a Gm-csf promoter,

[0193] hTPO protein encoded by a nucleic acid under the control of a TPO promoter, and

[0194] The hSirpa protein is encoded by a nucleic acid under the control of the Sirpa promoter.

[0195] 33. A method according to 32, wherein the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and wherein the non-human animal is heterozygous null for the non-human gene.

[0196] 34. A method according to 33, wherein the promoter is an endogenous non-human animal promoter at the corresponding non-human animal gene locus, and wherein the non-human animal is homozygous null for the non-human gene.

[0197] 35. The method according to any one of 23-34, wherein the non-human animal is deficient for one or both of Rag2 and Il2rg.

[0198] 36. A method according to any one of items 23-35, wherein the human hematopoietic cells comprise one or more cells selected from the group consisting of human CD34-positive cells, human hematopoietic stem cells, human myeloid cell precursor cells, human erythroid precursor cells, human myeloid cells, human dendritic cells, human monocytes, human granulocytes, human erythrocytes, human neutrophils, human mast cells, human thymocytes, and human B lymphocytes.

[0199] 37. The method according to any one of 23-36, wherein the pathogen is selected from Plasmodium, Babesia, and Theileria.

[0200] 38. The method according to 37, wherein the pathogen is a Plasmodium and the Plasmodium is selected from the group consisting of Plasmodium falciparum and Plasmodium vivax.

[0201] 39. The method according to any one of 23-38, wherein the non-human animal is a mammal.

[0202] 40. The method according to 39, wherein the mammal is a rodent.

[0203] 41. The method according to 40, wherein the rodent is a mouse.

[0204] 42. A method for generating a mouse expressing human EPO protein (hEPO), comprising:

[0205] contacting a mouse pluripotent stem cell with a nucleic acid sequence comprising a coding sequence for hEPO or a fragment thereof operably linked to an EPO promoter sequence, wherein the coding sequence and the EPO promoter sequence form a cassette flanked by sequences homologous to an endogenous mouse EPO locus,

[0206] Cultivating the pluripotent stem cells under conditions that promote integration of the nucleic acid sequence into the mouse genome at the endogenous mouse EPO locus by homologous recombination; and

[0207] Mice are generated from mouse pluripotent stem cells containing a nucleic acid sequence encoding hEPO.

[0208] 43. The method according to 42, wherein the mouse pluripotent stem cells are ES cells or iPS cells.

[0209] 44. The method according to 42 or 43, wherein the mouse pluripotent stem cells are deficient for Rag2 and / or IL2rg.

[0210] 45. A method according to any one of 42-44, wherein the EPO promoter sequence is the sequence of the human EPO promoter.

[0211] 46. ​​A method according to any one of 42-44, wherein the EPO promoter sequence is the sequence of an endogenous non-human EPO promoter.

[0212] 47. A method according to any one of 42-46, wherein the integration results in replacement of the non-human EPO gene at the non-human EPO gene locus.

[0213] 48. A method according to any one of items 42-47, wherein the nucleic acid sequence encoding hEPO comprises human EPO genomic coding and non-coding sequences.

[0214] 49. The method according to any one of 42-48, wherein the nucleic acid sequence encoding hEPO comprises a human EPO cDNA sequence.

[0215] 50. A method for generating a mouse expressing human EPO protein (hEPO) and comprising a human hematopoietic system, comprising:

[0216] A cell population comprising human hematopoietic progenitor cells is transplanted into a genetically modified mouse generated by the method according to any one of 42-49.

[0217] 51. The method according to 50, wherein the transplantation comprises tail vein injection, fetal liver injection, or retro-orbital injection.

[0218] 52. The method according to 50 or 51, wherein the genetically modified mouse is sublethally irradiated prior to transplantation.

[0219] 53. A method according to any one of 50-52, wherein the human hematopoietic progenitor cells are CD34+ cells.

[0220] 54. A method according to any one of items 50-53, wherein the human hematopoietic progenitor cells are from fetal liver, adult bone marrow, or umbilical cord blood.

[0221] 55. A method for generating mice infected with a human pathogen that targets human cells of the erythroid lineage, comprising:

[0222] According to the method of 50-54, a mouse expressing human EPO protein (hEPO) and comprising a human hematopoietic system is generated,

[0223] The mice were injected with clodronate and

[0224] The mice were injected with parasite-infected human red blood cells (PRBC).

[0225] 56. The method according to 55, wherein the method further comprises injecting healthy human red blood cells into the mouse.

[0226] 57. The method according to 55, wherein the parasite is selected from Plasmodium, Babesia, and Theileria.

[0227] 58. The method according to 57, wherein the parasite is a Plasmodium and the Plasmodium is selected from Plasmodium falciparum and Plasmodium vivax. Example

[0228] The following examples are presented to provide a person of ordinary skill in the art with a complete disclosure and description of how to implement and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments that were implemented. Efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be considered. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is or is close to atmospheric pressure.

[0229] General methods of molecular and cellular biochemistry can be found in standard textbooks such as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosure of which is incorporated herein by reference. Reagents, cloning vectors, and kits for genetic manipulations mentioned in this disclosure are available from suppliers such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and ClonTech.

[0230] Example 1

[0231] Generation of human EPO knock-in mice.

[0232] The coding sequence at the mouse erythropoietin gene locus (mouse NCBI Gene ID: 13856; MGI: 95407; RefSeq transcript cDNA of NM_007942.2 (SEQ ID NO: 1) and the encoded protein of NP_031968 (SEQ ID NO: 2)) was replaced with the coding sequence from the human erythropoietin gene locus (human NCBI Gene ID: 2056; HGNC: 3415; RefSeq cDNA transcript of NM_000799.2 (SEQ ID NO: 3) and the encoded protein of NP_000790 (SEQ ID NO: 4)).

[0233] Table 1

[0234]

[0235]

[0236] Specifically, the mouse genome region at GRCm38:ch5:137482017:137485745 (negative chain) was deleted and the human genome sequence from GRCh37:ch7:100318604:100321567 (positive chain) was inserted in its position. This causes the coding exons 1 to 5 (the entire coding region) of the mouse Epo gene to be replaced by exons 1 to 5 of the human EPO gene plus 3' human untranslated region. A total of 3729nt mouse sequences are replaced by 2964nt human sequences.

[0237] In short, use Genetic engineering techniques were used to construct a targeting construct for replacing the mouse EPO gene with the human EPO gene in a single targeting step (see Valenzuela et al. (2003) supra, and U.S. Pat. No. 6,586,251). Mouse and human EPO DNA were obtained from bacterial artificial chromosomes bMQ-386K4 and RP11-797M3, respectively. The APspXI linearized targeting construct generated by gap repair cloning was electroporated into Rag2 - / - IL Y / - In ES cells, the targeting construct contains a 2964 nt human EPO sequence flanked by upstream and downstream homology arms of mouse EPO (extending from the ATG in exon 1 to the stop codon in exon 5, i.e. including the 3' downstream sequence) and a neo selection cassette flanked by lox (floxed) Figure 2 and Figure 3 ). The junction between the mouse EPO 5' untranslated region (UTR) and human EPO exon 1 is provided as SEQ ID NO:5, wherein the last mouse nucleotide preceding the first nucleotide of the human gene is "G" (shown in square brackets) in the non-bold portion of SEQ ID NO:5 in Table 2 below, and the first nucleotide of the human sequence is "A" (shown in square brackets) in the bold portion of SEQ ID NO:5 in Table 2 below.

[0238] Table 2

[0239]

[0240] The junction between the human 3'UTR and the 5' end of the selection cassette is provided as SEQ ID NO:6, wherein the last nucleotide of the human sequence is "C" in the bold portion of SEQ ID NO:6 in Table 3 below (shown in single square brackets), and the first nucleotide of the selection cassette sequence is "C" in the non-bold portion of SEQ ID NO:6 in Table 3 below (shown in double square brackets); the downstream junction region also contains a loxP site at the 3' end, which is used to remove the ubiquitin promoter-driven neo cassette flanked by lox.

[0241] Table 3

[0242]

[0243] The junction between the 3' end of the selection cassette and the mouse genome is provided as SEQ ID NO:7, wherein the "C" shown in single square brackets is the last nucleotide of the neo cassette and the first nucleotide of the mouse genome following the cassette is the "G" shown in double square brackets, as shown in Table 4 below.

[0244] Table 4

[0245]

[0246] Correctly targeted hEPO ES cell clones were identified by the loss of natural allele (LONA) assay (Valenzuela et al. (2003) supra), in which two TaqMan genomic loci specific for the sequence targeted for deletion in the mouse EPO gene were identified. TM Quantitative polymerase chain reaction (qPCR) assays were performed to determine the copy number of the native, unmodified EPO gene. The qPCR assay contained the following primer-probe set (written 5' to 3'): upstream forward primer, CATCTGCGACAGTCGAGTTC (SEQ ID NO: 8); upstream reverse primer, CCAGGGAGCTTACCGTGAC (SEQ ID NO: 9); upstream probe, FAM-AGGTACATCTTAGAGGCCAAGGAGGCA-BHQ (SEQ ID NO: 10); downstream forward primer, ACAGCCGAGTCCTGGAGAG (SEQ ID NO: 11); downstream reverse primer, AAGCCCTGAGCGTGAGTTC (SEQ ID NO: 12); downstream probe, FAM-AGGCCAAGGAGGCCGAGAATATCACG-BHQ (SEQ ID NO: 13); wherein FAM refers to 5-carboxyfluorescein fluorescent probe and BHQ refers to a fluorescent quencher of the black hole quencher type (Biosearch Technologies). PCR plates (MicroAmpTM DNA purified from ES cell clones that had taken up the targeting vector and incorporated it into their genome was mixed with TaqMan TM Gene expression master mix (Life Technologies) was combined and cycled in an Applied Biosystems Prism 7900HT, which collects fluorescence data during the PCR process and determines the threshold cycle (Ct), that is, the fractional PCR cycle at which the accumulated fluorescence reaches a preset threshold. Upstream and downstream EPO-specific qPCR and two qPCRs for non-targeted reference genes were run for each DNA sample. The Ct value difference (ΔCt) between each EPO-specific qPCR and each reference gene qPCR was calculated, and then the difference between each ΔCt and the median ΔCt of all assayed samples was calculated to obtain a ΔΔCt value for each sample. The number of copies of the EPO gene in each sample was calculated from the following formula: Copy number = 2·2 -ΔΔCt A correctly targeted clone that has lost one of its natural copies will have an EPO gene copy number equal to 1. The clones were cloned by a TaqMan TM Confirmation of the mouse EPO gene sequence replacement deletion in the humanized allele was performed by qPCR assay: human forward primer, GAGCCCTGCACTGGACAAC (SEQ ID NO: 14); human reverse primer, TCCCATGAACGCTGAGAGTC (SEQ ID NO: 15); and human probe, AGGGTCAAGGAGCCATAGACAGAATGGC (SEQ ID NO: 16).

[0247] Correctly targeted ES cells were electroporated with a transient Cre expression vector to remove the drug selection cassette. To generate mice containing human EPO and deficient in Rag2 and Il2rg, correctly targeted ES cells were identified as described above and introduced into preimplantation embryos using techniques known in the art. Human EPO knock-in (KI) mice were then backcrossed to generate mice deficient in Rag2 and Il2rg and expressing human EPO.

[0248] Example 2

[0249] Generation of human SIRPα mice.

[0250] In conjunction with some of the examples described herein, a genetically modified mouse comprising a nucleic acid sequence encoding human SIRPα randomly integrated into the genome of the genetically modified mouse was prepared as described in U.S. Patent Application Publication No. 2013-0340105 (the disclosure of which is incorporated herein by reference).

[0251] In conjunction with some of the examples described herein, human SIRPα knock-in mice were prepared as described below. Human SIRPα is known to exist in at least 10 allelic forms. In this particular example, human SIRPα variant 1 was used to humanize the endogenous SIRPα gene of the mouse.

[0252] use The targeting vector for the extracellular region of a humanized SIRP (eg, SIRPα) gene is constructed using the genomic DNA technology (see, eg, US Pat. No. 6,586,251 and Valenzuela et al. (2003), supra).

[0253] Briefly, the mouse bacterial artificial chromosome (BAC) clone bMQ-261H14 was modified to delete the sequence containing exons 2 to 4 of the endogenous SIRPα gene and the exons 2 to 4 of the human SIRPα gene were inserted using the human BAC clone CTD-3035H21. The genomic DNA (~8555 bp) corresponding to exons 2 to 4 of the endogenous SIRPα gene in the BAC clone bMQ-261H14 was replaced with a ~8581 bp DNA fragment containing exons 2 to 4 of the human SIRPα gene from the BAC clone CTD-3035H21. Sequence analysis of the human SIRPα allele contained in the BAC clone CTD-3035H21 revealed an allele corresponding to human variant 1. A neomycin cassette flanked by loxP sites was added to the end of the ~8581 bp human DNA fragment containing exons 2 to 4 of the human SIRPα gene ( Figure 4 ).

[0254] The upstream and downstream homology arms were obtained from mouse BAC DNA at the 5' and 3' positions of exons 2 and 4, respectively, and added to the ~8581 bp human fragment-neomycin cassette to create the final targeting vector for humanizing the endogenous SIRPα gene, which contains from 5' to 3' a 5' homology arm (19 kb mouse DNA containing 5' of exon 2 of the endogenous SIRPα gene), a ~8581 bp DNA fragment (containing exons 2 to 4 of the human SIRPα gene), a neomycin cassette flanked by loxP sites, and a 3' homology arm (21 kb mouse DNA containing 3' of exon 4 of the endogenous SIRPα gene). Targeted insertion of the targeting vector positions the neomycin cassette in the fifth intron between exons 4 and 5 of the mouse SIRPα gene. The targeting vector was linearized by SwaI digestion and then used for homologous recombination in bacterial cells to achieve targeted replacement of exons 2 to 4 of the human SIRPα gene with exons 2 to 4 of the mouse SIRPα gene ( Figure 4 ).

[0255] Mouse ES cells were electroporated with targeted BAC DNA (described above) to create modified ES cells containing the replacement of exons 2 to 4 of the endogenous mouse SIRPα gene with a genomic fragment containing exons 2 to 4 of the human SIRPα gene. TMThe probe (Lie and Petropoulos, 1998. Curr. Opin. Biotechnology 9: 43-48) was used to identify positive ES cells containing a genomic fragment comprising exons 2 to 4 of the human SIRPα gene by quantitative PCR. The nucleotide sequence spanning the upstream insertion point includes the following, which indicates the endogenous mouse sequence upstream of the insertion point (enclosed in parentheses below) that is continuously linked to the human SIRPα genomic sequence present at the insertion point: (AGCTCTCCTACCACTAGACTGCTGAGACCCGCTGCTCTGCTCAGGACTCGATTTCCAGTACACAATCTCCCTCTTTGAAAAGTACCACACATCCTGGGGT)GCTCTTGCATTTGTGTGACACTTTGCTAGCCAGGCTCAGTCCTGGGTTCCAGGTGGGGACTCAAACACACTGGCACGAGTCTACATTGGATATTCTTGGT (SEQ ID NO: 17). The nucleotide sequence spanning the downstream insertion point at the 5' end of the neomycin cassette includes the following, which indicates the human SIRPα genomic sequence contiguous to the cassette sequence downstream of the insertion point (the loxP sequence contained in parentheses below is in italics): GCTCCCCATTCCTCACTGGCCCAGCCCCTCTTCCCTACTCTTTCTAGCCCCTGCCTCATCTCCCTGGCTGCCATTGGGAGCCTGCCCCACTGGAAGCCAG (TCGAGATAACTTCGTATAATGTATGCTATACGAAGTTATATGCATGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCGA) (SEQ ID NO: 18). The nucleotide sequence spanning the downstream insertion point at the 3' end of the neomycin cassette included the following, which indicates a cassette sequence contiguous with the mouse genomic sequence 3' to exon 4 of the endogenous SIRPα gene (enclosed in parentheses below): CATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGACCTCGACCTGCAGCCCCTAGATAACTTCGTATAATGTATGCTATACGAAGTTATGCTAGC (TGTCTCATAGAGGCTGGCGATCTGGCTCAGGGACAGCCAGTACTGCAAAGAGTATCCTTGTTCATACCTTCTCCTAGTGGCCATCTCCCTGGGACAGTCA) (SEQ ID NO: 19). The method (see, e.g., U.S. Patent No. 7,294,754 and Poueymirou et al. 2007, F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99, supra) uses positive ES cell clones to implant female mice to generate a litter of pups containing exons 2 to 4 of the human SIRPα gene inserted into the mouse endogenous SIRPα gene.

[0256] The targeted ES cells described above were used as donor ES cells and Methods (see above) were introduced into 8-cell stage mouse embryos. Mice carrying humanization of exons 2 to 4 of the endogenous SIRPα gene were identified by genotyping using a modified allele determination method (Valenzuela et al. (2003), supra) that detects the presence of human SIRPα gene sequences.

[0257] Mice carrying humanized SIRPα gene constructs (i.e., containing human SIRPα exons 2 to 4 in the mouse SIRPα gene) can be bred with Cre deletion mouse strains (see, e.g., International Patent Application Publication No. WO 2009 / 114400) to remove any lox-flanked neomycin cassette introduced by the targeting vector that was not removed, e.g., at the ES cell stage or in the embryo. Optionally, the neomycin cassette is retained in the mouse.

[0258] Example 3

[0259] Generation of compound knock-in mice.

[0260] The human EPO knock-in mice are crossed with mice expressing other human genes of interest (either as random integrants into the mouse genome or as knock-ins, i.e., from the corresponding mouse loci). - / - ,IL-2rg Y / -hEPOKI mice are crossed with mice expressing human TPO from the mouse TPO locus as described above (Rongvaux et al., 2011, Proc Natl Acad Sci USA, 108(6):2378-2383), human IL-3 and human GM-CSF from the mouse IL-3 / GM-CSF locus (Willinger et al, 2011, Proc Natl Acad Sci USA, 108(6):2390-2395), human M-CSF from the mouse M-CSF locus (Rathinam et al, 2011, Blood, 118(11):3119-3128), and / or as random integrants (Strowig et al., 2011, Proc Natl Acad Sci USA, 108(32):13218-13223) or human SIRPα from the mouse locus to generate combinations of these human proteins (Rag2 - / - Iq 无效 h h / h Tpo h / h Mcsf h / h Il3 / Gmcsf h / h EPO h / h ). Genetically modified mice expressing one or more of human TPO, human IL-3, human GM-CSF, human M-CSF, and human SIRPα are described in great detail in U.S. Patent Nos. 8,541,646 and 8,847,004; U.S. Patent Application Publication No. 2014 / 0134662; and PCT International Publication No. WO / 2014 / 039782; the disclosures of which are incorporated herein by reference.

[0261] Example 4

[0262] Development of humanized mouse models for blood-stage Plasmodium falciparum and Plasmodium vivax

[0263] It is demonstrated herein that genetically humanizing murine hosts by providing growth factors with limited cross-reactivity from mouse to human can successfully enhance erythropoiesis in mice engrafted with human cells in general and human hematopoietic stem cells (HSCs) in particular.

[0264] MITERG mice, which express human EPO (to enhance terminal erythropoiesis) as well as human TPO, MCSF, and IL-3 (to enhance HSC maintenance and early erythropoiesis) from their genome, are characterized by higher levels of human erythropoiesis in the bone marrow of human HSC-engrafted mice than mice that do not express hEPO ( Figure 5Panel A, comparing "hSIRPa-, hEPO+" (i.e., "MITERG mice") to "hSIRPa-, hEPO-" (i.e., "MITRG mice"), virtually identical mouse erythropoiesis in the same animals. However, these mice lack significant levels of circulating human erythrocytes (data not shown).

[0265] We hypothesized that low levels of circulating human erythrocytes in the periphery are derived from the destruction of peripheral human RBCs by mouse macrophages (erythrophagocytosis). We generated mice expressing hSIRPa from a locus other than the mSIRPa locus in the mouse genome, i.e., as a randomly integrated transgene, i.e., hSIRPa-tg (Rag2 - / - Iq 无效 Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h SIRPα-tg+, i.e., “MISTER-G mice”) and mice expressing hSIRPa from the mSIRPa locus as knock-in (KI), i.e., hSIRPa KI (Rag2 - / - Iq 无效 Tpo h / h Mcsf h / h Il3 h / h G h / h Epo h / h SIRPα h / h , “SupER-G mice”), and assessed the role of SIRPa in this process.

[0266] For example, as a randomly integrated transgene in MISTER-G mice, expression of human SIRPa promotes further expansion of human erythrocyte numbers in the bone marrow of mice engrafted with human HSC expressing human EPO ( Figure 5 , Panel A, compares “hSIRPa+, hEPO+” with “hSIRPa-, hEPO+”). The introduction of human SIRPa significantly improved the survival of most hematopoietic cells in the periphery, among which human CD45 + The frequency of human RBCs (including lymphoid and myeloid cells) was increased at least 10-fold over that observed in mice that did not express hSIRPa. However, hSIRPa KI had little effect on the level of human RBC engraftment in peripheral blood ( Figure 5 , panel B).

[0267] Since knock-in of human SIRPα was insufficient to increase human erythrocytes in peripheral blood, clodronate liposomes were used to deplete macrophages, specifically red pulp macrophages in the spleen and Kupffer cells in the liver. After depletion of tissue-resident macrophages by clodronate liposomes, a significant increase in circulating human cells of the erythroid lineage was observed in SuPER-G mice to 1% of total circulating erythroid cells ( Figure 6 , Panel A). In addition, the majority of human erythrocytes in the periphery after clodronate treatment are reticulocytes (CD71 + )( Figure 6 , Panel B). This is an exciting observation as it indicates that these mice would be good candidates to support P. vivax infection, which preferentially infects reticulocytes.

[0268] Erythrocyte infection is an essential part of the life cycle of Plasmodium. However, the required frequency of human RBCs necessary for successful in vivo infection of different Plasmodium species has not yet been established. The only in vivo model of Plasmodium falciparum currently available is based on transferring human RBCs into immunodeficient strains such as NOD / scid or NSG. In these mice, merozoite infection can only be achieved by iv injection of infected red blood cells after daily injection of large amounts of human red blood cells. At the time of infection, human RBCs account for approximately half of the total red blood cell number in these animals.

[0269] As demonstrated above, SupER-G mice transplanted with human hematopoietic stem cells (HSCs) develop human erythroid cells ( Figure 5 Panel B), and ii) clodronate treatment increases the frequency of human erythrocytes in the periphery of engrafted SupER-G mice ( Figure 6 ). To determine whether the engrafted, clodronate-treated SupER-G mice contain sufficient numbers of human erythrocytes in the periphery to sustain a successful Plasmodium infection in vivo, peripheral blood was collected from SupER-G mice engrafted with fetal liver or adult HSCs and cultured in vitro with blood infected with Plasmodium falciparum strain 3D7. To drive multiple rounds of parasite replication, fresh human erythrocytes were added to the infection cultures 48 hours later, with the expectation that expansion by reinfection of subsequently added human RBCs would only occur if human RBCs harvested from HSC-engrafted SupER-G mice had produced a full infection cycle of Plasmodium falciparum. Twelve days after infection, advanced stages of parasite infection and expansion of merozoites from schizonts were observed in all blood samples from engrafted SuPER-G mice ("engrafted mouse RBC, adult 1", "engrafted mouse RBC, adult 2", and "engrafted mouse RBC, fetal liver"), but not in blood samples from control mice that were not engrafted or acutely engrafted with 0.1% hRBC by injection ("spiked control") ( Figure 7Panel A and data not shown). Exponential growth of parasitemia was observed by Giemsa staining and quantitative PCR ( Figure 7 Panel B). This indicates that the engrafted, clodronate-treated SupER-G generated sufficient numbers of human erythrocytes to sustain infection with P. falciparum. From this, it is expected that in vivo infection of P. falciparum and P. vivax merozoites with clodronate-administered engrafted mice will be successful.

[0270] Example 5

[0271] TIES mice (Rag2- / -Il2rg null Tpoh / hIl3 / Gmcsfh / hEpoh / mSIRPαh / h)

[0272] Due to low fertility, developmental incompetence, and high mortality, patients with Epo h / h Mice that are heterozygous for the hEPO gene (i.e., Epo h / m , such as TIES mice) are fully capable of producing erythropoietin (EPO) and supporting all stages of erythropoiesis. A further improvement in viability from 8-10 weeks to 4 months was achieved by retaining the mouse M-CSF gene at the mouse locus rather than replacing it with human M-CSF, because the high level of human myeloid cell engraftment supported by the human macrophage colony stimulating factor (M-CSF) knock-in caused destruction of mouse red blood cells, which led to anemia and death of the engrafted mice.

[0273] Like SupER-G mice, TIES mice support human erythropoiesis and maintain a frequency of 1% human erythrocytes in peripheral blood if clodronate is administered. In addition, most human erythrocytes in the periphery after clodronate treatment are reticulocytes (CD71+). This suggests that these mice would be good candidates to support P. vivax infection.

[0274] It was demonstrated that engrafted TIES mice were able to maintain a 1% human RBC frequency in peripheral blood if clodronate was administered. In addition, the ability of TIES mice to support human RBC transfusions was determined. Figure 8 As shown in , clodronate treatment stabilized the infused population to more than 20% of the total cell population in the periphery. These levels, achieved approximately 4 hours after infusion, were maintained for at least 12 hours after infusion. It is expected that these RBC frequencies will be sufficient to support in vivo infection with different species of Plasmodium.

[0275] The above only illustrates the principles of the present invention. It should be appreciated that those skilled in the art will be able to come up with various arrangements, which, although not explicitly described or shown herein, embody the principles of the present invention and are included in its spirit and scope. In addition, all examples and conditional language described herein are intended in principle to help readers understand the principles of the present invention and the concept of the inventor's promotion of technological progress, and should be interpreted as not being limited to such specific examples and conditions. In addition, all statements of the principles of the present invention, aspects and embodiments and their specific examples described herein are intended to cover both their structural and functional equivalents. Thus, such equivalents include both currently known equivalents and future development equivalents, that is, including any elements developed for the implementation of the same function, which are independent of the structure. Therefore, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. And the attached claims embody the scope and spirit of the present invention.

Claims

1. A method for producing a genetically modified rodent, comprising: Spawn a rodent containing: A nucleic acid sequence encoding a human EPO (hEPO) protein operably linked to an endogenous rodent EPO promoter at a rodent EPO gene locus, wherein the operably linked sequence results in a null mutation in the rodent EPO gene at the rodent EPO gene locus, a nucleic acid sequence encoding a human M-CSF (hM-CSF) protein operably linked to an endogenous rodent M-CSF promoter at a rodent M-CSF gene locus, wherein the rodent is heterozygous null or homozygous null for the rodent M-CSF gene, a nucleic acid sequence encoding a human IL-3 (hIL-3) protein operably linked to an endogenous rodent IL-3 promoter at a rodent IL-3 gene locus, wherein the rodent is heterozygous null or homozygous null for the rodent IL-3 gene, a nucleic acid sequence encoding a human GM-CSF (hGM-CSF) protein operably linked to an endogenous rodent GM-CSF promoter at the rodent GM-CSF gene locus, wherein the rodent is heterozygous null or homozygous null for the rodent GM-CSF gene, a nucleic acid sequence encoding a human TPO (hTPO) protein operably linked to an endogenous rodent TPO promoter at the rodent TPO gene locus, wherein the rodent is heterozygous null or homozygous null for the rodent TPO gene, and a Sirpa transgene encoding a human Sirpa (hSirpa) protein, wherein the rodent expresses the hSirpa protein, wherein the genetically modified rodent is immunodeficient.

2. The method according to claim 1, wherein the rodent is homozygous for an allele comprising the nucleic acid sequence encoding hEPO.

3. The method according to claim 1 or 2, wherein the nucleic acid sequence encoding hEPO comprises human EPO genome coding and non-coding sequences.

4. The method according to any one of claims 1 to 3, wherein the nucleic acid sequence encoding hEPO comprises a human EPO cDNA sequence.

5. The method according to any one of claims 1 to 4, wherein the rodent is homozygous for the nucleic acid sequence encoding hTPO, the nucleic acid sequence encoding hM-CSF, the nucleic acid sequence encoding hIL-3, and the nucleic acid sequence encoding hGM-CSF.

6. A method according to any one of claims 1 to 5, wherein the rodent further comprises an incorporation of human hematopoietic cells, wherein optionally the human hematopoietic cells comprise one or more cells selected from the group consisting of human CD34-positive cells, human hematopoietic stem cells, human myeloid cell precursor cells, human erythroid precursor cells, human myeloid cells, human dendritic cells, human monocytes, human granulocytes, human erythrocytes, human neutrophils, human mast cells, human thymocytes, and human B lymphocytes.

7. The method according to claim 6, wherein the rodent comprises clodronate.

8. The method according to claim 7, wherein the rodent further comprises an infection with a pathogen that targets human cells of the erythroid lineage, wherein optionally the pathogen is selected from Plasmodium sp., Babesia sp., and Theileri sp.

9. The method according to any one of claims 1 to 8, wherein the immunodeficiency is caused by deficiencies in both Rag2 and Il2rg.

10. One or more oligonucleotides selected from the group consisting of: CATCTGCGACAGTCGAGTTC(SEQ ID NO:8); CCAGGGGAGCTTACCGTGAC(SEQ ID NO:9); FAM-AGGTACATCTTAGAGGCCAAGGAGGCA-BHQ (SEQ ID NO: 10); ACAGCCGAGTCCTGGAGAG(SEQ ID NO:11); AAGCCCTGAGCGTGAGTTC (SEQ ID NO: 12); FAM-AGGCCAAGGAGGCCGAGAATATCACG-BHQ (SEQ ID NO: 13); GAGCCCTGCACTGGACAAC(SEQ ID NO:14); TCCCATGAACGCTGAGAGTC (SEQ ID NO: 15); and AGGGTCAAGGAGCCATAGACAGAATGGC (SEQ ID NO: 16).

Images