Tuberculosis vaccine compositions comprising immunoactive site fusion proteins

Abstract

The present invention provides a fusion protein vaccine composition which identifies an immunocompetent domain (domain, site or fragment) in an Rv2299c protein, and removes unwanted sites or selects only desired moieties to link to other immunocompetent proteins or sites, thereby effectively activating an immune response in a tuberculosis patient, improving the immunocompetent activity of the Rv2299c protein, and improving the immunocompetent activity of the Rv2299c protein and the immunocompetent activity of the Rv2299c protein in the Rv2299c protein in the Rv2299c protein in the Rv2299c protein in the Rv2299c protein. And an epoch-making contribution is made to prevention or treatment of tuberculosis.

Description

Technical Field

[0001] The present invention relates to a tuberculosis vaccine composition comprising an immunologically active site fusion protein. Background Art

[0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (Mtb), and is one of the infectious diseases that has claimed the most human lives to date. In 2019, 1.4 million people died of tuberculosis worldwide, and in 2020, the mortality rate increased further due to restrictions on access to medical services caused by COVID-19. South Korea is one of the countries with the most serious tuberculosis problem among the member countries of the Organization for Economic Cooperation and Development (OECD).

[0003] In order to solve this tuberculosis problem, a safe vaccine with significant protective effects is most needed. However, the preventive effect of BCG (Mycobacterium bovis Bacillus Calmette-Guérin, BCG), the only tuberculosis vaccine, is controversial. Its preventive effect ranges from 0% to 80% depending on the reporter, and it is reported that it has no preventive effect on reactivation of latent tuberculosis or adult tuberculosis. However, since it has a preventive effect on severe tuberculosis in children, although many countries are administering it, a vaccine with more significant efficacy than BCG has not yet been developed.

[0004] The World Health Organization (WHO) End TB strategy aims to reduce the incidence of tuberculosis by 90% and the mortality by 95% between 2015 and 2035. South Korea has also set a goal of reducing the incidence of tuberculosis to less than 10 per 100,000 people under the End TB 2030 plan and is moving forward with it. To achieve such a world without tuberculosis, it is necessary to develop a tuberculosis vaccine that can be a game changer.

[0005] The three TB vaccine development goals proposed by WHO are as follows: ① an affordable TB vaccine for infants and young children with efficacy and safety comparable to BCG, ② a safe, effective and affordable TB vaccine for adolescents and adults, and ③ a therapeutic vaccine to improve the efficiency of TB treatment.

[0006] Currently, there are 14 tuberculosis vaccines in clinical trials worldwide, which are divided into the following categories according to their functions: ① vaccines based on live bacteria to replace BCG as a prime vaccine, ② BCG booster vaccines using immunopotentiators or viral vectors, and ③ other vaccines such as bacterial extracts or immunotherapy vaccines based on apoptotic non-tuberculous mycobacterium species for the purpose of shortening treatment time or inhibiting relapse. However, none of these vaccines has yet come close to the goal of developing a tuberculosis vaccine.

[0007] The development of live bacteria-based vaccines to replace BCG is mainly in the form of genetically recombinant BCG strains and Mycobacterium tuberculosis strains that lack two genes at the same time. These live bacteria-based vaccines contain more antigens than subunit vaccines and induce immune responses in a variety of ways, so high defense effects can be expected. However, with regard to the development of recombinant strains or gene-deficient strains, a longer development period is required due to the removal of antimicrobial resistance markers and safety certification issues, and strict quality management is required even in the preparation of vaccine strains after development. Due to these limitations, the development of vaccines to replace BCG has been focused on the development of subunit vaccines using proteins, but this subunit vaccine has limitations in replacing BCG, so it is mainly developed as a BCG booster vaccine.

[0008] On the other hand, in recent years, due to the increase in the aging population, the increase in immunosuppressant therapy, and the increase in HIV infection, the incidence of tuberculosis due to the reactivation of latent tuberculosis has increased, and the emergence of drug-resistant tuberculosis has made treatment difficult, so the development of a therapeutic vaccine that can assist in treatment has also become an important hotspot. Since most of the therapeutic vaccines currently under development use nontuberculous mycobacteria (NTM) or bacterial extracts, it would be ideal if a therapeutic vaccine based on a fusion protein composed of multiple proteins could be developed.

[0009] As a prior art, a composition for promoting maturation of dendritic cells comprising Rv2299c or a protein fused with Rv2299c and ESAT6 is disclosed in Korean Patent No. 1749165, and a method for differentiating immature dendritic cells into dendritic cells is proposed. In addition, a composition for boosting BCG vaccine of Rv2299c-ESAT6-HspX-RipA fusion protein is disclosed in Korean Patent No. 2193304, and a composition for tuberculosis immunotherapy comprising Rv2882c-Rv2005c fusion protein is disclosed in Korean Publication Patent No. 2021-0157659, and a composition for maturation induction of dendritic cells comprising Rv2005c protein of Mycobacterium tuberculosis as an effective ingredient is disclosed in Korean Patent No. 1452983. However, due to the problem of increased molecular weight of the fusion protein as described above, there are difficulties in standardization of the purification process, etc. Therefore, it is necessary to develop a vaccine composition that can reduce protein molecular weight and maximize immune activity. Summary of the invention

[0010] Problem that the invention aims to solve

[0011] The object of the present invention is to provide a tuberculosis vaccine composition comprising an immunologically active site fusion protein.

[0012] Another object of the present invention is to provide a tuberculosis preventive vaccine or tuberculosis therapeutic vaccine comprising the immune active site fusion protein.

[0013] Means used to solve problems

[0014] The present invention provides a tuberculosis vaccine composition comprising a fusion protein of an immunologically active site of Rv2299c and ESAT6.

[0015] The immunologically active site of Rv2299c may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO.1 to SEQ ID NO.5. In addition, the immunologically active site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO.3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO.4, or a combination of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO.5.

[0016] The present invention provides a tuberculosis vaccine composition comprising a fusion protein of an immunologically active site of Rv2299c and ESAT6.

[0017] The immunologically active site of Rv2299c may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO.1 to SEQ ID NO.5. In addition, the immunologically active site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO.3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO.4, or a combination of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO.5.

[0018] The present invention provides a tuberculosis vaccine composition, characterized in that the immunologically active site of Rv2299c and the end of the fusion protein of ESAT6 are combined with a Bacillus Calmette-Guérin-Cell Wall Skeleton (BCG-CWS).

[0019] The tuberculosis vaccine composition of all compositions provided in the present invention may be a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

[0020] The end of the immunologically active site of Rv2299c and the fusion protein of ESAT6 of the present invention may also contain one or more Mycobacterium tuberculosis derived antigens or their immunologically active sites selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220 and Rv0869c. In this case, the Mycobacterium tuberculosis derived antigen or its immunologically active site may be an antigen or its immunologically active site consisting of one or more amino acid sequences selected from the group consisting of SEQ ID NO.1 to SEQ ID NO.22.

[0021] More specifically, the present invention provides a composition for tuberculosis vaccine, characterized in that the end of the fusion protein of the immunologically active site of Rv2299c and ESAT6 further comprises any one Mycobacterium tuberculosis derived antigen or its immunologically active site selected from the following groups, the group consisting of RpfED1 composed of the amino acid sequence of SEQ ID NO.8, Rv3463 composed of the amino acid sequence of SEQ ID NO.19, Rv2005cD3-Rv3463 composed of the amino acid sequence of SEQ ID NO.18 and SEQ ID NO.19 connected and fused in sequence, Rv2882cD2-Rv2005cD3-Rv3463D2 composed of the amino acid sequence of SEQ ID NO.12, SEQ ID NO.18 and SEQ ID NO.21 connected and fused in sequence, and Rv3463D3-Rv2005cD3-Rv3463D2 ... NO.21 is connected and fused in sequence, Rv2005cD3-Rv1605-Rv3463D2 is composed of an amino acid sequence of SEQ ID NO.21 and SEQ ID NO.12 connected and fused in sequence, Rv3463D2-Rv2882cD2 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.15 connected and fused in sequence, Rv3463D2-Rv2882cD2-Rv2145cD2 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.8 connected and fused in sequence, Rv3463D2-Rv2882cD2-Rv2145cD2 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.8 connected and fused in sequence, NO.15 connected and fused in sequence, Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2, composed of an amino acid sequence composed of the amino acid sequences of SEQ ID NO.21 and SEQ ID NO.18 connected and fused in sequence, and Rv3463D2-Rv2005cD3-RpfED1, composed of an amino acid sequence composed of the amino acid sequences of SEQ ID NO.21, SEQ ID NO.18 and SEQ ID NO.8 connected and fused in sequence.

[0022] In the present invention, the fusion protein represented by Rv2299cD2D3-ESAT6 refers to a polypeptide consisting of an amino acid sequence in which the amino acid sequences of SEQ ID NO.5 and SEQ ID NO.6 are sequentially connected and fused, and refers to a polypeptide in which one end of Rv2299cD2D3 is connected to the other end of ESAT6. The production of the Rv2299cD2D3-ESAT6 fusion protein is produced by using the recombinant protein production method of pET-22b(+)_Rv2299cD2D3-ESAT6 in Example 1.2 below.

[0023] Hereinafter, in the present invention, a fusion protein comprising two or more Mycobacterium tuberculosis-derived antigens or immunologically active sites thereof refers to a polypeptide consisting of amino acid sequences in which the amino acid sequences of the corresponding Mycobacterium tuberculosis-derived antigens or immunologically active sites thereof are sequentially linked and fused with or without a linker.

[0024] In the present invention, preventive vaccines refer to vaccines that are pre-vaccinated before exposure to pathogens, and can prevent diseases by activating the immune system even if the pathogens enter the body later, and therapeutic vaccines, although most of them also have preventive functions, refer to vaccines prepared for the purpose of treating infected patients. Preventive vaccines for tuberculosis include primary vaccines and booster vaccines. Primary vaccines are vaccinated in infancy and are intended to expose to Mycobacterium tuberculosis (M.tuberculosis) as early as possible. Booster vaccines are vaccinated in adolescence or adults, and are intended to induce an increase in immune response after primary vaccines or latent tuberculosis infection. Therapeutic vaccines refer to methods of direct administration in a short period of time.

[0025] The terminal of the fusion protein comprising the Mycobacterium tuberculosis derived antigen or its immunologically active site of the present invention is also combined with BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS), thereby increasing the immune activity.

[0026] In addition, the present invention provides a tuberculosis vaccine composition, characterized in that the tuberculosis vaccine composition comprises any one fusion protein selected from the following groups, the group consisting of Rv2882c-Rv2005c-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO.10, SEQ ID NO.16 and SEQ ID NO.19 are connected and fused in sequence, Rv2882c-Rv2005cD3-ESAT6-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO.10, SEQ ID NO.16, SEQ ID NO.6 and SEQ ID NO.19 are connected and fused in sequence, and Rv2882c-Rv2005cD3-ESAT6-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO.23, SEQ ID NO.12, SEQ ID NO.15, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 is composed of an amino acid sequence of SEQ ID NO.22, SEQ ID NO.12, SEQ ID NO.18, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 is composed of an amino acid sequence of SEQ ID NO.23, SEQ ID NO.6, SEQ ID NO.19, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv2220-ESAT6-Rv3463 is composed of an amino acid sequence of SEQ ID NO.23, SEQ ID NO.6, SEQ ID NO.19, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; The invention relates to Rv0869c-ESAT6-Rv2005cD3-Rv3463, which is composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO.24, SEQ ID NO.6, SEQ ID NO.18 and SEQ ID NO.19 are connected and fused in sequence, and Rv1605-ESAT6-Rv2005cD3-Rv3463, which is composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO.22, SEQ ID NO.6, SEQ ID NO.18 and SEQ ID NO.19 are connected and fused in sequence.

[0027] In addition, the end of the fusion protein is bound to a BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS), thereby increasing the immune activity, and the tuberculosis vaccine composition can be a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

[0028] The fusion protein contained in the tuberculosis vaccine composition of the present invention can be produced according to methods known in the art. For example, an automated polypeptide synthesizer can be used to produce it in a recombinant or synthetic manner, and it can be inserted into a vector and transformed into Escherichia coli, etc. by a known method, and the fusion protein can be produced by mass culture. The fusion protein or antigen may include an appropriate purification tag (or affinity tag) that allows purification from an unpurified biological source (e.g., a recombinant expression system). The purification tag includes a His-tag, a chitin binding protein (Chitin binding protein, CBP), a maltose binding protein (Maltose binding protein, MBP) and a glutathione-S-transferase (Glitathione-S-transferase, GST), but is not limited thereto.

[0029] Effects of the Invention

[0030] The present invention provides a fusion protein vaccine composition, which identifies the immunologically active domain (domain, site or fragment) in the Rv2299c protein and removes unnecessary sites or selects only the required parts to connect with other immunologically active proteins or sites, thereby effectively activating the immune response of tuberculosis patients and making an epoch-making contribution to the prevention or treatment of tuberculosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is the result showing the preparation of Rv2299c domain and the degree of immune cell activation of each domain. Part A is the preparation of Rv2299c domain. Part B is the confirmation of the activation energy of the dendritic cells of the prepared Rv2299c domain. Part C is the schematic diagram of the anti-tuberculosis ability determination method. Part D is the determination of the anti-tuberculosis ability of the Rv2299c domain. Part E shows the T cell activity of the Rv2299c domain measured by ELISA based on the cytokine produced under the conditions of D.

[0032] Figure 2 This is a graph comparing the anti-tuberculosis ability and T cell activity (IFN-γ and IL-2 production ability) of the first screened Rv2299c domains D2 and D3.

[0033] Figure 3 The results of confirming the preparation and anti-tuberculosis ability of D2, D3 and D2+D3 fusion domains of Rv2299c. Part A is the purification of Rv2299c domains and fusion domains. Part B is a graph showing the number of Mycobacterium tuberculosis measured by co-culturing dendritic cells with T cells for 72 hours after activation with their respective stimuli for 24 hours and then co-culturing them with macrophages infected with Mycobacterium tuberculosis for 72 hours.

[0034] Figure 4 It is the result of evaluating anti-tuberculosis ability by RpfE domain preparation and T cell activity. Part A and B are the preparation of RpfE domain. Part C is a chart of using ELISA to analyze the activity of dendritic cells after dendritic cells are activated by respective stimulus sources for 24 hours. Part D is a chart of co-culturing dendritic cells with T cells for 72 hours after dendritic cells are activated by respective stimulus sources for 24 hours, and then co-culturing T cells activated for 72 hours in macrophages infected with Mycobacterium tuberculosis to measure the number of Mycobacterium tuberculosis. Part E measures the cytokines produced in T cells under the conditions of D.

[0035] Figure 5 This is a graph evaluating the degree of T cell differentiation based on the RpfE, D1, and D2 domains. After dendritic cells were activated by their respective stimuli for 24 hours, spleens were obtained from mice infected with BCG or Mtb H37Ra and co-cultured with isolated T cells for 72 hours. The production of IFN-γ, IL-17, and IL-2 by T cells was then measured using ELISA.

[0036] Figure 6 The effects of Rv2882c and the D1 and D2 domains on the growth of Mtb under co-culture conditions with T cells are shown. Part A shows that the Rv2882c protein consists of an N-terminal part (1 to 100; Rv2882c D1) and a C-terminal part (86 to 185; Rv2882c D2). Each cleaved protein was expressed in enterohemorrhagic Escherichia coli (E. coli), and only Rv2882c D1 was confirmed to be expressed by SDS-PAGE. Part B is the result of BMDM infection (Mtb, MOI: 1) for 4 hours, and treatment with full-length Rv2882c and Rv2882c D1 for 24 hours, and then spleen cells were co-cultured at a ratio of 1:5 to 10 for 72 hours, and then the growth of Mtb in the cells was confirmed.

[0037] Figure 7The effects of Rv2005c, D1, and D3 domains on Mtb growth are shown. Part A shows that the Rv2005c protein is composed of D1 (1-105), D2 (91-198), and D3 (197-294) parts, respectively. Each cut protein was expressed in enterohemorrhagic Escherichia coli (E. coli), and it was confirmed that only Rv2005c D1 and D3 were expressed. Part B shows that after BMDM was infected (Mtb, MOI: 1) for 4 hours, and full-length Rv2005c and Rv2005c D1 and D3 were cultured for 24 hours, spleen cells were co-cultured at a ratio of 1:5-10 for 72 hours, and then the growth of Mtb in the cells was confirmed.

[0038] Figure 8 It is the domain in the N-terminal region of Rv3463 that regulates the growth of Mtb. Part A is the separation of the Rv3463 protein into the N-terminal part (1-138; Rv3463 D1) and the C-terminal part (139-285; Rv3463 D2). Each cut protein was expressed in enterohemorrhagic Escherichia coli (E.coli), and it was confirmed that only Rv3463 D2 was expressed, and the Rv3463 D2 part that was confirmed to be expressed was purified and analyzed by SDS-PAGE. Part B shows that BMDM was infected (Mtb, MOI:1) for 4 hours, and full-length Rv3463c and Rv3463 D2 were cultured for 72 hours. Intracellular Mtb growth was confirmed after 72 hours.

[0039] Fig. 9 It is a schematic diagram of the composition of ESAT6 and various domain fusion proteins (Part A) and purification photos of various fusion proteins (Part B).

[0040] Fig.10 The results are the results of measuring the LPS contamination of the purified fusion protein. Dendritic cells were pretreated with PMB, an LPS inhibitor, and then activated with the respective stimuli for 24 hours, and then the activity of dendritic cells (TNF-α and IL-1β) was analyzed by ELISA.

[0041] Fig.11The results of the evaluation of the anti-tuberculosis ability and T cell activity of the purified fusion protein. Part A is to activate dendritic cells with their respective stimuli for 24 hours, co-culture them with T cells for 72 hours, and then co-culture the activated T cells with macrophages infected with Mycobacterium tuberculosis for 72 hours, and then measure the number of Mycobacterium tuberculosis. Part B is to activate dendritic cells with their respective stimuli for 24 hours, co-culture them with T cells for 72 hours, and then use ELISA to analyze the activity of T cells (IL-2, IL-17 and INF-γ).

[0042] Fig.12 The results are the results of evaluating the dendritic cell activity of the purified fusion protein. Dendritic cells were activated by respective stimuli for 24 hours, and then the activity of dendritic cells (IL-1β, TNF-α, IL-12, and IL-23) was analyzed by ELISA.

[0043] Fig.13 The results of evaluating the proliferation capacity of non-sensitized T cells of dendritic cells activated by fusion proteins. Part A is a schematic diagram of the method for evaluating the proliferation capacity of non-sensitized T cells. Part B is the analysis of the activity of T cells (INF-γ, IL-17, IL-2 and TNF-α) by FACS after the dendritic cells were treated with the prepared fusion protein and ovalbumin (OVA) peptide for 24 hours and the OVA peptide-specific T cells were pretreated with CFSE and then co-cultured with the activated dendritic cells for 24 hours. Part C is the analysis of the activity of T cells (INF-γ, IL-17, IL-2 and TNF-α).

[0044] Fig.14 The results of the evaluation of the anti-tuberculosis ability of T cells activated by fusion proteins. Part A is to activate dendritic cells by their respective stimuli for 24 hours, co-culture them with T cells for 72 hours, and then co-culture the activated T cells with macrophages infected with Mycobacterium tuberculosis for 72 hours, and then measure the number of Mycobacterium tuberculosis. Part B is to activate dendritic cells by their respective stimuli for 24 hours, co-culture them with T cells for 72 hours, and then use ELISA to analyze the activity of T cells (INF-γ, IL-17 and IL-2).

[0045] Fig.15 The results of the evaluation of the efficacy of the tuberculosis vaccine using a combination of Rv2299c-ESAT6 and BCG-CWS of non-pathogenic Mycobacterium tuberculosis in mice. Part A is a schematic diagram of the vaccine preventive effect evaluation experiment. Part B is the bacterial load in the lungs of each group 6 or 18 weeks after tuberculosis infection.

[0046] Fig.16The results of the evaluation of the efficacy of the Rv2299cD2D3-BCG-CWS combined tuberculosis vaccine in mice using pathogenic Mycobacterium tuberculosis. Part A is a schematic diagram of the vaccine preventive effect evaluation experiment. Part B is the bacterial load in the lungs of each group after 6 weeks or 28 weeks of pathogenic tuberculosis infection. Part C is the pathological lesions of the lung nodules in each group after 28 weeks of tuberculosis infection.

[0047] Fig.17 The results are analysis results of antigen-specific cytokines of the fusion protein of the present invention in the lungs of mice 6 weeks after infection with pathogenic Mycobacterium tuberculosis.

[0048] Fig.18 The results are analysis results of antigen-specific cytokines of the fusion protein of the present invention in the spleen of mice 6 weeks after infection with pathogenic Mycobacterium tuberculosis.

[0049] Fig.19 The results of the evaluation of the therapeutic vaccine efficacy of Rv2299c-ESAT6 using the latent infection model. Part A is the efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. Part B is the bacterial load in the lungs of each group according to the evaluation schedule after tuberculosis infection.

[0050] Fig. 20 The results of the evaluation of the therapeutic vaccine efficacy of Rv2299c-ESAT6-Rv3463 using the latent infection model. Part A is the efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. Parts B and C are the bacterial loads in the lungs of each group based on repeated evaluations after tuberculosis infection.

[0051] Fig.21 It is the evaluation result of therapeutic vaccine efficacy of Rv2299cD2D3-ESAT6 backbone structure vaccine candidate group. Part A is Rv2299cD2D3-ESAT6 backbone structure vaccine candidate group. Part B is the efficacy evaluation strategy schedule using MtbH37Ra latent infection model. Part C is the bacterial load in the lungs of each candidate group after 20 weeks of tuberculosis infection.

[0052] Fig. 22 It is the evaluation result of the therapeutic vaccine efficacy of the Rv2299cD2D3-ESAT6-Rv3463 main chain (backbone) structure vaccine candidate group. Part A is the Rv2299cD2D3-ESAT6-Rv3463 main chain (backbone) structure vaccine candidate group. Part B is the efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. Part C is the bacterial load in the lungs of each candidate group after 20 weeks of tuberculosis infection.

[0053] Fig.23 The results of the evaluation of the therapeutic vaccine efficacy of the new antigen and ESAT6 combined backbone fusion protein. Part A is the new antigen and ESAT6 combined backbone structure vaccine candidate group. Part B is the efficacy evaluation strategy schedule using the Mtb H37Ra latent infection model. Part C is the bacterial load in the lungs of each candidate group 20 weeks after tuberculosis infection. DETAILED DESCRIPTION

[0054] The inventor has been conducting research on developing a BCG replacement or BCG booster and therapeutic vaccine based on fusion protein with significant defense effect and very favorable safety. In particular, the inventor's team is committed to developing a vaccine with more excellent defense effect, which overcomes the shortcomings of the tuberculosis vaccine using Rv2299c-ESAT6 proposed in the Korean Patent Authorization No. 1749165 as an existing patent. When the protein with high immunological activity is fused, even if the vaccine efficacy is good, there are still many difficulties in the standardization of the purification method during commercialization. That is, as the molecular weight of the fused protein increases, there is a problem that it is difficult to purify and is prone to denaturation during the purification process. In the process of overcoming these problems, it is confirmed that the smaller the molecular weight of the protein-based vaccine is, the more favorable it is in the standardization of the purification process, and higher efficiency can be achieved by connecting other proteins in a composite manner.

[0055] Thus, when the immunologically active domain (domain, site or fragment) in the Rv2299c protein was identified and unnecessary sites were removed or only the necessary parts were selected to form a fusion protein, it was assumed that a vaccine with more significant effects than existing fusion proteins could be obtained and the present invention was completed during the research.

[0056] Below, the preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein, and may also be specifically implemented in other forms. Instead, it is provided to make the content described herein more comprehensive and complete and to fully convey the idea of ​​the present invention to those skilled in the art.

[0057] <Experimental Materials and Methods>

[0058] 1. Cloning, production and purification of recombinant proteins

[0059] 1.1 Cloning of each protein domain for recombinant protein production

[0060] In order to generate the respective recombinant proteins required for the experiment, genomic DNA from Mycobacterium. Tuberculosis, Mtb) H37Rv (ATCC 27294) was used as a template and the corresponding genes were amplified by PCR using the primers in Table 1 below. The generated PCR products were inserted into the pET-22b (+) vector (Novagen, Madison, Wisconsin (WI), USA) using the inserted restriction enzyme sequences and confirmed by sequence analysis of the generated plasmids.

[0061] Table 1

[0062]

[0063] 1.2 Cloning for fusion protein production (1) pET-22b(+)_Rv2299cD2D3-ESAT6

[0064] The genomic DNA of Mycobacterium tuberculosis (Mtb) H37Rv (ATCC 27294) was used as a template to obtain Rv2299c DNA and ESAT6 DNA by PCR, and an overlapping PCR method was used to prepare an Rv2299c D2D3-ESAT6 DNA fragment with NdeI inserted at the 5' end and HindIII restriction enzyme inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0065] D2D3-ESAT6_NdeI_F:AAGGAGATATACATATGtcgatgaaggcgctgtgg

[0066] D2D3-ESAT6_HindIII_R:GTGCGGCCGCAAGCTTtgcgaacatcccagtgacg

[0067] D2D3-ESAT6_intP:aagaaggtgctgtccacg

[0068] (2) pET-22b(+)_Rv2299cD3-ESAT6

[0069] Using the same method as above, overlapping PCR was used on Rv2299c and ESAT6 DNA to prepare Rv2299c D3-ESAT6 DNA fragment with NdeI inserted at the 5' end and HindIII inserted at the 3' end, and inserted into pET22b vector. The primers used at this time were as follows.

[0070] D3-ESAT6_NdeI_F:AAGGAGATATACATATGctcggtatttcttcgtttgtctc

[0071] D3-ESAT6_HindIII_R:GTGCGGCCGCAAGCTTtgcgaacatcccagtgac

[0072] (3)pET-22b(+)_Rv2299cD2D3-ESAT6-RpfE D1

[0073] Using RpfE DNA and Rv2299c D2D3-ESAT6 DNA obtained in the same manner as above as templates, an overlapping PCR method was used to prepare an Rv2299c D2D3-ESAT6-RpfE D1 DNA fragment with NdeI and XhoI restriction enzymes inserted at the 5' end and 3' end, and the fragment was inserted into the pET22b vector. The primers used at this time were as follows.

[0074] Rv2299c(D2D3)+ESAT6_NdeI_F:

[0075] AAGGAGATATACATATGTCGATGAAGGCGCT

[0076] Rv2299c(D2D3)+ESAT6_R:TGCGAACATCCCAGTGAC

[0077] RpfEdomain1_F: GTCACTGGGATGTTCGCAGCCGACGACGCGGGCTTG

[0078] RpfEdomain1_XhoI_R:

[0079] GGTGGTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC

[0080] (4)pET-22b(+)_Rv2299c-Rv3463-ESAT6

[0081] The Rv2299c, Rv3463 and ESAT6 DNA obtained by the same method as above was used as a template, and the Rv2299c-Rv3463-ESAT6 DNA fragment with NdeI and XhoI restriction enzymes inserted at the 5' end and 3' end was finally prepared by PCR and inserted into the pET22b vector. At this time, the primers used were as follows.

[0082] Rv2299c-Nde-F:CATATGAACGCCCATGTCGAGCAGTTG

[0083] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0084] Rv3463-EcoR-F:GAATTCGATGACCAATTGTGCCGCC

[0085] Rv3463-Hind-R:AAGCTTAGTCAGTCGGAGCGGCTT

[0086] ESAT6-Hind-F:AAGCTTATGACAGAGCAGCATGGAAT

[0087] ESAT6-Xho-R: CTCGAGTGCGAACATCCCAGTGACGTT

[0088] (5)pET-22b(+)_Rv2299c-ESAT6-Rv3463

[0089] The Rv2299c, ESAT6 and Rv3463 DNA obtained by the same method as above was used as a template, and the Rv2299c-ESAT6-Rv3463 DNA fragment with NdeI and NotI restriction enzymes inserted at the 5' end and 3' end was finally prepared by PCR and inserted into the pET22b vector. At this time, the primers used were as follows.

[0090] Rv2299c-Nde-F:CATATGAACGCCCATGTCGAGCAGTTG

[0091] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0092] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0093] ESAT6-Hind-R:AAGCTTTGCGAACATCCCAGTGACGTT

[0094] Rv3463-Hind-F: AAGCTTATGACCAATTGTGCCGCC

[0095] Rv3463-Not-R: GCGGCCGCAGTCAGTCGGAGCGGCTT

[0096] (6)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463

[0097] The Rv2299c D2D3, ESAT6 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare an Rv2299c D2D3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0098] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG

[0099] Rv2299c_D2D3_R: CAAGGTACGCGCGAGACG

[0100] ESAT-6_F:

[0101] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0102] ESAT-6_R:TGCGAACATCCCAGTGAC

[0103] Rv3463_F:

[0104] GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC

[0105] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0106] (7)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv3463

[0107] The Rv2299c D2D3, ESAT6, Rv2005cD3 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare an Rv2299c D2D3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0108] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG

[0109] Rv2299c_D2D3_R: CAAGGTACGCGCGAGACG

[0110] ESAT-6_F:

[0111] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0112] ESAT-6_R:TGCGAACATCCCAGTGAC

[0113] Rv2005c_D3_HindIII_F:

[0114] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0115] Rv2005c_R: CGACTGCCGTGCCACGAT

[0116] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC

[0117] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0118] (8)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2882cD2-Rv2005cD3-Rv3463D2

[0119] The Rv2299c D2D3, ESAT6, Rv2882cD2, Rv2005cD3 and Rv3463 D2 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0120] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG

[0121] Rv2299c_D2D3_R: CAAGGTACGCGCGAGACG

[0122] ESAT-6_F:

[0123] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0124] ESAT-6_R:TGCGAACATCCCAGTGAC

[0125] Rv2882c_D2_HindIII_F:

[0126] GATGTTCGCAAAGCTTATGGACGGCGCCCTTATTC

[0127] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0128] Rv2005c_D3_F:

[0129] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0130] Rv2005c_D3_R1:GCTAGCCGACTGCCGTGCCACGAT

[0131] Rv3463_D2_F1: GCACGGCAGTCGGCTAGCATGGCACTGGGCCCCCG

[0132] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0133] (9)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv1605-Rv3463D2

[0134] The Rv2299c D2D3, ESAT6, Rv1605, Rv2005cD3 and Rv3463D2 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare an Rv2299c D2D3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0135] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG

[0136] Rv2299c_D2D3_R: CAAGGTACGCGCGAGACG

[0137] ESAT-6_F:

[0138] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0139] ESAT-6_R:TGCGAACATCCCAGTGAC

[0140] Rv2005c_D3_HindIII_F:

[0141] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0142] Rv2005c_D3_R2:TCTAGACGACTGCCGTGCCACGAT

[0143] Rv1605_F:GCACGGCAGTCGTCTAGAATGTATGCCGACCGTGAC

[0144] Rv1605_R:GCTAGCTCGCACGGTGATTCCTTC

[0145] Rv3463_D2_F2:ATCACCGTGCGAGCTAGCATGGCACTGGGCCCCCG

[0146] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0147] (10)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2

[0148] Using Rv2299c D2D3, ESAT6, Rv3463D2, Rv2882cD2, RpfED1 and Rv2145cD2 DNA obtained by the same method as above as template, an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0149] Rv2299c D2+D3_NdeI_F:

[0150] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0151] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0152] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0153] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0154] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0155] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0156] Rv2882c_D2_F: CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG

[0157] Rv2882c_D2_XhoI_R:

[0158] GTGGTGGTGGGTGCTCGAGGACCTCCAGCAGCTCGCC

[0159] RpfE_D1_Rv2882D2_F:

[0160] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC

[0161] RpfE_D1_R:GTTGTAGGCCACGGGCAC

[0162] Rv2145c_D2_RpfED1_F:CCCGTGGCCTACAACATGGTCTCGGCGGGGATG

[0163] Rv2145c_D2_XhoI_R:

[0164] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC

[0165] (11)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3

[0166] Using Rv2299c D2D3, ESAT6, Rv3463D2 and Rv2005cD3 DNA obtained by the same method as above as template, the overlapping PCR method was used to finally prepare the Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0167] Rv2299c D2+D3_NdeI_F:

[0168] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0169] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0170] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0171] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0172] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0173] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0174] Rv2005c_D3_F: CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT

[0175] Rv2005c_D3_XhoI_R:

[0176] GGTGGTGGTGGTGCTCGAGCGACTGCCGTGCCACGATCAC

[0177] (12)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1

[0178] The Rv2299c D2D3, ESAT6, Rv3463D2, Rv2005cD3 and RpfED1 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0179] Rv2299c D2+D3_NdeI_F:

[0180] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0181] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0182] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0183] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0184] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0185] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0186] Rv2005c_D3_F: CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT

[0187] Rv2005c_D3_R: CGACTGCCGTGCCACGATCAC

[0188] RpfE_D2_Rv2005cD3_F:

[0189] GTGGCACGGCAGTCGATGGCCGACGACGCGGGCTTGGAC

[0190] RpfE_D1_XhoI_R:GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC

[0191] (13)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2

[0192] The Rv2299cD2D3, ESAT6, and Rv3463D2 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0193] Rv2299c D2+D3_NdeI_F:

[0194] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0195] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0196] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0197] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0198] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0199] Rv3463 D2_NotI_R:

[0200] TGGTGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTTC

[0201] (14)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2

[0202] Using Rv2299cD2D3, ESAT6, Rv3463D2 and Rv2882cD2 DNA obtained by the same method as above as template, an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0203] Rv2299c D2+D3_NdeI_F:

[0204] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0205] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0206] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0207] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0208] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0209] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0210] Rv2882c_D2_F: CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG

[0211] Rv2882c_D2_XhoI_R:

[0212] GTGGTGGTGGGTGCTCGAGGACCTCCAGCAGCTCGCC

[0213] (15)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-Rv2145cD2

[0214] Using Rv2299cD2D3, ESAT6, Rv3463D2, Rv2882cD2 and Rv2145cD2 DNA obtained by the same method as above as template, an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-Rv2145cD2 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0215] Rv2299c D2+D3_NdeI_F:

[0216] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0217] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0218] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0219] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0220] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0221] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0222] Rv2882c_D2_F: CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG

[0223] Rv2882c_D2_R: GACCTCCAGCAGCTCGCC

[0224] Rv2145c_D2_Rv2882cD2_F:

[0225] GAGCTGCTGGAGGTCATGGTCTCGGCGGGGATG

[0226] Rv2145c_D2_XhoI_R:

[0227] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC

[0228] (16)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1

[0229] Using Rv2299cD2D3, ESAT6, Rv3463D2, Rv2882cD2 and RpfED1 DNA obtained by the same method as above as template, an overlapping PCR method was used to finally prepare a Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1 DNA fragment with NdeI inserted at the 5' end and XhoI inserted at the 3' end, and it was inserted into the pET22b vector. At this time, the primers used are as follows.

[0230] Rv2299c D2+D3_NdeI_F:

[0231] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC

[0232] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC

[0233] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT

[0234] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT

[0235] Rv3463 D2_F:ATGGCACTGGGCCCCCGG

[0236] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG

[0237] Rv2882c_D2_F: CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG

[0238] Rv2882c_D2_R: GACCTCCAGCAGCTCGCC

[0239] RpfE_D1_Rv2882D2_F:

[0240] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC

[0241] RpfE_D1_XhoI_R:GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC

[0242] (17)pET-22b(+)_Rv2882c-Rv2005c-Rv3463

[0243] The Rv2882c, ESAT6 and Rv3463 DNA obtained by the same method as above were used as templates, and the overlapping PCR method was used to finally prepare the Rv2882c-Rv2005c-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0244] Rv2882c_NdeI_F:AAGGAGATATACATATGATTGATGAGGCTCTCTTCG

[0245] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0246] Rv2005c_F: GCGAGCTGCTGGAGGTCGAATTCATGTCTAAACCCCGCAAG

[0247] Rv2005c(HindIII)_R:AAGCTTCGACTGCCGTGCCACGAT

[0248] Rv3463(HindIII)_F:GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC

[0249] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0250] (18)pET-22b(+)_Rv2882c-Rv2005cD3-ESAT6-Rv3463

[0251] The Rv2882c, Rv2005cD3, ESAT6 and Rv3463 DNA obtained by the same method as above were used as templates, and the overlapping PCR method was used to finally prepare the Rv2882c-Rv2005cD3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0252] Rv2882c_NdeI_F:AAGGAGATATACATATGATTGATGAGGCTCTCTTCG

[0253] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0254] Rv2005c_D3_F:

[0255] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0256] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0257] ESAT-6_F:

[0258] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0259] ESAT-6_R:TGCGAACATCCCAGTGAC

[0260] Rv3463(HindIII)_F:GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC

[0261] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0262] (19)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0263] The Rv2220, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into a pET22b vector. At this time, the primers used are as follows.

[0264] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC

[0265] Rv2220_R:AACGTCGTAGTACAGCGC

[0266] Rv2882c_D2_F:

[0267] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0268] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0269] Rv2005c_D3_F:

[0270] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0271] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0272] ESAT-6_F:

[0273] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0274] ESAT-6_R:TGCGAACATCCCAGTGAC

[0275] Rv3463_D2_F3:

[0276] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0277] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0278] (20)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0279] Using Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above as template, the overlapping PCR method was used to finally prepare the Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted it into the pET22b vector. At this time, the primers used are as follows.

[0280] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG

[0281] Rv0869c_NheI_R: CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA

[0282] Rv2882c_D2_F:

[0283] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0284] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0285] Rv2005c_D3_F:

[0286] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0287] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0288] ESAT-6_F:

[0289] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0290] ESAT-6_R:TGCGAACATCCCAGTGAC

[0291] Rv3463_D2_F3:

[0292] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0293] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0294] (21)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0295] Using Rv1605, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above as template, the overlapping PCR method was used to finally prepare the Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0296] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC

[0297] Rv1605_NheI_R: CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC

[0298] Rv2882c_D2_F:

[0299] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0300] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0301] Rv2005c_D3_F:

[0302] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0303] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0304] ESAT-6_F:

[0305] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0306] ESAT-6_R:TGCGAACATCCCAGTGAC

[0307] Rv3463_D2_F3:

[0308] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0309] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0310] (22)pET-22b(+)_Rv2220-ESAT6-Rv3463

[0311] The Rv2220, ESAT6 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare an Rv1605-Rv2220-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0312] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC

[0313] Rv2220_EcoRI_R: GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC

[0314] ESAT-6_F:

[0315] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0316] ESAT-6_R:TGCGAACATCCCAGTGAC

[0317] Rv3463_F: GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC

[0318] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0319] (24)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463

[0320] The Rv0869c, ESAT6, Rv2005cD3 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0321] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG

[0322] Rv0869c_EcoRI_R: GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT

[0323] ESAT-6_F:

[0324] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0325] ESAT-6_R:TGCGAACATCCCAGTGAC

[0326] Rv2005c_D3_HindIII_F:

[0327] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0328] Rv2005c_R: CGACTGCCGTGCCACGAT

[0329] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC

[0330] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0331] (25)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463

[0332] Using Rv1605, ESAT6, Rv2005cD3 and Rv3463 obtained by the same method as above as templates, an overlapping PCR method was used to finally prepare a Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0333] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC

[0334] Rv1605_EcoRI_R: GCTCTGTCATGAATTCTCGCACGGTGATTCCTTC

[0335] ESAT-6_F:

[0336] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0337] ESAT-6_R:TGCGAACATCCCAGTGAC

[0338] Rv2005c_D3_HindIII_F:

[0339] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0340] Rv2005c_R: CGACTGCCGTGCCACGAT

[0341] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC

[0342] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0343] (26)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0344] The Rv2220, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into a pET22b vector. At this time, the primers used are as follows.

[0345] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC

[0346] Rv2220_R:AACGTCGTAGTACAGCGC

[0347] Rv2882c_D2_F:

[0348] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0349] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0350] Rv2005c_D3_F:

[0351] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0352] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0353] ESAT-6_F:

[0354] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0355] ESAT-6_R:TGCGAACATCCCAGTGAC

[0356] Rv3463_D2_F3:

[0357] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0358] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0359] (27)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0360] Using Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above as template, the overlapping PCR method was used to finally prepare the Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted it into the pET22b vector. At this time, the primers used are as follows.

[0361] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG

[0362] Rv0869c_NheI_R: CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA

[0363] Rv2882c_D2_F:

[0364] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0365] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0366] Rv2005c_D3_F:

[0367] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0368] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0369] ESAT-6_F:

[0370] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0371] ESAT-6_R:TGCGAACATCCCAGTGAC

[0372] Rv3463_D2_F3:

[0373] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0374] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0375] (28)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2

[0376] Using Rv1605, Rv2882cD2, Rv2005cD3, ESAT6 and Rv3463D2 DNA obtained by the same method as above as template, the overlapping PCR method was used to finally prepare the Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5' end and Not restriction enzyme inserted at the 3' end, and inserted it into the pET22b vector. At this time, the primers used are as follows.

[0377] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC

[0378] Rv1605_NheI_R: CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC

[0379] Rv2882c_D2_F:

[0380] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC

[0381] Rv2882c_D2_R: GACCTCCAGCAGCTCGC

[0382] Rv2005c_D3_F:

[0383] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG

[0384] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT

[0385] ESAT-6_F:

[0386] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0387] ESAT-6_R:TGCGAACATCCCAGTGAC

[0388] Rv3463_D2_F3:

[0389] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG

[0390] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0391] (29)pET-22b(+)_Rv2220-ESAT6-Rv3463

[0392] The Rv2220, ESAT6 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare an Rv1605-Rv2220-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0393] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC

[0394] Rv2220_EcoRI_R: GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC

[0395] ESAT-6_F:

[0396] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0397] ESAT-6_R:TGCGAACATCCCAGTGAC

[0398] Rv3463_F: GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC

[0399] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0400] (30)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463

[0401] The Rv0869c, ESAT6, Rv2005cD3 and Rv3463 DNA obtained by the same method as above was used as a template, and an overlapping PCR method was used to finally prepare a Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0402] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG

[0403] Rv0869c_EcoRI_R: GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT

[0404] ESAT-6_F:

[0405] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0406] ESAT-6_R:TGCGAACATCCCAGTGAC

[0407] Rv2005c_D3_HindIII_F:

[0408] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0409] Rv2005c_R: CGACTGCCGTGCCACGAT

[0410] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC

[0411] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0412] (31)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463

[0413] Using Rv1605, ESAT6, Rv2005cD3 and Rv3463 obtained by the same method as above as templates, an overlapping PCR method was used to finally prepare a Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI inserted at the 3' end, and inserted into the pET22b vector. At this time, the primers used are as follows.

[0414] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC

[0415] Rv1605_EcoRI_R: GCTCTGTCATGAATTCTCGCACGGTGATTCCTTC

[0416] ESAT-6_F:

[0417] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG

[0418] ESAT-6_R:TGCGAACATCCCAGTGAC

[0419] Rv2005c_D3_HindIII_F:

[0420] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG

[0421] Rv2005c_R: CGACTGCCGTGCCACGAT

[0422] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC

[0423] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT

[0424] 1.3 Production of recombinant proteins

[0425] All recombinant plasmids prepared above were transformed into Escherichia coli BL21 cells. The Escherichia coli cells containing the recombinant plasmids were grown in a shaking incubator at 37°C. When the optical density (OD) was reached at a wavelength of 600nm, isopropyl-D-thiogalactoside (IPTG; ELPIS-Biotech, Daejeon, South Korea) was added at a concentration of 1mM. After 4 to 6 hours, bacterial cells were obtained by centrifugation and suspended in 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM imidazole, 6M urea and 1mM phenylmethylsulfonyl fluoride (Sigma). In order to purify a single protein, the same composition was used except urea. After cleavage by ultrasonic treatment, the recombinant protein was purified by Ni-Nitrilotriacetic acid (Ni-NTA) agarose chromatography according to the manufacturer's instructions (Qiagen, Chatsworth, CA, USA). Each purification step was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with Coomassie brilliant blue (CB) staining and western blot (WB) analysis using anti-His antibody (Santa Cruz). The purified protein was concentrated and dialyzed with phosphate buffered saline (PBS, pH 7.4). PBS was used to dialyze the weekly protein. In order to remove endotoxin, the dialyzed protein was cultured with polymyxin B-agarose (PMB, Sigma) at 4°C for 2 hours. Finally, the purified endotoxin-free recombinant protein was filtered and sterilized and frozen at -70°C. The protein concentration was calculated using a polycyanoacrylate n-butyl ester (BicinchoninicAcid, BCA) protein assay kit (Pierce, Rockford, IL) with bovine serum albumin (BSA) as the standard. The purity of all proteins was evaluated by Coomassie Blue (CB) staining and Western Blot (WB) using an anti-histidine antibody.

[0426] 2. Culture of mouse bone marrow-derived dendritic cells (BMDCs)

[0427] Bone marrow derived dendritic cells (BMDC) were cultured in RPMI 1640 medium (Roswell Park Memorial Institute) supplemented with 10% FBS, 1% antibiotics (Welgene), and 0.1% 2-mercaptoethanol at 37°C and 5% CO2. Afterwards, they were induced with 5 mM 4-hydroxyethylpiperazineethanesulfonic acid (HEPES) buffer, 1% MEM solution, 20 ng / ml granulocyte-macrophage colony stimulating factor (GM-CSF) and 2 ng / ml IL-4, and non-adherent cells and loosely adherent proliferating DC aggregates were obtained on day 7 or 8 and used for further experiments.

[0428] 3. Cultivation of mouse bone marrow-derived macrophages (BMDMs)

[0429] BMDM obtained from the femur and pelvis were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), 50 ng / ml macrophage colony stimulating factor (M-CSF) (R&D System, USA) and 1% antibiotics (Welgene, South Korea) in a cell culture incubator under the conditions of 5% CO2 and 37°C.

[0430] 4. Mtb strain preparation

[0431] Mtb H37Rv (Mtb H37Rv, ATCC 27294) and H37Ra (Mtb H37Ra, ATCC 25177) were cultured using 7H9 medium containing 0.5% glycerol, 0.05% Tween-80, 10% oleic acid, albumin, dextrose and catalase.

[0432] 5. Animal Preparation

[0433] 5-6 week-old female C57BL / 6 mice that were not infected with specific pathogens were housed in the biohazard animal laboratory of the College of Medicine, Chungnam National University, South Korea. The housing conditions were 12 hours a day / 12 hours a night, and sterile normal feed was provided. The mice were monitored daily, and no mice showed clinical symptoms or diseases during the experiment.

[0434] 6. Cell infection assay and intracellular Mycobacterium tuberculosis proliferation assay

[0435] BMDM were plated at 1 × 10 per well. 5 The cells were plated and cultured, and then infected with Mtb H37Rv (MOI = 1) for 4 hours. Next, in order to remove the uninfected Mycobacterium tuberculosis remaining outside the BMDM, amikacin was added as an antibacterial agent to 200 μg / ml and treated for 2 hours, and then washed with PBS. Specific antigens were added and cultured for 3 or 5 days, and the number of intracellular Mycobacterium tuberculosis was determined.

[0436] Alternatively, BMDCs stimulated with each antigen were cultured with spleen cells or T cells isolated from spleen cells at a ratio of 1:10 for 3 days, and the activated lymphocytes were cocultured with M. tuberculosis -infected BMDMs for 3 or 5 days, and the number of intracellular M. tuberculosis was measured.

[0437] The intracellular bacterial count was determined by collecting BMDMs and treating them in distilled water for 30 minutes to lyse the cells and obtain lysates. The obtained lysates were serially diluted and then smeared on 7H10 solid medium and cultured at 37°C. After culture, the colony forming units (CFU) generated in the solid medium were analyzed.

[0438] 7. In vitro T-cell proliferation analysis

[0439] Responder T cells involved in the initial T cell response were isolated from total mononuclear cells extracted from BALB / c mice using MACS columns (Miltenyi Biotec). OVA-specific CD4 + T cells were obtained from spleen cells of OT-2 mice. These T cells were stained with 1 μM CFSE (Invitrogen). DCs (2×10 per well) treated with OVA peptide for 24 hours were cultured in the presence of 10 μg / ml tuberculosis antigen. 5 cells) and CFSE-stained CD4 + T cells (2×10 6 ) were co-cultured with DC:T cells at a ratio of 1:10. On the 3rd or 4th day of co-culture, each T cell was configured with PerCP-Cy5.5-conjugated anti-CD4 + Monoclonal Ab staining and analysis by flow cytometry were performed, and supernatants were obtained and analyzed by ELISA for levels of IFN-γ, IL-2, and IL-4.

[0440] 8. Enzyme-linked immunosorbent assay (ELISA)

[0441] Cytokines produced after stimulating BMDMs or BMDCs with antigens and produced under various conditions were detected in the culture medium using a sandwich ELISA method for TNF-α, IL-1β, IFN-γ, IL-2, IL-4, and IL-12p70. Cytokine analysis was performed in the culture medium according to the recommendations of the manufacturers (eBioscience and BD Biosciences). The level of cytokines released into the culture medium was determined by measuring the absorbance at a wavelength of 450nm using an ELISA reader. The concentration of cytokines was calculated using a standard curve of recombinant cytokines, and the results were presented in a pictogram per milliliter.

[0442] 9. Preparation of BCG-Cell Wall Skeleton (BCG-CWS) and its covalent bond with proteins

[0443] BCG-CWS was prepared by killing the cultured BCG strain by high pressure steam sterilization according to the method of Paik et al. (PMID; 20937311). The final prepared CWS was suspended in 2-propanol (2-propanol) (100%) and stored in a freezer. Covalent bonding with proteins was performed according to the method of Baik et al. (PLOS One, 2019, PMID 30849108). CWS was suspended in coupling buffer (20 mM EDC and 50 mM NHS / 100% 2-propanol; N-hydroxysulfosulfonimide (NHS), 1-ethyl-3-(3-dimethlyaminopropyl)carbodiimidehydrochloride (EDC)) and a certain amount of protein was added, and it was mixed and reacted in a refrigerator overnight. Unbound proteins were washed three times with suspension buffer (0.02% Tween 80 and 1% ethanol / PBS) to remove them, and the final product was suspended with suspension buffer to determine the protein concentration and used as a vaccine antigen.

[0444] 10. Mixing of protein and DDA / MPL

[0445] The mixture of protein, dimethyl dioctadecylammonium bromide (DDA) and monophosphoryl lipid A (MPL) was prepared according to the method of Andersen et al. (PMID; 10639447). After mixing 5 μg of protein, 250 μg of DDA and 25 μg of MPL, 0.2% triethylamine was added to make the final volume reach 200 μl. Next, the mixture was heated in a 70°C water tank for 30 seconds and then ultrasonically treated for 30 seconds. This process was repeated 2 to 3 times. The mixture of protein, DDA and MPL was mixed just before use.

[0446] 11. Vaccine Experiments

[0447] In the preventive vaccine experiment, the vaccine composition to be tested was first administered subcutaneously three times. After 4 or 6 weeks, the mice were challenged with Mtb (H37Ra or H37Rv), and the number of bacteria in the trachea of ​​the mice was measured after a certain period of time.

[0448] For the therapeutic vaccine experiment, mice were first anesthetized with 1.2% 2,2,2-tribromoethanol (Avertin), and after exposing the trachea through a small midline incision, 50 μl of Mtb contained in saline was inoculated into the trachea (Intratracheal, IT). After infection for 3 weeks through "short-term" chemotherapy, isoniazid (INH, 0.1 g / L) and rifampicin (RIF, 0.1 g / L) were administered, and drinking water was provided ad libitum for 4 weeks. After the start of treatment, the vaccine composition was immunized 3 times at a certain interval, and the number of bacteria in the lungs was measured after a certain period of time. Determination of bacterial counts in the lungs Mice were euthanized with CO2, and the lungs were removed and homogenized. The lung homogenate was serially diluted and plated in Middlebrook 7H10 agar (Difco Laboratories, Detroit, MI) supplemented with 10% OADC (Difco Laboratories), amphotericin B (Sigma-Aldrich, St. Louis) and 2 μg / ml 2-thiophenecarboxylic acid hydrazide (Sigma-Aldrich). After culturing for 4 weeks at 37°C, the colonies were counted and determined. CFU data and evaluation of lung inflammation were performed using log 10 CFU±interquartile range (IQR) was used.

[0449] 12. Statistical Analysis

[0450] All experiments were repeated more than 3 times. The significance level of comparison between samples was determined using Tukey's multiple comparison test distribution of statistical software (GraphPadPrism Software, Version 4.03; GraphPad Software, San Diego CA). The data of the graphs are expressed as mean ± SEM, and the difference from each value is *p<0.05, **p<0.01 or ***p<0.001, which is considered to be statistically significant.

[0451] <Example 1. Identification of active sites by immunoassay of each domain (site) of Mtb antigen>

[0452] In order to construct an efficient tuberculosis vaccine, it is advantageous to fuse several proteins with high immunological activity. However, when multiple proteins are fused, the molecular weight increases, making it difficult to purify and prone to denaturation during the purification process. For vaccines with large molecular weight, even if they have good efficacy, there are still many difficulties in standardizing the purification method during commercialization. In fact, due to the difficulty in producing recombinant proteins, the vaccine development period is long and the possibility of failure is high. In order to produce an efficient vaccine, it is necessary to develop a vaccine with high vaccine efficacy and small molecular weight.

[0453] The present inventors reported that a protein fused to a dendritic cell activation protein, namely Rv2299c (molecular weight 72 kDa) and a T cell activation protein, namely ESAT6 (molecular weight 10 kDa), exhibited a tuberculosis vaccine with very high BCG boosting efficacy (Ref, Oncotarget. PMID: 28193909). However, since the molecular weight of the Rv2299c-ESAT6 fusion protein is basically about 80 kDa, the possibility of reducing the molecular weight while maintaining the same defense effect and fusing it by adding a new immunoactive protein thereto was investigated. Thus, the present inventors conducted research to identify sites with high immunoactive activity in the proteins developed by the present inventors so far, and to develop a vaccine consisting of these active sites.

[0454] 1.1. Identification of active sites by immunoassay of each domain (site) of the Rv2299c protein

[0455] First, in order to identify the active domain of the Rv2299c protein as a dendritic cell active protein, such as Figure 1 As shown in part A of the present invention, the recombinant proteins were expressed in E. coli and purified. The results of treating each domain in bone marrow-derived dendritic cells (BMDCs) of C57BL / 6 mice are shown in FIG. Figure 1As shown in part B of FIG, D2 and D3 sites induced IL-1β and IL-12 production, but D1 site did not produce IL-1β or IL-12. Figure 1 As shown in Part C of the present invention, BMDC activated with each protein and naive T cells isolated from the spleen of C57BL / 6 were co-cultured for 3 days and added to bone marrow-derived macrophages (BMDMs) infected with Mycobacterium tuberculosis. After 3 or 5 days, the colony forming unit (CFU) of the proliferation degree of Mycobacterium tuberculosis in BMDMs was determined and shown in Figure 1 In Part D of Figure 1 As shown in the D part of FIG, T cells activated by BMDCs stimulated with the entire Rv2299c protein, D2, and D3 regions significantly inhibited intracellular bacterial proliferation, but the D1 site failed to inhibit intracellular bacterial proliferation. Figure 1 As shown in Part E, the production of IFN-γ and IL-17 at this time is proportional to the degree of inhibition of bacterial proliferation.

[0456] Based on the above results, the anti-tuberculosis activity of the D2 and D3 sites of the Rv2299c protein, which was confirmed to have excellent Mtb bacterial growth inhibitory activity, was re-measured and the results are shown in Figure 2 In. Figure 2 As shown, T cells activated by BMDCs stimulated with the D3 site showed a significantly higher degree of inhibition of intracellular M. tuberculosis proliferation compared to D2, while inducing high IFN-γ production. On the other hand, the D2 site showed a specific and significant increase in IL-2 production.

[0457] Based on the results, Figure 3 As shown in Part A of the present invention, after preparing recombinant proteins fused with the D2 and D3 sites of Rv2299c, T cells activated by BMDCs stimulated with each protein were added to BMDMs infected with Mycobacterium tuberculosis and cultured for 3 days. Figure 3 As shown in Part B of the Figure 2, the entire Rv2299c protein, the D3 site, and the D2+D3 site exhibited high anti-tuberculosis activity. This result indicates that the same vaccine efficacy can be induced when D2+D3 in addition to the D1 part or only the D3 domain is used instead of the entire Rv2299c protein.

[0458] The entire Rv2299c protein and the amino acid sequences of D1, D2, D3, D2+D3 and ESAT6 are shown in Table 2 below.

[0459] Table 2

[0460]

[0461]

[0462] 1.2. Identification of the immunologically active domain of RpfE protein

[0463] like Figure 4 As shown in part A of FIG. 1 , the RpfE protein, which is a dendritic cell activation protein, is divided into D1 and D2 sites. Figure 4 As shown in Part B of FIG. 1 , the recombinant proteins of each domain were produced in E. coli and purified. The cytokines produced by BMDCs stimulated by each domain were measured and shown in FIG. Figure 4 The results showed that when stimulated with the D1 and D2 domains of the RpfE protein, IL-1β and IL-12 were similar, but when stimulated with the D2 site, the concentration of IL-23 was very low. Next, the anti-tuberculosis activity of T cells stimulated by BMDC activated with purified domains was determined and shown in Figure 4 In Part D of Figure 4 As shown in the D part of FIG, the whole RpfE protein and the D1 site of RpfE exhibited similar anti-tuberculosis activity. The concentrations of cytokines IFN-γ, IL-2, and IL-17 produced at this time were measured and shown in FIG. Figure 4 Part E of Figure 4 As shown in the E part of Figure 1, RpfE, D1 and D2 domains all showed similar effects, but IL-17 production was significantly lower in the D2 domain. In addition, the results of measuring the cytokine production by co-culturing BMDCs matured by each domain with T cells (isolated from spleen cells isolated from mice infected with BCG or Mtb H37Ra strain) showed that, as Figure 5 As shown, there was no major difference in IFN-γ production, but IL-2 and IL-17 production was very low when treated with the D2 domain. The above results indicate that sufficient vaccine efficacy can be induced using only the D1 site of RpfE.

[0464] The amino acid sequences of the entire RpfE protein, D1 and D2 are shown in Table 3 below.

[0465] Table 3

[0466]

[0467] 1.3. Identification of the immunologically active domain of the Rv2882c protein

[0468] like Figure 6 As shown in Part A of FIG, the Rv2882c protein, which is a macrophage active protein, was also divided into the D1 site and the D2 site and cloned into an expression vector, and then the recombinant protein was produced in E. coli. However, in this process, the D2 site was not expressed ( Figure 6 When BMDMs infected with M. tuberculosis were stimulated with the whole Rv2882c protein and the D1 site, Figure 6 As shown in Part B of the Figure 2, there was no significant inhibitory effect on intracellular bacterial proliferation. When mouse spleen cells were added thereto, the proliferation of Mycobacterium tuberculosis in BMDMs stimulated with the entire Rv2882c protein was maximally inhibited, but when spleen cells were added after stimulation with the D1 site, the proliferation of Mycobacterium tuberculosis in BMDMs was no different from that without any treatment. This suggests that the D2 domain of the Rv2882c protein is a site with anti-tuberculosis efficacy.

[0469] The amino acid sequences of the entire protein of Rv2882c, D1 and D2 are shown in Table 4 below.

[0470] Table 4

[0471]

[0472]

[0473] 1.4. Identification of the immunologically active domain of the Rv2145c protein

[0474] The inventors have reported that, with respect to the Rv2145c macrophage active protein, rather than having an anti-tuberculosis active effect, it is a protein that increases the proliferation of Mycobacterium tuberculosis by inducing IL-10 production (Ref, Front Microbiol, PMID: 34017340). In addition, the results of measuring the anti-tuberculosis active region of Rv2145c confirmed that the D2 (from amino acid position 91 to position 260) portion as the C-terminal portion is a domain that exhibits activity. In order to analyze the vaccine efficacy by adding a domain related to pathogenicity in addition to the immune active site in the tuberculosis vaccine composition, the Rv2145c protein was selected.

[0475] The amino acid sequences of the entire Rv2145c protein, D1 and D2 are shown in Table 5 below.

[0476] Table 5

[0477]

[0478]

[0479] 1.5. Identification of the immunologically active domain of the Rv2005c protein

[0480] Rv2005C protein is a protein associated with reactivation induction of Mycobacterium tuberculosis, which is a protein that activates BMDC (Ref. Vaccine 2020, PMID: 32664238). In order to identify the active site of Rv2005c, such as Figure 7 As shown in Part A of the , it was divided into three domains and recombinant proteins were produced, but the D2 site was not expressed and therefore could not be produced. The whole Rv2005c protein, D1 region, and D3 region were used to stimulate BMDMs infected with Mycobacterium tuberculosis or add mouse spleen cells to them, and the results of measuring the inhibitory effect of intracellular bacterial proliferation after 72 hours showed that the D3 domain showed the highest anti-tuberculosis activity ( Figure 7 Part B of the

[0481] The amino acid sequences of the entire protein of Rv2005C, D1 and D2 are shown in Table 6 below.

[0482] Table 6

[0483]

[0484] 1.6. Identification of the immunologically active domain of Rv3463 protein

[0485] The Rv3463 protein, which is a macrophage active protein, was also divided into the D1 site and the D2 site and cloned into the expression vector. The recombinant protein was produced in E. coli, but the D1 site was not expressed ( Figure 8 After BMDMs infected with M. tuberculosis were stimulated with the whole protein and D2 site of Rv3463, the proliferation of intracellular M. tuberculosis was measured 72 hours later. Both the whole protein and the D2 site of Rv3463 inhibited the proliferation of intracellular bacteria ( Figure 8 In this case, without the addition of T cells, bacterial proliferation was inhibited only by protein treatment. The above results indicate that the D2 domain of Rv3463 alone is sufficient to achieve anti-tuberculosis activity.

[0486] The amino acid sequences of the entire Rv3463 protein, D1 and D2 are shown in Table 7 below.

[0487] Table 7

[0488]

[0489] In addition, Table 8 shows the amino acid sequences of Mycobacterium tuberculosis-derived antigens used in the present invention.

[0490] Table 8

[0491]

[0492]

[0493] <Example 2. In vitro immune activity of Rv2299c protein domain, ESAT6 and RpfE active domain fusion protein>

[0494] Based on the results of Example 1, the immunological activity of the fusion protein of each domain or fusion domain of Rv2299c and ESAT6 was investigated.

[0495] like Fig. 9 As shown, in order to produce Rv2299cD2D3-ESAT6 (ESAT6 is fused to D2 and D3 in addition to D1 of Rv2299c) and Rv2299cD2D3-ESAT6-RpfE1D1 (Rv2299cD3-ESAT6 is fused to the active region D1 of RpfE1), the corresponding genes were cloned into expression vectors, respectively, and the corresponding plasmids were transformed into Escherichia coli to produce and purify the recombinant proteins.

[0496] In the present invention, Rv2299cD2D3-ESAT6 fusion protein refers to a polypeptide consisting of an amino acid sequence in which the amino acid sequences of SEQ ID NO.5 and SEQ ID NO.6 are sequentially connected and fused, and refers to a polypeptide in which one end of Rv2299cD2D3 is connected to the other end of ESAT6. The production of Rv2299cD2D3-ESAT6 fusion protein is produced by using the recombinant protein production method of pET-22b(+)_Rv2299cD2D3-ESAT6 of Example 1.2.

[0497] Hereinafter, in the present invention, a fusion protein comprising two or more Mycobacterium tuberculosis derived antigens or immunologically active sites thereof refers to a polypeptide consisting of amino acid sequences in which the amino acid sequences of the corresponding Mycobacterium tuberculosis derived antigens or immunologically active sites thereof are sequentially linked and fused.

[0498] Since the recombinant protein was purified in E. coli, it was confirmed whether LPS, which is a component of E. coli, was contaminated with protein. First, it was confirmed that there was no contamination, which is shown in FIG. Fig.10 In. Fig.10 As shown, even when treated with 100 ng / ml of LPS, the concentrations of TNF-α and IL-1β were not significantly different from those of the control group, and increases in the concentrations of TNF-α and IL-1β were confirmed by treatment with Rv2299cD3-ESAT6 (D3-E6), Rv2299cD2D3-ESAT6 (D2D3-E6), and Rv2299cD2D3-ESAT6-RpfE1D1 (D2D3-E6-RpfED1), thus confirming that there was no contamination with LPS.

[0499] Thus, the results of measuring the anti-tuberculosis activity of the three fusion proteins Rv2299c-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6 are shown in Fig.11 First, T cells activated by BMDCs matured with each protein were added to BMDMs infected with Mycobacterium tuberculosis and co-cultured for 72 hours, and the number of Mycobacterium tuberculosis was measured. The results are shown in Fig.11 In Part A of Fig.11 As shown in Part A of FIG. 1 , the three fusion proteins Rv2299c-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6 all showed similar anti-tuberculosis activity. In addition, the IL-2, IL-17 and IFN-γ produced at this time were measured and shown in FIG. Fig.11 In Part B of Fig.11 As shown in Part B of , IL-2 and IL-17 were similarly increased by the three fusion proteins of Rv2299c-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6, and as for IFN-γ, its production was increased the most by Rv2299c-ESAT6. Although Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6 were less than Rv2299c-ESAT6, it was confirmed that the production of IFN-γ was effectively increased.

[0500] Next, the anti-tuberculosis activity of the protein in which the D1 active site of the RpfE protein associated with the induction of reactivation of Mycobacterium tuberculosis was fused to Rv2299cD2D3-ESAT6 was determined. Dendritic cells were stimulated with three fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1, for 24 hours, and the production of IL-1β, TNF-α, IL-12 and IL-23 by mouse dendritic cells (BMDCs) was determined using ELIZA, and the results are shown in Fig.12 In. Fig.12 As shown, all three fusion proteins significantly induced the production of IL-1β, TNF-α and IL-12, and the IL-23 production was induced to the highest extent in the Rv2299cD2D3-ESAT6-RpfED1-treated group.

[0501] In addition, if Fig.13 As shown in Part A of the Figure, T cell activation responses based on BMDCs matured by each fusion protein were determined by using ovalbumin (OVA) peptide-specific transgenic T cells. Fig.13Part B shows the results of 24-hour co-culture with dendritic cells activated by pretreatment with 5,6-carboxyfluoresceindiacetate succinimidyl ester (CFSE) in OVA peptide-specific T cells after treatment with each fusion protein of Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1 and OVA peptide in dendritic cells, and then analyzed by flow cytometry (Fluorescence-activated cell sorting, FACS). Fig.13 As shown in Part B of FIG. 3 , BMDCs matured by the four fusion proteins Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 induced T cell proliferation and Th1 response. In addition, the cytokines produced at this time were measured and shown in FIG. Fig.13 Part C. Fig.13 As shown in part C, all four proteins promoted the production of IFN-γ, IL-17, IL-2 and TNF-α. In particular, the treatment with Rv2299cD2D3-ESAT6-RpfED1 showed a trend of increasing the production of IFN-γ, IL-17 and TNF-α to a greater extent.

[0502] In order to confirm the inhibitory effect of Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1 on intracellular bacterial proliferation, T cells activated by BMDCs matured by the four fusion proteins were added to BMDMs infected with Mycobacterium tuberculosis. Fig.14 As shown in Part A of FIG, the inhibitory effect on the proliferation of Mycobacterium tuberculosis was confirmed in all four proteins, and among them, Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1 proteins showed the most significant inhibitory effect on the proliferation of intracellular bacteria. In particular, for the Rv2299cD2D3-ESAT6-RpfED1 protein, it was confirmed that most Mycobacterium tuberculosis was removed from BMDMs infected with Mycobacterium tuberculosis. The concentration of cytokines generated at this time was confirmed and shown in FIG. Fig.14 Part B. Fig.14As shown in Part B, the production of IFN-γ, IL-17 and IL-2 cytokines increased in all four fusion protein treatment groups. In particular, the production of IFN-γ, IL-17 and IL-2 cytokines was the highest for the Rv2299cD2D3-ESAT6-RpfED1 protein, which is consistent with the results of Mycobacterium tuberculosis removal ability.

[0503] <Example 3. Evaluation of vaccine efficacy of Rv2299c protein domain, ESAT6, RpfE and BCG cell wall skeleton (BCG-CWS) combined antigen>

[0504] It is reported that BCG cell wall skeleton (BCG-CWS) is a delivery body that can induce Th1 response in experiments using OVA (Ref Vaccine, 2010, PMID: 20937311). According to the inventors' previous research, the Mycobacterium tuberculosis protein Ag85B was combined with BCG-CWS to immunize mice, and when challenged with Mycobacterium tuberculosis, it showed a defense effect similar to BCG at week 6, and maintained a sustained defense effect at week 32 (3.2log of bacteria were measured in the lungs and spleen), but lost its defense effect at week 32 when only BCG was used (Ref PLOS One, 2019, PMID 30849108). Thus, the efficacy of the tuberculosis vaccine combined with BCG-CWS in the fusion protein confirmed in the embodiment was confirmed.

[0505] 3.1. Vaccine efficacy of Rv2299c-ESAT6 combined with BCG-CWS antigen

[0506] The efficacy of tuberculosis vaccine was evaluated by covalently binding the vaccine in which the above-mentioned immunologically active protein or active domain was fused to BCG-CWS. Rv2299c-ESAT6 (Ref, Oncotarget 2017, PMID: 28193909), which was reported to have a BCG boosting effect, was used. Fig.15Part A shows a schematic diagram of the vaccine's preventive effect evaluation experiment. C57BL / 6 mice were divided into 7 groups (G1: Mycobacterium tuberculosis infection control group (Infection control); G2: antigen control group BCG-CWS (10μg); G3: antigen control group BCG-CWS / dimethyldioctadecyl ammonium (DDA) (10μg / 250μg); G4: Rv2299c-ESAT6-BCG-CWS (7.5μg / 10μg); G5: Rv2299c-ESAT6-BCG-CWS / DDA (7.5μg / 10μg / 250μg); G6: immunopotentiator control group DDA / monophosphoryl lipid A, MPL) (250μg / 25μg); G7: Rv2299c-ESAT6 / DDA / MPL (5μg / 250μg / 25μg), and G2 to G7 groups were subcutaneously immunized three times (8 weeks, 6 weeks, and 4 weeks before inoculation with Mycobacterium tuberculosis). Four weeks after the last immunization, 1×10 6 CFU of H37Ra strain (M. tuberculosis H37Ra), a non-pathogenic strain of Mycobacterium tuberculosis, was inoculated into the airways of all groups. Six and 18 weeks after inoculation with Mycobacterium tuberculosis, the mice were sacrificed and the number of bacteria in the lungs was measured and shown in Fig.15 Part B. Fig.15 As shown in Part B of the Figure, when DDA was mixed in BCG-CWS, the defense efficacy appeared after 18 weeks compared to after 6 weeks. In addition, the Rv2299c-ESAT6 antigen (G5) mixed with DDA / MPL, which is widely used when immunizing animals as a subunit vaccine of a protein antigen, had no vaccine efficacy. The most interesting fact is that, compared with other conditions, Rv2299c-ESAT6-CWS (G4) showed the highest vaccine efficacy after 6 weeks and induced a reaction in which bacteria were completely removed from the lungs after 18 weeks. This confirms that in the field of tuberculosis vaccines, the use of BCG-CWS covalently bound to an antigen shows a superior defense efficacy than the use of the immunopotentiator DDA / MPL, which has been proven to be effective.

[0507] 3.2. Vaccine efficacy of Rv2299c and RpfE fragment domains, ESAT6 fusion protein, and BCG-CWS combined antigen

[0508] Based on the Fig.15 The results, such as Fig.16As shown in Part A, the vaccine efficacy of the combined antigen of BCG-CWS covalently bound to the fragment domain of Rv2299c and RpfE and ESAT6 fusion protein was confirmed under the condition of pathogenic strain H37Rv infection. C57BL / 6 mice were divided into the following 6 groups (G1: Mycobacterium tuberculosis infection control group (Infection control); G2: antigen control group (BCG1×10 5 CFU); G3: antigen control group BCG-CWS (10μgμg); G4: Rv2299c-ESAT6-BCG-CWS (5μg / 10μg); G5: Rv2299cD2D3-ESAT6-BCG-CWS (5μg / 10μg); G6: Rv2299cD2D3-ESAT6-RpfED1-BCG-CWS (5μg / 10μg), and G2 to G6 groups were subcutaneously immunized three times (10 weeks, 8 weeks, and 6 weeks before inoculation with Mycobacterium tuberculosis). Six weeks after the last immunization, 1×10 3 CFU of H37Rv strain (M. tuberculosis H37Rv), which is a pathogenic Mycobacterium tuberculosis strain, was inoculated into the airways of all groups. Six weeks and 28 weeks after inoculation with Mycobacterium tuberculosis, the mice were killed and the number of bacteria in the lungs was measured and shown in Fig.16 Part B. Fig.16 As shown in Part B, 6 weeks after inoculation with Mycobacterium tuberculosis, Rv2299c-ESAT6-CWS (G4), Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6) all significantly inhibited bacterial proliferation in the lungs. In particular, Rv2299cD2D3-ESAT6-RpfED1-CWS most significantly inhibited proliferation, with no bacteria growing in the lungs of 5 out of 6 mice. After 28 weeks, no bacteria grew in the lungs of mice immunized with Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6). In addition, in the gross pathology of the lungs, it was also observed that the number of granulomas in the groups vaccinated with these vaccines was significantly lower ( Fig.16C part). When the D1 part of Rv2299c was removed from Rv2299c-ESAT6, the defensive effect was increased. Live bacteria BCG (G2) had a certain effect at 6 weeks, but had no defensive effect at 28 weeks. It is reported that the defensive effect of BCG usually drops sharply after 10 weeks after immunization. On the contrary, Rv2299c-ESAT6-CWS (G5), Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6) of the present invention induced an almost perfect sterilization reaction. Compared with the subunit vaccines or live bacteria vaccines reported so far, it has a significantly superior vaccine effect.

[0509] Six weeks after inoculation with Mycobacterium tuberculosis, each mouse was sacrificed and lung and spleen cells were isolated. After stimulation with purified protein derivatives (PPD), ESAT6, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 antigens, cytokines in the cell culture medium were measured and are shown in Figure 2. Fig.17 and Fig.18 .like Fig.17 and Fig.18 As shown, in the groups inoculated with the three vaccines with excellent effects of removing Mycobacterium tuberculosis in the lungs, no cytokines including IFN-γ were produced in the lung cells stimulated with antigens, while in the spleen cells, IFN-γ, IL-2 and IL-17 were further increased in the group inoculated with antigens. In particular, in the group immunized with Rv2299cD2D3-ESAT6-RpfED1-CWS (G6), which has the best defense effect, no cytokines other than IFN-γ were produced in the spleen cells. As in the mice in Group 5 (G5) and Group 6 (G6), the immune response returned to normal in the sterilized lungs, so it is believed that the immune response was significantly reduced.

[0510] As far as we know, any vaccine that is a subunit vaccine / immunopotentiator mixed with protein cannot show vaccine efficacy sufficient to replace BCG alone, so protein-based subunit vaccines are developed for use as BCG-prime booster vaccines. Figures 16 to 19 As a result, it was confirmed that surprisingly, the combination of the fusion protein of the present invention and the antigen of CWS can completely eliminate bacteria through three vaccinations, and induces an immune response that is significantly better than BCG. Therefore, since the fusion protein vaccine composition of the present invention induces an immune response that completely eliminates bacteria, it is expected that it can not only replace BCG, but also be very effective as a BCG booster and therapeutic vaccine.

[0511] <Example 4. Evaluation of therapeutic vaccine efficacy of Rv2299c protein domain, ESAT6, RpfE and BCG cell wall skeleton (BCG-CWS) combined antigen>

[0512] Therapeutic vaccines for improving the treatment of tuberculosis are developed for the following purposes: ① inhibiting relapse after chemotherapy, ② increasing the tuberculosis defense effect of cured patients, ③ reducing the treatment cycle after infection or the number of drugs used for treatment, ④ inhibiting the reactivation of latent tuberculosis, etc. Therefore, the therapeutic vaccine efficacy of the fusion protein antigen of the present invention was evaluated.

[0513] 4.1. Evaluation of the therapeutic vaccine potential of Rv2299c-ESAT6 fusion protein

[0514] In order to screen out a therapeutic vaccine consisting of a highly active fusion protein, the present inventors conducted the following Fig.19 The experiment shown in Part A of the present invention uses a latent infection model to preliminarily determine the therapeutic vaccine efficacy of the Rv2299c-ESAT6 fusion protein developed as a vaccine candidate fusion protein. First, Mycobacterium tuberculosis was infected into the trachea of ​​C57BL / 6 mice, and treatment with isoniazid and rifampin (chemotherapy, C) was started 3 weeks after the bacteria proliferated the most in the lungs. The treatment was interrupted after 4 weeks. If the treatment is interrupted, no bacteria will be detected in the lungs at first, but the bacteria will re-proliferate over time. At this time, the vaccine candidate substance mixed with the immune enhancer DDA / MPL (vaccine adjuvant) in the fusion protein was subcutaneously inoculated at the 4th, 7th and 10th weeks after 1 week of treatment, and the inhibitory effect of bacterial re-proliferation was confirmed, which is shown in FIG. Fig.19 Part B. Fig.19 As shown in Part B of the Figure, no bacteria were detected in the lungs of mice in the control group that was only administered with the immunopotentiator (DDA / MPL) at week 7 of infection (the time point when treatment was interrupted), but at week 16 after infection, the number of bacteria was the same as that of the infection control group mice that were only infected without treatment. However, in the group immunized with Rv2299c-ESAT6 / DDA / MPL, no bacteria were detected in the lungs at week 7 of infection, and the number of bacteria in the lungs was significantly less than that of the control group even at week 16 of infection.

[0515] 4.2. Evaluation of vaccine efficacy of Rv2299c-ESAT6-Rv3463 fusion protein

[0516] based on Fig.19The results of Part B of the present study analyzed the vaccine efficacy of Rv2299c-Rv3463 and Rv2299c-Rv3463-ESAT6 fusion proteins. Fig.19 The experiment was carried out in the same way as in Part A. Fig. 20 As shown in Part A of FIG. 12 , the number of bacteria in the lungs was measured at week 12 and week 20 of infection and is shown in FIG. Fig. 20 Part B. Fig. 20 As shown in Part B of FIG, at the 20th week of infection, the re-growth of bacteria was better suppressed in mice immunized with Rv2299c-Rv3463-ESAT6 than in mice immunized with Rv2299c-Rv3463. Next, the vaccine composition order was changed, and fusion proteins were prepared with Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463, and the experiment was performed in the same manner as above, and the results are shown in FIG. Fig. 20 Part C. Fig. 20 As shown in Part C of the experiment, at the 12th week of infection, the re-growth of bacteria in mice immunized with Rv2299c-ESAT6-Rv3463 was completely suppressed, but by the 20th week, there was no difference between the groups vaccinated with Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463 vaccines. However, compared with the control group, it can be confirmed that both groups of vaccines significantly suppressed the re-growth of bacteria. Based on the above results, the fusion proteins of Rv2299c-ESAT6, Rv2299c-ESAT6-Rv3463 and Rv2299c-Rv3463-ESAT6 showed excellent therapeutic vaccine effects. In particular, the Rv2299c-ESAT6-Rv3463 fusion protein showed the best therapeutic vaccine efficacy when evaluated based on the 12th week after infection.

[0517] 4.3. Evaluation of vaccine efficacy of proteins fused with multiple active proteins or domains in the D2D3 region of Rv2299c

[0518] The Rv2299cD2D3-ESAT6 fusion protein, which is obtained by removing the D1 portion of Rv2299c from the Rv2299c-ESAT6 with excellent efficacy in existing vaccines, can fuse multiple active domains due to its reduced molecular weight. Fig.21 As shown in Part A of the present invention, multiple fusion proteins were constructed and cloned and produced as recombinant proteins in E. coli. Fig.21 As shown in Part B of FIG, C57BL / 6 mice infected with Mycobacterium tuberculosis were treated and immunized, and the number of bacteria in the lungs was determined at week 20 of infection and is shown in FIG. Fig.21 Part C. Fig. 20As shown in the figure, since the Rv2299c-ESAT6-Rv3463 fusion protein showed excellent therapeutic vaccine efficacy, mice immunized with Rv2299cD2D3-ESAT6-Rv3463 in which the D1 site of Rv2299c was removed from the fusion protein were used as a benchmark to screen for vaccine candidates with better efficacy. Fig.21 As shown in part C, the results showed that Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 (G7), Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3 (G8) and Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1 (G9) showed very excellent vaccine efficacy.

[0519] In addition, if Fig. 22 As shown in part A of FIG. , Rv2299cD2D3-ESAT6 was used as the backbone to construct additional recombinant proteins, such as Fig. 22 The vaccine efficacy was evaluated in the same manner as above and the results are shown in Fig. 22 In Part C of Fig. 22 As shown in Part C, several fusion proteins showed an inhibition of bacterial proliferation of approximately 0.5 log 10 , and interestingly, the most basic backbone fusion protein Rv2299cD2D3-ESAT6 exhibited the best vaccine efficacy compared to proteins with additional active sites fused to the backbone fusion protein, significantly inhibiting bacterial repopulation.

[0520] 4.4. Vaccine efficacy evaluation of proteins fused with multiple active proteins or domains

[0521] like Fig.23 As shown in part A, multiple proteins are formed and produced to Fig.23 The same method as in Part B was used to analyze the efficacy of therapeutic vaccines and is shown in Fig.23In the C part. At this time, with Rv2299cD2D3-ESAT6-Rv3463 (G11) as the benchmark, a fusion protein with better efficacy was explored. Rv2882c-Rv2005c-Rv3463, Rv2882c-Rv2005cD3-ESAT6-Rv3463, Rv2220-Rv2882cD2-R v2005cD3-ESAT6-Rv3463D2, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv2220-ESAT6-Rv3463, R The results of evaluating the vaccine efficacy of the fusion protein composed of v0869c-ESAT6-Rv2005cD3-Rv3463 and Rv1605-ESAT6-Rv2005cD3-Rv3463 are as follows: Fig.23 As shown in part C, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 (G6) exhibited the best vaccine efficacy.

Claims

1. A tuberculosis vaccine composition, characterized in that: A fusion protein comprising the immunologically active site of Rv2299c and ESAT6.

2. The tuberculosis vaccine composition according to claim 1, characterized in that The fusion protein is a fusion protein of the immunologically active site of Rv2299c consisting of an amino acid sequence selected from the group consisting of SEQ ID NO.1 to SEQ ID NO.5 and ESAT6 consisting of the amino acid sequence of SEQ ID NO.

6.

3. The tuberculosis vaccine composition according to claim 1, characterized in that The fusion protein is a fusion protein of the immune active site of Rv2299c consisting of an amino acid sequence selected from the group consisting of SEQ ID NO.3 to SEQ ID NO.5 and ESAT6 consisting of the amino acid sequence of SEQ ID NO.

6.

4. The tuberculosis vaccine composition according to any one of claims 1 to 3, characterized in that The terminal end of the fusion protein is bound to the BCG cell wall skeleton.

5. The tuberculosis vaccine composition according to any one of claims 1 to 3, characterized in that The tuberculosis vaccine composition is a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

6. The tuberculosis vaccine composition according to claim 4, characterized in that The tuberculosis vaccine composition is a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

7. The tuberculosis vaccine composition according to any one of claims 1 to 3, characterized in that The end of the fusion protein also contains one or more Mycobacterium tuberculosis derived antigens or their immunologically active sites selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220 and Rv0869c.

8. The tuberculosis vaccine composition according to any one of claims 1 to 3, characterized in that The end of the fusion protein also contains any one Mycobacterium tuberculosis derived antigen or its immunologically active site selected from the following groups: RpfED1 composed of the amino acid sequence of SEQ ID NO.8, Rv3463 composed of the amino acid sequence of SEQ ID NO.19, Rv2005cD3-Rv3463 composed of the amino acid sequence of SEQ ID NO.18 and SEQ ID NO.19 connected and fused in sequence, Rv2882cD2-Rv2005cD3-Rv3463D2 composed of the amino acid sequence of SEQ ID NO.12, SEQ ID NO.18 and SEQ ID NO.21 connected and fused in sequence, Rv2005cD3-Rv1605-Rv3463D2 composed of the amino acid sequence of SEQ ID NO.18, SEQ ID NO.22 and SEQ ID NO.21 connected and fused in sequence, NO.12 is connected and fused in sequence, Rv3463D2-Rv2882cD2-Rv2145cD2 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.15 connected and fused in sequence, Rv3463D2-Rv2882cD2-RpfED1 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.8 connected and fused in sequence, Rv3463D2-Rv2882cD2-Rv2145cD2 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12 and SEQ ID NO.8 connected and fused in sequence, Rv3463D2-Rv2882cD2-RpfED1 is composed of an amino acid sequence of SEQ ID NO.21, SEQ ID NO.12, SEQ ID NO.8 and SEQ ID NO.15 connected and fused in sequence, NO.18 is connected and fused in sequence, and Rv3463D2-Rv2005cD3 is composed of an amino acid sequence, and an amino acid sequence, which is connected and fused, is composed of SEQ ID NO.21, SEQ ID NO.18 and SEQ ID NO.

8.

9. The tuberculosis vaccine composition according to claim 7, characterized in that: The terminal end of the fusion protein is bound to the BCG cell wall skeleton.

10. The tuberculosis vaccine composition according to claim 8, characterized in that The terminal end of the fusion protein is bound to the BCG cell wall skeleton.

11. The tuberculosis vaccine composition according to claim 9, characterized in that The tuberculosis vaccine composition is a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

12. The tuberculosis vaccine composition according to claim 10, characterized in that: The tuberculosis vaccine composition is a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

13. A composition for tuberculosis vaccine, characterized in that: The tuberculosis vaccine composition comprises any one fusion protein selected from the following group as a Mycobacterium tuberculosis derived antigen or its immunologically active site, The group is composed of Rv2882c-Rv2005c-Rv3463 consisting of an amino acid sequence in which the amino acid sequences of SEQ ID NO.10, SEQ ID NO.16 and SEQ ID NO.19 are connected and fused in sequence, Rv2882c-Rv2005cD3-ESAT6-Rv3463 consisting of an amino acid sequence in which the amino acid sequences of SEQ ID NO.10, SEQ ID NO.16, SEQ ID NO.6 and SEQ ID NO.19 are connected and fused in sequence, and Rv2882c-Rv2005cD3-ESAT6-Rv3463 consisting of an amino acid sequence in which the amino acid sequences of SEQ ID NO.23, SEQ ID NO.12, SEQ ID NO.15, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 is composed of an amino acid sequence of SEQ ID NO.22, SEQ ID NO.12, SEQ ID NO.18, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 is composed of an amino acid sequence of SEQ ID NO.23, SEQ ID NO.6, SEQ ID NO.19, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; Rv2220-ESAT6-Rv3463 is composed of an amino acid sequence of SEQ ID NO.23, SEQ ID NO.6, SEQ ID NO.19, SEQ ID NO.6 and SEQ ID NO.21 are sequentially connected and fused to each other; NO.24, SEQ ID NO.6, SEQ ID NO.18 and SEQ ID NO.19 connected and fused in sequence, and Rv1605-ESAT6-Rv2005cD3-Rv3463 is composed of an amino acid sequence composed of an amino acid sequence composed of SEQ ID NO.22, SEQ ID NO.6, SEQ ID NO.18 and SEQ ID NO.19 connected and fused in sequence.

14. The tuberculosis vaccine composition according to claim 13, characterized in that The terminal end of the fusion protein is bound to the BCG cell wall skeleton.

15. The tuberculosis vaccine composition according to claim 13 or 14, characterized in that: The tuberculosis vaccine composition is a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine.

Images