Antiviral agent, pharmaceutical composition for treating or preventing viral infection, kit for evaluating risk of severity of viral infection, and method for evaluating risk of severity of viral infection

Abstract

An antiviral agent containing, as an active ingredient, a protein having disulfide bond cleavage activity. Furthermore, a pharmaceutical composition for treating or preventing viral infections, comprising: the viral agent; and a pharmaceutically acceptable carrier. Furthermore, a kit for evaluating the risk of severity of viral infections, which comprises a specific binding substance for a protein having disulfide bond cleavage activity. Furthermore, a method for evaluating the risk of severity of a viral infection, said method comprising a step for measuring the blood concentration of a protein having disulfide bond cleavage activity in a biosample of the test subject.

Description

Technical Field

[0001] The present invention relates to an antiviral agent, a pharmaceutical composition for treating or preventing viral infections, a kit for evaluating the risk of developing severe symptoms of viral infections, and a method for evaluating the risk of developing severe symptoms of viral infections.

[0002] This application claims priority based on Japanese Patent Application No. 2022-108705 filed in Japan on July 5, 2022, the contents of which are cited herein. Background Art

[0003] As seen in the global pandemic of COVID-19, the rapid development of therapeutic drugs for emerging viral infections has become a global issue. Therapeutic drugs for viral infections are usually developed by targeting proteins possessed by the pathogenic virus.

[0004] For example, as a treatment for COVID-19, research and development of antibody drugs and antagonists that inhibit the binding of the SARS-CoV-2 spike receptor binding domain (RBD) to the human angiotensin-converting enzyme II (hACE2) are underway. However, when the RBD mutates, the ability of antibodies and antagonists to recognize the RBD may be reduced, and the infection inhibition effect may be reduced.

[0005] The protein disulfide isomerase (PDI) family is a group of proteins with thioredoxin-like domains that are locally present in the endoplasmic reticulum of cells. There are about 20 PDI family proteins known in mammals. It is reported that a protein disulfide isomerase (PDI) as a kind of PDI family protein has functions such as thiol disulfide oxidoreductase activity, disulfide isomerase activity, redox-dependent chaperone activity (non-patent literature 1). In addition, it is also shown that the PDI family exists outside the cell, i.e. in the brain and blood, and it is reported that, as an extracellular activity, cholera toxin is unfolded (unfolding) by disulfide reductase activity (non-patent literature 2).

[0006] Prior art literature

[0007] Non-patent literature

[0008] Non-licensed article 1: Hyder Ali Khan and Bulent Mutus, Protein disulfideisomerase a multifunctional protein with multiple physiological roles. Front Chem. 2014 Aug 26; 2: 70.

[0009] Non-patented literature 2: B Tsai et al., Protein disulfide isomerase acts as aredox-dependent chaperone to unfold cholera toxin. Cell. 2001 Mar 23; 104(6): 937-48. Summary of the invention

[0010] Problems to be solved by the invention

[0011] Drugs that target viral proteins of pathogenic viruses need to be developed for each pathogenic virus, and cannot respond quickly to newly emerging viral infections. In addition, antiviral activity may be reduced for mutants that have mutated in the target protein. In addition, drugs that inhibit the binding of pathogenic viruses to host cell receptors cannot detoxify pathogenic viruses that remain in the body.

[0012] Therefore, the purpose of the present invention is to provide an antiviral agent that can maintain antiviral activity against mutant strains of the pathogenic virus of viral infection and a pharmaceutical composition for treating or preventing viral infection comprising the antiviral agent. In addition, the purpose of the present invention is to provide a kit for evaluating the risk of severe symptoms of viral infection and a method for evaluating the risk of severe symptoms of viral infection.

[0013] Solutions for solving problems

[0014] The present invention includes the following aspects.

[0015] [1] An antiviral agent comprising: at least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein.

[0016] [2] The antiviral agent according to [1], wherein the protein is a protein disulfide isomerase family protein.

[0017] [3] The antiviral agent according to [2], wherein the protein disulfide isomerase family protein is at least one selected from the group consisting of PDI, ERp46, ERp57, ERp72 and P5.

[0018] [4] The antiviral agent according to [3], wherein the protein disulfide isomerase family protein is at least one selected from the group consisting of PDI and ERp46.

[0019] [5] The antiviral agent according to any one of [1] to [4], which is suitable for a virus having a disulfide bond in at least one protein selected from the group consisting of a spike protein, an envelope protein, and a capsid protein.

[0020] [6] A pharmaceutical composition for treating or preventing a viral infection, comprising: the antiviral agent according to any one of [1] to [5]; and a pharmaceutically acceptable carrier.

[0021] [7] A kit for evaluating the risk of severe viral infection, comprising: a substance that specifically binds to a protein having disulfide bond cleavage activity.

[0022] [8] A method for evaluating the risk of severe symptoms of a viral infection, comprising the step of measuring the concentration of a protein having disulfide bond cleavage activity in a biological sample of a test subject.

[0023] [9] A determination method comprising: a step of determining the concentration of a protein having disulfide bond cleaving activity in a biological sample of a test subject; a step of evaluating the risk of severe illness of a viral infection in the test subject based on the concentration of the protein having disulfide bond cleaving activity; and a step of determining the test subject who is determined to have a higher risk of severe illness as a test subject to be administered an antiviral agent.

[0024] Effects of the Invention

[0025] According to the present invention, an antiviral agent that can maintain antiviral activity against mutant strains of the pathogenic virus of a viral infection and a pharmaceutical composition for treating or preventing a viral infection comprising the antiviral agent are provided. In addition, a kit for evaluating the risk of severe symptoms of a viral infection and a method for evaluating the risk of severe symptoms of a viral infection are also provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The three-dimensional structure of PDI is shown. The active sites that are responsible for antiviral activity are indicated as redox-active sites in the figure.

[0027] Figure 2 The domain structure of PDI family proteins is shown. "CGHC" indicates the CGHC motif within the domain.

[0028] Figure 3 The results of evaluating the disulfide bond cleavage activity of PDI family proteins using the RBD of SARS-CoV-2 are shown.

[0029] Figure 4Results of evaluating the antiviral activity of PDI family proteins against SARS-CoV-2 are shown.

[0030] Figure 5 Shown are the results of evaluating the cytotoxicity of PDI on human cells.

[0031] Figure 6 The results of evaluating the disulfide bond cleavage activity of PDI using the RBD of the SARS-CoV-2 Delta strain are shown.

[0032] Figure 7 The results of evaluating the disulfide bond cleavage activity of PDI using the RBD of the SARS-CoV-2 Omicron strain are shown.

[0033] Figure 8 Shown are the results of evaluating the antiviral activity of PDI against the SARS-CoV-2 Delta strain.

[0034] Fig. 9 Shown are the results of evaluating the antiviral activity of PDI against the Omicron strain of SARS-CoV-2.

[0035] Fig.10 The results of evaluating the disulfide bond cleavage activity of PDI family proteins using the RBD of hCoV-229E are shown. DETAILED DESCRIPTION

[0036] [definition]

[0037] The term "comprise" means that constituent elements other than the target constituent elements may be included. The term "consist of" means that constituent elements other than the target constituent elements are not included. The term "consist essentially of" means that constituent elements other than the target constituent elements are not included in a manner in which a special function is exerted (e.g., a manner in which the effect of the present invention is completely lost). When "comprise" appears in this specification, it includes the manners of "consist of" and "consist essentially of".

[0038] The numerical range expressed using “to” means a numerical range including the numerical values ​​described before and after “to” as the lower limit and the upper limit.

[0039] Protein, peptide, polynucleotide (DNA, RNA), vector and cell can be separated substances. "Separation" refers to the natural state or the state separated from other components. The "separated" substance can be substantially free of other components. "Substantially free of other components" refers to the extent that the content of other components contained in the separated components can be ignored. The content of other components contained in the separated components can be listed as 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less, or 0.1% by mass or less. The protein, peptide, polynucleotide (DNA, RNA), vector and cell described in this specification can be separated protein, separated peptide, separated polynucleotide (separated DNA, separated RNA), separated vector and separated cell, respectively.

[0040] "Polynucleotide" refers to a nucleotide polymer in which nucleotides are linked by phosphodiester bonds. "Polynucleotide" and "nucleic acid" can be DNA, RNA, or a combination of DNA and RNA. "Polynucleotide" can be a polymer of natural nucleotides, a polymer of natural nucleotides and non-natural nucleotides (analogs of natural nucleotides, nucleotides in which at least one of the base part, sugar part and phosphate part is modified (for example, thiophosphate backbone), etc.), or a polymer of non-natural nucleotides.

[0041] The nucleotide sequence of a "polynucleotide" is written in the generally accepted single-letter code unless otherwise indicated. The nucleotide sequence is written from the 5' side to the 3' side unless otherwise indicated. The nucleotide residues constituting a "polynucleotide" are sometimes simply described as adenine, thymine, cytosine, guanine or uracil, etc., or their single-letter codes.

[0042] "Polypeptide" and "protein" are used interchangeably and refer to polymers of amino acids bonded by amide bonds. A "polypeptide" or "protein" may be a polymer of natural amino acids, a polymer of natural amino acids and non-natural amino acids (chemical analogs, modified derivatives, etc. of natural amino acids), or a polymer of non-natural amino acids.

[0043] The amino acid sequence of a "polypeptide" or "protein" is written using the commonly accepted single-letter code or the three-letter code, unless otherwise indicated. Amino acid sequences are written from the N-terminal side to the C-terminal side, unless otherwise indicated.

[0044] The sequence identity (or homology) between nucleotide sequences or amino acid sequences refers to that two nucleotide sequences or amino acid sequences are compared while inserting gaps at the corresponding insertion and deletion parts, so that the corresponding bases or amino acids are consistent to the greatest extent, and the gaps in the obtained comparison are excluded to find the ratio of the consistent bases or amino acids to the entire nucleotide sequence or the entire amino acid sequence. The sequence identity between nucleotide sequences or amino acid sequences can be determined using various homology search software known in the art. For example, the value of the sequence identity of the nucleotide sequence can be calculated based on the comparison obtained by the known homology search software BLASTN, and the value of the sequence identity of the amino acid sequence can be calculated based on the comparison obtained by the known homology search software BLASTP.

[0045] "Codon optimization" means that while maintaining the original amino acid sequence, at least one codon of the original nucleotide sequence is replaced with a codon that is more frequently used in the target biological species. Codon usage frequency tables can be easily obtained from, for example, the "Codon Usage Database" (Codon Usage Database) (www.kazusa.or.jp / codon / ) provided by the public welfare foundation Kazusa DNA Research Institute. For example, codon usage frequency tables can be used to optimize codons. Computer algorithms for codon optimization of specific sequences to express in specific animal species are also known. Computer algorithms for codon optimization can be obtained in, for example, Gene Forge (Aptagen, Jacobus, PA).

[0046] The term "functionally linked" used in connection with a polynucleotide means that a first nucleotide sequence is placed close enough to a second nucleotide sequence and that the first nucleotide sequence is able to affect the second nucleotide sequence or a region under the control of the second nucleotide sequence. For example, a polynucleotide is functionally linked to a promoter, meaning that the polynucleotide is linked in such a way that it is expressed under the control of the promoter.

[0047] The term "promoter is capable of functioning" means that a polynucleotide functionally linked to the promoter can be expressed in cells of a target organism.

[0048] The term "expressible state" refers to a state in which a polynucleotide can be transcribed in a cell into which the polynucleotide has been introduced.

[0049] The term "expression vector" refers to a vector comprising a polynucleotide of interest and having a system that enables the polynucleotide of interest to be expressed in cells into which the vector has been introduced.

[0050] "Viral infection" refers to diseases caused by viral infection. For example, infection with SARS-CoV-2 causes the novel coronavirus infection disease (COVID-19).

[0051] "Pathogenic virus" refers to the virus that causes viral infection. For example, the causative virus of COVID-19 is SARS-CoV-2.

[0052] The “risk of a viral infection becoming severe” refers to the risk that symptoms of a viral infection will progress and become severe.

[0053] [Antiviral agents]

[0054] A first aspect of the present invention is an antiviral agent. In one embodiment, the antiviral agent comprises at least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein.

[0055] <Protein having disulfide bond cleaving activity (disulfide bond cleaving enzyme)>

[0056] In one embodiment, the antiviral agent may include a protein having disulfide bond cleaving activity (hereinafter also referred to as "disulfide bond cleaving enzyme").

[0057] "Disulfide bond cleavage activity" refers to an activity that catalyzes a disulfide bond cleavage reaction. In one embodiment, a disulfide bond is a disulfide bond formed between thiol groups of two cysteine ​​residues in a protein. Disulfide bonds participate in protein folding. By forming disulfide bonds between cysteine ​​residues contained in a protein, the protein is folded and stabilized to become a protein in a native state. On the other hand, the cleavage of disulfide bonds causes the protein to unfold and become unstable. When a protein unfolds, it loses the function of the protein in the native state.

[0058] Whether the target protein has disulfide bond cleavage activity can be confirmed by a known method. As a method for confirming the presence or absence of disulfide bond cleavage activity, for example, it can be the method described in the Examples. Specifically, in the presence of an appropriate reducing agent (e.g., reduced glutathione), the target protein is reacted with a substrate protein (a protein containing a disulfide bond). Then, the cleavage of the disulfide bond in the substrate protein is confirmed. As a result, if the cleavage of the disulfide bond in the substrate protein is confirmed, it can be determined that the target protein has disulfide bond cleavage activity.

[0059] The cutting of disulfide bonds in substrate proteins can be confirmed by detecting the thiol groups formed by the cutting of disulfide bonds. Reagents that specifically attach to thiol groups, such as maleimide compounds, can be used to detect thiol groups. For example, the substrate protein after the reaction can be reacted with maleimide PEG (polyethylene glycol with maleimide groups added) and SDS-polyacrylamide electrophoresis (PAGE). Maleimide PEG specifically binds to thiol groups. Therefore, when the disulfide bonds are cut to form thiol groups, maleimide PEG is attached to the thiol groups. Thus, compared with the case where the disulfide bonds are not cut, this increases the molecular weight of the substrate protein. The cutting of disulfide bonds can be detected based on the increase in the molecular weight of the substrate protein.

[0060] The disulfide bond cleaving enzyme is not particularly limited as long as it has disulfide bond cleaving activity. Examples of the disulfide bond cleaving enzyme include C(X) n C motif (C is a cysteine ​​residue, X is any amino acid residue, and n is an integer from 2 to 10).

[0061] In the disulfide bond formation reaction, the oxidized C(X) n The C motif acts on the cysteine ​​residues (C) of the substrate protein in the unfolded state to form disulfide bonds between the cysteine ​​residues in the substrate protein. n C motif is converted to a reduced state.

[0062] In the disulfide bond cleavage reaction, the reduced C(X) n The C motif reduces the disulfide bonds of the substrate protein in the folded state and cuts the disulfide bonds. At this time, C(X) n C motif is converted to an oxidized state.

[0063] C(X) n The C motif is preferably a CXXC motif, more preferably a CGHC motif (C is a cysteine ​​residue, G is a glycine residue, and H is a histidine residue). As a protein containing a CXXC motif, for example, a protein containing a thioredoxin-like domain can be cited. The thioredoxin-like domain is a domain having a structure similar to that of thioredoxin, and has catalytic activity for the formation reaction and cleavage reaction of a disulfide bond. The thioredoxin-like domain contains a CXXC motif at the active site.

[0064] Specific examples of disulfide bond cleaving enzymes include PDI family proteins, which are a group of proteins having a thioredoxin-like domain. PDI family proteins are localized in the endoplasmic reticulum. Examples of PDI family proteins include protein disulfide isomerase (PDI), ERp46 (thioredoxin domain containing 5; also referred to as "TXNDC5"), ERp57 (protein disulfide-isomerase like protein ERp57), ERp72 (protein disulfide isomerase A4 (protein disulfide isomerase family A member 4)), P5 (protein disulfide isomerase A6 (protein disulfide isomerase family A member 6); also referred to as "PDIA6"), ERp18 (thioredoxin domain containing 12; also referred to as "TXNDC12"), ERdj5 (DnaJ heat shock protein family (Hsp40) member C10 (DnaJ heat shock protein family (Hsp40) member C10); also known as "DNAJC10"), PDIr (protein disulfide isomerase familyA member 5); also known as "PDIA5") and PDIp (protein disulfide isomerase familyA member 2); also known as "PDIA2"). The disulfide bond cleaving enzyme is preferably a PDI family protein, more preferably at least one selected from the group consisting of PDI, ERp46, ERp57, ERp72 and P5, and further preferably at least one selected from the group consisting of PDI and ERp46.

[0065] Figure 1 The three-dimensional structure of PDI is shown. PDI has four domains: catalytic domains a and a' and non-catalytic domains b and b'. Catalytic domains a and a' are thioredoxin-like domains. The a domain and the a' domain each contain a redox active site. A redox active site contains a CGHC motif. Figure 2The domain structures of PDI family proteins, namely PDI, ERp57, ERp72, ERp46 and P5, are shown. In the figure, "CGHC" represents the CGHC motif and indicates that the domain contains the CGHC motif.

[0066] The amino acid sequence of human PDI is shown in SEQ ID NO: 2. The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 1. Human PDI may be a genetic recombinant. An example of the amino acid sequence of a genetic recombinant human PDI is shown in SEQ ID NO: 4 (the nucleotide sequence is SEQ ID NO: 3).

[0067] The amino acid sequence of human ERp46 is shown in SEQ ID NO: 6. The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 5. Human ERp46 may be a recombinant gene. An example of the amino acid sequence of a recombinant human ERp46 is shown in SEQ ID NO: 8 (the nucleotide sequence is SEQ ID NO: 7).

[0068] The amino acid sequence of human ERp57 is shown in SEQ ID NO: 10. The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 9. Human ERp57 may be a recombinant gene. An example of the amino acid sequence of a recombinant human ERp57 is shown in SEQ ID NO: 12 (the nucleotide sequence is SEQ ID NO: 11).

[0069] The amino acid sequence of human ERp72 is shown in SEQ ID NO: 14. The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 13. Human ERp72 may be a recombinant gene. An example of the amino acid sequence of a recombinant human ERp72 is shown in SEQ ID NO: 16 (the nucleotide sequence is SEQ ID NO: 15).

[0070] The amino acid sequence of human P5 is shown in SEQ ID NO: 18. The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 17. Human P5 may be a recombinant gene. An example of the amino acid sequence of a recombinant human P5 is shown in SEQ ID NO: 20 (the nucleotide sequence is SEQ ID NO: 19).

[0071] Examples of the amino acid sequence of human ERp18 include the amino acid sequence registered as GeneBank Accession No. NP_056997.1, and examples of the nucleotide sequence include the nucleotide sequence registered as GeneBank Accession No. NM_015913.4.

[0072] Examples of the amino acid sequence of human ERdj5 include the amino acid sequence registered as GeneBank Accession No. NP_001258510.1, and examples of the nucleotide sequence include the nucleotide sequence registered as GeneBank Accession No. NM_001271581.3.

[0073] Examples of the amino acid sequence of human PDIr include the amino acid sequence registered as GeneBank Accession No. NP_006801.1, and examples of the nucleotide sequence include the nucleotide sequence registered as GeneBank Accession No. NM_006810.4.

[0074] Examples of the amino acid sequence of human PDIp include the amino acid sequence registered as GeneBank Accession No. NP_006840.2, and examples of the nucleotide sequence include the nucleotide sequence registered as GeneBank Accession No. NM_006849.4.

[0075] The PDI family protein may be a natural protein or a mutant. Specific examples of the PDI family protein that can be used as a disulfide bond cleaving enzyme include the following polypeptides (A) to (C).

[0076] (A) A polypeptide comprising the amino acid sequence of a native PDI family protein (eg, SEQ ID NOs: 2, 6, 10, 14, 18).

[0077] (B) A polypeptide comprising an amino acid sequence in which one or more amino acids in the amino acid sequence of a natural PDI family protein (eg, SEQ ID NO: 2, 6, 10, 14, 18) are mutated, which has disulfide bond cleaving activity.

[0078] (C1) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence of a natural PDI family protein (eg, SEQ ID NO: 2, 6, 10, 14, 18), which has disulfide bond cleaving activity.

[0079] The polypeptide in (A) is a polypeptide consisting of an amino acid sequence of a natural PDI family protein, or a polypeptide to which an amino acid sequence is attached to either or both of the N-terminus and the C-terminus of the polypeptide. The length of the amino acid sequence attached to the N-terminus or the C-terminus of the polypeptide is not particularly limited. As the attached amino acid sequence, for example, the amino acid sequence of a peptide tag (FLAG tag, HA tag, 6×His tag, Myc tag, etc.), the amino acid sequence of other proteins, etc. can be cited. As the number of amino acids in the attached amino acid sequence, for example, 2000 or less, 1000 or less, 500 or less, 400 or less, 300 or less, 200 or less, 100 or less, 50 or less, 30 or less, 20 or less, or 10 or less can be cited. As the number of amino acids constituting the polypeptide in (A), for example, 4000 or less, 3000 or less, 2000 or less, 1000 or less, 800 or less, 700 or less, 600 or less can be cited.

[0080] The polypeptide in (B) is a polypeptide consisting of an amino acid sequence in which one or more amino acids in the amino acid sequence of a natural PDI family protein are mutated, or a polypeptide in which an amino acid sequence is added to either or both of the N-terminus and the C-terminus of the polypeptide. The added amino acid sequence and the number of amino acids are the same as those in (A) above.

[0081] Amino acid mutation may be any one of deletion, substitution, addition and insertion, or a combination thereof. The number of mutated amino acids is not particularly limited. As the number of mutated amino acids, for example, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2 can be cited. "Multiple" refers to, for example, 2 to 80, 2 to 60, 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, 2 to 5, 2 to 4, 2 to 3 or 2. The number of mutated amino acids is preferably 1 or several. "Several" refers to 2 to 10, which may be 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3 or 2.

[0082] The type and position of the mutated amino acid are not particularly limited. When the mutation is an amino acid substitution, for example, an amino acid substituted with a similar property to the original amino acid can be cited. The property of the amino acid can be judged based on the side chain. For example, the original amino acid and the substituted amino acid can have similar side chain properties. As an amino acid substitution, for example, conservative substitution can be cited. Conservative substitution is an amino acid substitution that does not significantly affect the function of the polypeptide. Amino acids can be classified into acidic amino acids (aspartic acid, glutamic acid), basic amino acids (lysine, arginine, histidine), neutral amino acids (amino acids with hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine, proline), amino acids with hydroxyl groups (serine, threonine), sulfur-containing amino acids (cysteine, methionine), amino acids with amide groups (asparagine, glutamine), amino acids with imino groups (proline), amino acids with aromatic groups (phenylalanine, tyrosine, tryptophan), etc. As conservative substitutions, for example, substitutions within these groups can be cited.

[0083] The polypeptide in (C) is a polypeptide consisting of an amino acid sequence having a sequence identity of 80% or more with the amino acid sequence of a natural PDI family protein, or a polypeptide having an amino acid sequence added to either or both of the N-terminus and the C-terminus of the polypeptide. The added amino acid sequence and the number of amino acids are the same as those in (A) above.

[0084] There is no particular limitation on the sequence identity as long as it is 80% or more. Examples of sequence identity include 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, and 99.5% or more.

[0085] The disulfide bond cleaving enzyme is not limited to those exemplified above, and any enzyme can be used. As the disulfide bond cleaving enzyme, for example, an enzyme registered in a public gene database such as GneneBank, UniProt, or a public protein database can be used without particular limitation.

[0086] The source organism of the disulfide bond cleaving enzyme is not particularly limited. From the viewpoint of avoiding an immune response to the disulfide bond cleaving enzyme, the disulfide bond cleaving enzyme is preferably derived from an organism of the same species as the subject to which the antiviral agent is administered. For example, when the antiviral agent is administered to humans, it is preferred to use a disulfide bond cleaving enzyme derived from humans.

[0087] Disulfide bond cutting enzyme can be obtained by known methods. In the case where the disulfide bond cutting enzyme is a natural protein, the disulfide bond cutting enzyme can be purified from the cell producing the disulfide bond cutting enzyme by known protein purification techniques. Alternatively, the polynucleotide encoding the disulfide bond cutting enzyme can be introduced into a suitable host cell (e.g., Escherichia coli, yeast, etc.) in an expressible state, and the disulfide bond cutting enzyme is produced in the host cell, and then the disulfide bond cutting enzyme is purified. Alternatively, a cell-free synthesis system can be used to produce the disulfide bond cutting enzyme.

[0088] When the antiviral agent contains a disulfide bond cleaving enzyme, the disulfide bond cleaving enzyme contained in the antiviral agent may be one type or two or more types.

[0089] <Polynucleotide comprising a nucleotide sequence encoding a protein having disulfide bond cleaving activity>

[0090] In one embodiment, the antiviral agent may include a polynucleotide including a nucleotide sequence encoding a protein having disulfide bond cleaving activity (hereinafter also referred to as a "disulfide bond cleaving enzyme encoding sequence").

[0091] (RNA containing a disulfide bond cleaving enzyme coding sequence)

[0092] The polynucleotide comprising the disulfide bond cleaving enzyme coding sequence may be RNA. In this case, the polynucleotide is preferably mRNA. In the case of mRNA, the polynucleotide preferably comprises a 5' untranslated region (5'UTR), a 3' untranslated region (3'UTR), a 5' end cap structure (5'Cap) and a 3' terminal poly A (poly A) sequence in addition to the disulfide bond cleaving enzyme coding sequence. The mRNA may be the natural mRNA of the disulfide bond cleaving enzyme or a modified mRNA. As mRNA, the following examples may be cited.

[0093] (1) Starting from the 5' side, the mRNA contains 5' Cap, 5' UTR, disulfide bond cleaving enzyme coding region, 3' UTR and poly A in sequence.

[0094] (2) Starting from the 5' side, the mRNA contains 5' Cap, 5' UTR, disulfide bond cleaving enzyme coding region and poly A in sequence.

[0095] (3) Starting from the 5' side, the mRNA includes 5'UTR, disulfide bond cleaving enzyme coding region, 3'UTR and poly A in sequence.

[0096] (4) Starting from the 5' side, the mRNA includes 5'UTR, disulfide bond cleaving enzyme coding region and poly A in sequence.

[0097] (5) mRNA that includes, starting from the 5' side, a 5' Cap, a 5' UTR, a disulfide bond cleaving enzyme coding region, and a 3' UTR.

[0098] (6) Starting from the 5' side, the mRNA contains the 5' Cap, 5' UTR and disulfide bond cleaving enzyme coding region in sequence.

[0099] (7) mRNA comprising, starting from the 5' side, a 5' UTR, a disulfide bond cleaving enzyme coding region, and a 3' UTR.

[0100] (8) Starting from the 5' side, the mRNA includes 5'UTR and disulfide bond cleaving enzyme coding region in sequence.

[0101] In the above (1) to (8), the disulfide bond cleaving enzyme coding region is a region having a nucleotide sequence encoding a disulfide bond cleaving enzyme (hereinafter also referred to as a "disulfide bond cleaving enzyme coding sequence"). The disulfide bond cleaving enzyme coding sequence may be the same as the coding sequence in the mRNA of a natural disulfide bond cleaving enzyme (e.g., a PDI family protein). The disulfide bond cleaving enzyme coding sequence may have variations in the natural coding sequence as long as it encodes a functional disulfide bond cleaving enzyme. For example, the disulfide bond cleaving enzyme coding sequence may have silent variations in the natural coding sequence. The disulfide bond cleaving enzyme coding sequence may be codon-optimized according to the biological species of the applicable object. The disulfide bond cleaving enzyme coding sequence may have a high G / C content to stabilize the mRNA.

[0102] The mRNA of the disulfide bond cleaving enzyme can be prepared by a known method. For example, it can be prepared by in vitro transcription of a template DNA encoding the disulfide bond cleaving enzyme. For example, it can be prepared according to the method described in Blood 108 (13) (2006) 4009-17. Specifically, the template DNA is cut immediately downstream of the poly A / T chain, and in vitro transcription is performed in a buffer solution containing a translation enzyme, nucleotides and a 5' cap analog, and then prepared by purifying mRNA, in which the poly A / T chain has been incorporated downstream of the disulfide bond cleaving enzyme coding sequence.

[0103] The length of the poly A sequence of the mRNA of the disulfide bond cleaving enzyme is not particularly limited. Examples of the length of the poly A sequence include 10 to 500 bases, preferably 30 to 300 bases, and more preferably 60 to 250 bases.

[0104] The 5'UTR and 3'UTR sequences of the mRNA of the disulfide bond cleaving enzyme may have 100% sequence identity with the naturally occurring sequence. Alternatively, the 5'UTR sequence may be partially or completely replaced by the 5'UTR sequence of the mRNA of another gene. The 3'UTR sequence may be partially or completely replaced by the 3'UTR sequence of the mRNA of another gene. Examples of mRNAs of other genes include, but are not limited to, mRNAs of globulin genes, mRNAs of hydroxysteroid (17-β) dehydrogenase 4 genes, and mRNAs of albumin genes.

[0105] The bases of the mRNA itself (coding region, 5'UTR, 3'UTR, poly A) may or may not be chemically modified. In the case where the bases of the mRNA itself are not chemically modified, since the mRNA itself is natural, it can be expected that the translation process will hardly be disturbed. In the case where the bases of the mRNA itself are chemically modified, it can be expected that the enzyme resistance of the mRNA will be improved and / or the immunogenicity will be reduced. As chemically modified bases of the mRNA itself, for example, methylated bases (e.g., 5-methylcytosine), sulfur-modified bases (e.g., 2-thiouridine), pseudouridine, N1 methyl pseudouridine, 5-methoxyuridine, etc. can be listed, but are not limited to this.

[0106] The cap structure of mRNA may be modified or not. Modification of the cap structure is expected to stabilize mRNA. As a modification of the cap structure, a modification in which the 2-hydroxyl group of the first or second ribose on the 5' side is replaced by a methoxy group can be cited. It is known that such modification can improve expression efficiency.

[0107] (DNA containing a disulfide bond cleaving enzyme coding sequence)

[0108] The polynucleotide containing the disulfide bond cleaving enzyme coding sequence may be DNA. In this case, the polynucleotide preferably contains an expression control sequence of the disulfide bond cleaving enzyme coding sequence in addition to the disulfide bond cleaving enzyme coding sequence. As expression control sequences, for example, promoters, enhancers, poly A tailing signals and terminators can be listed. These expression control sequences can be sequences that can play a role in the cells of the antiviral administration object. Preferably, the disulfide bond cleaving enzyme coding sequence is functionally connected to the promoter. Preferably, the disulfide bond cleaving enzyme coding sequence is functionally connected to the expression control sequence contained in the polynucleotide. The polynucleotide encoding the disulfide bond cleaving enzyme may be an expression vector of the disulfide bond cleaving enzyme.

[0109] When the subject is a mammal, specific examples of promoters include, but are not limited to, CMV (cytomegalovirus) promoter, SRα promoter, SV40 early promoter, LTR of retrovirus, RSV (Rous sarcoma virus) promoter, HSV-TK (herpes simplex virus thymidine kinase) promoter, EF1α promoter, metallothionein promoter, heat shock promoter, etc.

[0110] When an expression vector is used, the type of vector is not particularly limited. The vector can be any vector that works in the cells of the subject to which the antiviral agent is administered. The vector can be a viral vector or a non-viral vector (plasmid, transposon vector, additional vector, artificial chromosome vector, etc.).

[0111] Examples of viral vectors include Sendai virus vectors, retrovirus (including lentivirus) vectors, adenovirus vectors, adeno-associated virus vectors, herpes virus vectors, vaccinia virus vectors, poxvirus vectors, poliovirus vectors, Sylvestris virus vectors, rhabdovirus vectors, paramyxovirus vectors, orthomyxovirus vectors, etc. The viral vector may be a replication-defective viral vector that is defective in replication ability.

[0112] Examples of the plasmid vector include pA1-11, pXT1, pRc / CMV, pRc / RSV, and pcDNAI / Neo.

[0113] As an additional vector, for example, a vector containing a sequence required for autonomous replication as a vector element can be listed. The sequence required for autonomous replication can be a sequence derived from Epstein-Barr virus (EBV), Simian virus 40 (SV40), etc. As a vector element required for autonomous replication, specifically, for example, a replication origin and a gene encoding a protein that binds to the replication origin and controls replication can be listed. For example, in EBV, the replication origin oriP and EBNA-1 genes can be listed, and in SV40, the replication origin ori and SV40LT genes can be listed.

[0114] Examples of artificial chromosome vectors include HAC (Human artificial chromosome), YAC (Yeast artificial chromosome) vectors, BAC (Bacterial artificial chromosome) vectors, and PAC (P1-derived artificial chromosome).

[0115] (Disulfide bond cleaving enzyme coding sequence)

[0116] The disulfide bond cleaving enzyme coding sequence is not particularly limited as long as it encodes a disulfide bond cleaving enzyme. As the disulfide bond cleaving enzyme encoded by the disulfide bond cleaving enzyme coding sequence, the same enzymes as those mentioned above can be listed. The disulfide bond cleaving enzyme coding sequence can encode a natural disulfide bond cleaving enzyme, or a modified disulfide bond cleaving enzyme. The disulfide bond cleaving enzyme coding sequence can contain introns, or it can be a gene sequence on the genome of a natural disulfide bond cleaving enzyme. Alternatively, the disulfide bond cleaving enzyme coding sequence may not contain introns. Examples of the disulfide bond cleaving enzyme coding sequence that does not contain an intron include the nucleotide sequence described by SEQ ID NO: 1 (human PDI), SEQ ID NO: 3 (human PDI recombinant), SEQ ID NO: 5 (human ERp46), SEQ ID NO: 7 (human ERp46 recombinant), SEQ ID NO: 9 (human ERp57), SEQ ID NO: 11 (human ERp57 recombinant), SEQ ID NO: 13 (human ERp72), SEQ ID NO: 15 (human ERp72 recombinant), SEQ ID NO: 17 (human P5), or SEQ ID NO: 19 (human P5 recombinant). When the polynucleotide containing the disulfide bond cleaving enzyme coding sequence is RNA, the nucleotide sequence described by the SEQ ID NO is replaced by a nucleotide sequence in which "T" is replaced by "U".

[0117] Examples of disulfide bond cleaving enzyme coding sequences include PDI family protein coding sequences. Specific examples of PDI family protein coding sequences include the following (a) to (c).

[0118] (a) Nucleotide sequences encoding natural PDI family proteins (e.g., SEQ ID NOs: 1, 5, 9, 13, 17).

[0119] (b) A nucleotide sequence in which one or more nucleotides in a nucleotide sequence encoding a natural PDI family protein (e.g., SEQ ID NO: 1, 5, 9, 13, 17) are mutated, which encodes a polypeptide having disulfide bond cleaving activity.

[0120] (c) A nucleotide sequence having a sequence identity of 80% or more to a polynucleotide consisting of a nucleotide sequence encoding a natural PDI family protein (e.g., SEQ ID NO: 1, 5, 9, 13, 17), which encodes a polypeptide having disulfide bond cleaving activity.

[0121] In the nucleotide sequence in (b), the nucleotide mutation may be any one of deletion, substitution, addition and insertion, or a combination thereof. The number of mutated nucleotides is not particularly limited as long as the polypeptide encoded by the obtained nucleotide sequence has disulfide bond cleavage activity. As the number of mutated nucleotides, for example, 1 to 300, 1 to 200, 1 to 150, 1 to 120, 1 to 100, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 or 2 can be listed. "Multiple" refers to, for example, 2 to 300, 2 to 200, 2 to 150, 2 to 120, 2 to 100, 2 to 80, 2 to 60, 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, 2 to 5, 2 to 4, 2 to 3 or 2. The number of variant nucleotides is preferably 1 or several. "Several" refers to 2 to 10, and can be 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3 or 2.

[0122] In the nucleotide sequence in (c), the sequence identity is not particularly limited as long as it is 80% or more. Examples of the sequence identity include 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, and 99.5% or more.

[0123] In the disulfide bond cleaving enzyme coding sequence, degenerate codons can use codons with high usage frequency in the subject of administration of the antiviral agent. For example, codon optimization of the disulfide bond cleaving enzyme coding sequence can be performed according to the subject of administration of the antiviral agent. Nucleotide mutations can be gene mutations (silent mutations) that do not change the amino acid sequence of the encoded protein.

[0124] When the antiviral agent includes a polynucleotide containing a disulfide bond cleaving enzyme encoding sequence, the polynucleotides included in the antiviral agent may be one type or two or more types.

[0125] <Applicable objects>

[0126] The virus to which the antiviral agent is applicable is not particularly limited. Preferably, the antiviral agent is applicable to a virus comprising a protein folded, for example, by a disulfide bond. As a protein comprising a disulfide bond, there is no particular limitation, preferably at least one protein selected from the group consisting of a spike protein, an envelope protein, and a capsid protein. The spike is a structure protruding to the outer surface of the virus. The spike is usually present in the envelope and is involved in the invasion of the host cell by the virus particle. The spike protein is a protein constituting the spike. The envelope is a lipid bilayer membrane structure located at the outermost side of the virus particle. The envelope protein is a protein constituting the envelope. The capsid is a protein shell surrounding the viral genome. The capsid protein is a protein constituting the capsid. In particular, it is preferred that the spike protein comprises a disulfide bond. More preferably, the spike protein comprises a disulfide bond in the receptor binding domain (RBD). In one embodiment, the antiviral agent is preferably applicable to a virus containing a disulfide bond in at least one protein selected from the group consisting of a spike protein, an envelope protein, and a capsid protein, more preferably applicable to a virus containing a disulfide bond in the spike protein, and further preferably applicable to a virus containing a disulfide bond in the RBD.

[0127] As the virus applicable to the antiviral agent, for example, coronavirus, influenza virus, RS virus, Ebola virus, human immunodeficiency virus, rotavirus, Zika virus, dengue virus, Japanese encephalitis virus, hepatitis virus (hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus) and papillomavirus can be listed. Among them, coronavirus has a disulfide bond in its RBD, so it is preferably used as a virus applicable to the antiviral agent.

[0128] "Coronavirus" refers to a virus belonging to the Coronaviridae family. The Coronaviridae family is further divided into the subfamily Coronavirinae and the subfamily Torovirinae. The subfamily Coronavirinae is further divided into four genera: Alpha (α) coronavirus, Beta (β) coronavirus, Gamma (γ) coronavirus and Delta (δ) coronavirus. The applicable coronavirus may be any one of them. As specific examples of applicable coronaviruses, for example, SARS-CoV-2, SARS-CoV-1, MERS-CoV, HCoV-HKU1, HCoV-OC43, HCoV-229E, HCoV-NL63, etc. can be listed, but are not limited thereto. The applicable virus may be a variant strain. As a SARS-CoV-2 variant strain, for example, Delta strain and Omicron strain can be listed, but are not limited thereto.

[0129] The object of administration of the antiviral agent is not particularly limited. The object of administration of the antiviral agent is preferably a eukaryotic organism, but may also be an animal or a plant. Among them, the applicable object of the antiviral agent is more preferably a mammal. The mammal may be a human or a mammal other than a human. As mammals other than humans, for example, primates (monkeys, chimpanzees, gorillas, etc.), rodents (mice, hamsters, rats, etc.), rabbits, dogs, cats, cows, goats, sheep, horses, etc. can be listed, but are not limited to these.

[0130] The antiviral agent of this embodiment includes a disulfide bond cleaving enzyme, which inactivates the virus by cleaving the disulfide bonds of the proteins constituting the virus. For example, in the case where the RBD of the virus contains a disulfide bond, the cleavage of the disulfide bond in the RBD will cause the RBD to unfold. In addition, the disulfide bond cleaving enzyme has binding activity to proteins containing disulfide bonds, and thus can competitively inhibit the binding of the RBD containing disulfide bonds to the host cell receptor. This makes it difficult for the virus to bind to the host cell receptor. As a result, the viral infection of the host cell is inhibited.

[0131] The antiviral agent of this embodiment exerts antiviral activity by inactivating viral proteins by cutting disulfide bonds, and is therefore not easily affected by viral protein mutations. Therefore, it can be applied to a wide range of viruses. In addition, by using a disulfide bond cutting enzyme derived from the same biological species as the subject of administration, the risk of side effects can be reduced.

[0132] [Drug composition]

[0133] The second embodiment of the present invention is a pharmaceutical composition for treating or preventing viral infections. In one embodiment, the pharmaceutical composition comprises the antiviral agent according to the first embodiment and a pharmaceutically acceptable carrier. The pharmaceutical composition of this embodiment comprises the antiviral agent according to the first embodiment as an active ingredient.

[0134] "Pharmaceutically acceptable carrier" refers to a carrier that does not inhibit the physiological activity of the active ingredient and does not show substantial toxicity to the subject to which it is administered. "Does not show substantial toxicity" means that the ingredient does not show toxicity to the subject to which it is administered at the dosage normally used. In the pharmaceutical composition of the present embodiment, a pharmaceutically acceptable carrier is a carrier that does not inhibit the antiviral activity of the antiviral agent according to the first method and does not show substantial toxicity to the subject to which it is administered. Pharmaceutically acceptable carriers include any known pharmaceutically acceptable ingredients that are generally considered to be inactive ingredients. There are no particular restrictions on pharmaceutically acceptable carriers, for example, solvents, diluents, vehicles, excipients, glidants, binders, granulating agents, dispersants, suspending agents, wetting agents, lubricants, disintegrants, solubilizers, stabilizers, emulsifiers, fillers, etc. Pharmaceutically acceptable carriers can be used alone or in combination of two or more.

[0135] In addition to the above-mentioned ingredients, the pharmaceutical composition may also contain other ingredients. There are no particular restrictions on other ingredients, and ingredients commonly used in the pharmaceutical field can be used without particular restrictions. As other ingredients, for example, pharmaceutical additives other than the above can be listed. As pharmaceutical additives, for example, preservatives (such as antioxidants), chelating agents, flavoring agents, sweeteners, thickeners, buffers, colorants, etc. can be listed, but are not limited to this. The pharmaceutical composition may contain active ingredients other than the antiviral agent according to the first embodiment. As active ingredients, for example, other antiviral agents, antibiotics, anti-inflammatory agents, antipyretics, analgesics, etc. can be listed, but are not limited to this. In the case where the antiviral agent contains a polynucleotide containing a disulfide bond cleaving enzyme coding sequence, the pharmaceutical composition may contain a transfection reagent. As a transfection reagent, for example, polyethyleneimine, cationic lipids, cationic liposomes, cationic polymers, etc. can be listed, but are not limited to this. Other ingredients can be used alone or in combination of two or more.

[0136] The dosage form of the pharmaceutical composition is not particularly limited, and can be a dosage form commonly used as a pharmaceutical preparation. The pharmaceutical composition of the present embodiment can be an oral preparation or a non-oral preparation, but a non-oral preparation is preferred. As oral preparations, for example, tablets, coated tablets, pills, powders, granules, capsules, syrups, fine granules, liquids, drops, emulsions, etc. can be listed. As non-oral preparations, for example, injections, suppositories, nasal drops, enteral preparations and inhalants can be listed. The pharmaceutical compositions of these dosage forms can be prepared according to conventional methods (for example, methods described in the Japanese Pharmacopoeia). The pharmaceutical composition is preferably a non-oral preparation, more preferably an injection.

[0137] The administration route of the pharmaceutical composition of the present embodiment is not particularly limited, and can be administered orally or non-orally, but non-oral administration is preferred. As the administration route of non-oral administration, as non-oral administration, for example, intravenous administration, intranasal administration, intratracheal administration, intrapulmonary administration, subcutaneous administration, intradermal administration, intramuscular administration, intraperitoneal administration and enteral administration can be listed. In the case where the antiviral agent contains a disulfide bond cleaving enzyme, intravenous administration is preferred as the administration route. In the case where the antiviral agent contains a polynucleotide containing a disulfide bond cleaving enzyme encoding sequence, the administration route is preferably subcutaneous administration, intradermal administration or intramuscular administration.

[0138] The pharmaceutical composition is capable of administering an effective therapeutic amount of an antiviral agent according to the first method. "Effective therapeutic amount" refers to an amount of a drug that is effective for treating or preventing a target disease. For example, the effective therapeutic amount of the antiviral agent may be an amount that effectively inhibits viral infection. The effective therapeutic amount may be appropriately determined based on the patient's symptoms, weight, age, gender, etc., as well as the dosage form and administration method of the pharmaceutical composition. For example, in the pharmaceutical composition, a single administration amount of the antiviral agent may be 0.01 to 1000 mg per kilogram of body weight of the subject of administration. The administration amount may be 0.05 to 500 mg / kg, 0.1 to 300 mg / kg, 0.2 to 200 mg / kg, or 0.3 to 100 mg / kg.

[0139] The pharmaceutical composition may contain a therapeutically effective amount of the antibody per unit administration. For example, the content of the antiviral agent in the pharmaceutical composition may be 0.01 to 90% by mass, 0.05 to 80% by mass, or 0.1 to 60% by mass.

[0140] The pharmaceutical composition may be administered once or repeatedly. In the case of repeated administration, the administration interval may be appropriately determined according to the patient's symptoms, weight, age, sex, etc., as well as the dosage form and administration method of the pharmaceutical composition. The administration interval may be, for example, every few hours, 2 to 3 times a day, once a day, once every 2 to 3 days, once a week, once a month, once every several months, etc.

[0141] The pharmaceutical composition is used to treat or prevent viral infections. The viral infections of applicable objects are not particularly limited. Preferably, in viral infections, for example, viruses containing proteins folded by disulfide bonds are pathogenic viruses. Preferably, viral infections are caused by pathogenic viruses such as spike proteins containing disulfide bonds. As viral infections, for example, coronavirus infections, influenza (influenza virus infections), RS virus infections, dengue fever (dengue virus infections), Ebola hemorrhagic fever (Ebola virus infections), AIDS (human immunodeficiency virus infections), rotavirus infections, Zika fever (Zika virus infections), Japanese encephalitis (Japanese encephalitis virus infections), viral hepatitis (hepatitis virus infections), papillomavirus infections, etc. can be listed. Preferably, viral infections are caused, for example, by pathogenic viruses containing disulfide bonds in the receptor binding domain (RBD). As such viral infections, for example, coronavirus infections can be listed. As specific examples of coronavirus infections, for example, COVID-19, SARS, MERS, seasonal coronavirus infections, etc. can be listed, but are not limited thereto.

[0142] The subject of administration of the pharmaceutical composition is not particularly limited. The subject of administration of the pharmaceutical composition is preferably a eukaryotic organism, but may also be an animal or a plant. Among them, the subject of administration of the pharmaceutical composition is more preferably a mammal. The mammal may be a human or a mammal other than a human. As mammals other than a human, for example, the same mammals as those exemplified in the above-mentioned antiviral agent can be cited.

[0143] [Evaluation kit for the risk of severe viral infection]

[0144] A third aspect of the present invention is a kit for evaluating the risk of developing severe symptoms of a viral infection. In one embodiment, the kit for evaluating the risk of developing severe symptoms of a viral infection comprises a specific binding substance for a protein having disulfide bond cleaving activity (disulfide bond cleaving enzyme).

[0145] Disulfide bond cleaving enzymes are proteins involved in protein folding and degradation and are present in a wide range of organisms. In mammals, some protein cleaving enzymes are secreted outside the cells and are also present in body fluids. Disulfide bond cleaving enzymes in body fluids are believed to act on viruses present in body fluids and inactivate viruses by cutting disulfide bonds in viral proteins. If the concentration of disulfide bond cleaving enzymes in body fluids is lower than that of healthy people, the viruses will not be inactivated, but will proliferate, increasing the risk of severe viral infections. Therefore, by measuring the concentration of disulfide bond cleaving enzymes in the body fluids of the subjects being tested, the risk of severe viral infections can be evaluated. In addition, disulfide bond cleaving enzymes present in cells are believed to act on viruses that have invaded cells and inactivate viruses by cutting disulfide bonds in viral proteins. Therefore, by measuring the concentration of disulfide bond cleaving enzymes in biological samples (body fluids, tissue pieces, etc.) obtained from the subjects being tested, the risk of severe viral infections can be evaluated.

[0146] <Disulfide bond cleaving enzyme>

[0147] Examples of disulfide bond cleaving enzymes that are binding targets of the specific binding substance include the same substances as those described above. The disulfide bond cleaving enzyme is preferably a PDI family protein, more preferably at least one selected from the group consisting of PDI, ERp46, ERp57, ERp72, and P5, and further preferably at least one selected from the group consisting of PDI and ERp46.

[0148] <Specific binding substance>

[0149] In one embodiment, the kit contains a specific binding substance for a disulfide bond cleaving enzyme. "Specific binding substance" refers to a substance that has an activity (specific binding property) of specifically binding to a substance to be measured. Specific binding to a substance to be measured means that it has a high binding affinity to the substance to be measured, but does not bind to other substances, or hardly binds to other substances. A specific binding substance for a disulfide bond cleaving enzyme is a substance that has specific binding property to a disulfide bond cleaving enzyme.

[0150] Examples of specific binding substances include antibodies and aptamers.

[0151] The antibody does not need to be a complete antibody, as long as it has antigen binding activity, it can also be an antigen binding fragment. An "antigen binding fragment" is a polypeptide comprising a portion of an antibody that retains the antigen binding activity of the original antibody. Preferably, the antigen binding fragment comprises all six complementarity determining regions (CDRs) of the original antibody. That is, preferably, the antigen binding fragment comprises all heavy chain variable regions CDR1, CDR2 and CDR3 and light chain variable regions CDR1, CDR2 and CDR3. As antigen binding fragments, for example, Fab, Fab', F(ab')2, variable region fragments (Fv), disulfide bond Fv, single-chain Fv (scFv), sc(Fv)2, etc. can be listed.

[0152] Antibodies may be derived from any organisms, and examples of organisms from which antibodies may be derived include mammals (human, mouse, rat, rabbit, horse, cow, pig, monkey, dog, etc.) and birds (chicken, ostrich), but are not limited thereto.

[0153] Antibodies can belong to any class and subclass of immunoglobulins. Antibodies can be either monoclonal or polyclonal.

[0154] Antibodies can be prepared by known methods such as immunization, hybridoma method, phage display method, etc.

[0155] An aptamer is a substance that has specific binding properties to a target substance. Examples of aptamers include nucleic acid aptamers and peptide aptamers. Nucleic acid aptamers can be selected, for example, by systematic evolution of ligand by exponential enrichment (SELEX). Peptide aptamers can be selected, for example, by using a yeast two-hybrid method.

[0156] The specific binding substance may be an antibody, an antigen binding fragment, or an aptamer, but is preferably an antibody. The specific substance for the disulfide bond cleaving enzyme may be an antibody or an antigen binding fragment of the disulfide bond cleaving enzyme, or an aptamer of the disulfide bond cleaving enzyme.

[0157] The specific binding substances contained in the kit may be one or two or more. When the kit contains two or more specific binding substances, each specific binding substance may have specific binding properties to another disulfide bond cleaving enzyme.

[0158] The specific binding substance can be fixed on a solid phase carrier. As the solid phase carrier, for example, a well plate (e.g., a 96-well microplate), a membrane (e.g., a nitrocellulose membrane, a polyvinylidene fluoride membrane, etc.), a slide, a magnetic bead, a latex particle, etc. can be listed. The method for fixing the specific binding substance on the solid phase carrier is not particularly limited. A known method can be appropriately selected according to the material of the solid phase carrier.

[0159] In the case where the specific binding substance is immobilized on a solid phase carrier, the kit may contain a specific binding substance (secondary specific binding substance) that binds to a disulfide bond cleaving enzyme at a different epitope from the specific binding substance (primary specific binding substance) immobilized on the solid phase carrier.

[0160] The kit may contain, for example, a primary specific binding substance immobilized on a solid phase carrier and a secondary specific binding substance not immobilized on a solid phase carrier as specific binding substances against a disulfide bond cleaving enzyme.

[0161] The specific binding substance for the disulfide bond cleaving enzyme can be labeled. The labeling substance used for labeling is not particularly limited, and known labeling substances can be used. As labeling substances, for example, enzyme labels such as peroxidase (such as horseradish peroxidase) and alkaline phosphatase can be listed; fluorescent labels such as carboxyfluorescein (FAM), 6-carboxy-4', 5'-dichloro 2', 7'-dimethoxyfluorescein (JOE), fluorescein isothiocyanate (FITC), tetrachlorofluorescein (TET), 5'-hexachlorofluorescein-CE phosphoramidite (HEX), Cy3, Cy5, Alexa568, Alexa647; radioactive isotope labels such as iodine 125; electrochemiluminescent labels such as ruthenium complexes; biotin; metal nanoparticles, etc. The labeling of the specific binding substance can be carried out by appropriately selecting a known method according to the type of the labeling substance. In the case of using biotin as a labeling substance, the kit can contain labeled avidin or avidin derivatives (streptavidin, etc.). Examples of the labeling substance for avidin or a derivative thereof include the labeling substances listed above except for biotin.

[0162] When the kit comprises a secondary specific binding substance, the secondary specific binding substance is preferably labeled.

[0163] <Other factors>

[0164] In addition to the specific binding substance for disulfide bond cleaving enzyme, the kit may also contain other elements, such as detection reagents for labeling substances, standard test materials for disulfide bond cleaving enzyme, biological test material preparation reagents, diluents, buffers, solid phase carriers, instructions for use, etc.

[0165] The detection reagent of the labeling substance is a reagent for detecting the labeling substance used to label the specific binding substance. For example, when the labeling substance is an enzyme label, the detection reagent contains a substrate of the enzyme. For example, when the enzyme label is peroxidase, as the detection reagent, TMB (3,3',5,5'-tetramethylbenzidine), OPD (o-phenylenediamine dihydrochloride), ABTS (2,2'-azo-bis-[3-ethyl-benzothiazoline-6-sulfonic acid] diammonium salt) and the like can be listed. In addition, when the enzyme label is alkaline phosphatase, pNPP (p-nitrophenyl phosphate) can be listed as the detection reagent.

[0166] The standard sample of disulfide bond cleaving enzyme is a reagent for preparing a standard curve of disulfide bond cleaving enzyme. As the standard sample of disulfide bond cleaving enzyme, a purified product of disulfide bond cleaving enzyme as the measurement object can be used. For example, when the measurement object is a PDI family protein, a purified product of a PDI family protein (PDI, ERp46, ERp57, ERp72, P5, etc.) can be used.

[0167] Biological sample preparation reagents are reagents for preparing biological samples collected from the test object. As biological samples suitable for the detection kit of this method, for example, blood samples, urine, lymph, tissue fluid, saliva, throat swabs, nasal swabs, tissue slices, etc. can be listed. As blood samples, plasma and serum can be listed. Biological sample preparation reagents are reagents used to adjust biological samples to samples suitable for measuring disulfide bond cleaving enzymes. For example, in the case where the biological sample is a blood sample, as a blood sample preparation reagent, a reagent for preparing plasma samples or serum samples from blood collected from the test object can be listed. As such reagents, for example, heparin, EDTA, sodium citrate, etc. can be listed. In addition, as biological sample preparation reagents, for example, diluents for biological samples can be listed. As diluents, known buffers such as phosphate buffer, Tris buffer (Tri-HCl, etc.) and phosphate buffered saline (PBS) can be listed.

[0168] Examples of buffers include buffers used for the binding reaction between a disulfide bond cleaving enzyme and a specific binding substance, and buffers used for the detection reaction of a labeled substance. Specific examples of buffers include blocking buffers, washing buffers, etc. As these buffers, buffers commonly used in immunoassays and the like can be used without particular limitation.

[0169] The solid phase carrier is used to immobilize a specific binding substance for the disulfide bond cleaving enzyme. Examples of the solid phase carrier include those listed above.

[0170] The kit may be an ELISA kit. In the case of an ELISA kit, it may include, for example, a primary specific binding substance fixed on a solid phase carrier, a labeled secondary specific binding substance, and a detection reagent for the labeled substance. The ELISA kit may also include a biological sample preparation reagent, an oxidized fatty acid extraction reagent, a diluent, a standard sample for a disulfide bond cleaving enzyme, and buffers (blocking buffer, washing buffer, etc.).

[0171] The kit can be used in the following method for evaluating the risk of severe symptoms of a viral infection.

[0172] [Method for evaluating the risk of severe symptoms of viral infections]

[0173] A fourth aspect of the present invention is a method for evaluating the risk of severe viral infection. In one embodiment, the method for evaluating the risk of severe viral infection comprises a step of measuring the concentration of a protein having disulfide bond cleavage activity in a biological sample of a test subject (hereinafter also referred to as "step (a)").

[0174] <Viral infections for which the risk of severe illness is assessed>

[0175] Preferably, in the viral infection for which the risk of severe illness is to be evaluated, for example, a virus comprising a protein folded by a disulfide bond is a pathogenic virus. As viral infections, for example, coronavirus infections, influenza (influenza virus infection), RS virus infection, dengue fever (dengue virus infection), Ebola hemorrhagic fever (Ebola virus infection), AIDS (human immunodeficiency virus infection), rotavirus infection, Zika fever (Zika virus infection), Japanese encephalitis (Japanese encephalitis virus infection), viral hepatitis (hepatitis virus infection), papillomavirus infection, etc. can be listed. Preferably, the viral infection is caused, for example, by a pathogenic virus comprising a disulfide bond in a receptor binding domain (RBD). As such viral infections, for example, COVID-19, SARS, MERS, and seasonal coronavirus infections can be listed.

[0176] <Biological samples to be tested>

[0177] The "test subject" refers to a subject for whom the risk of severe viral infection is evaluated by the evaluation method of this method. The test subject may be a subject suffering from a viral infection or a subject at a high risk of suffering from a viral infection. As the test subject, for example, the same subjects as those to whom the above-mentioned antiviral agent is administered can be listed.

[0178] "Biological samples" refer to samples that contain at least a portion of the body fluid components and / or cell components of the subject being tested. The biological samples of the subject being tested can be obtained by collecting the body fluids or tissues of the subject being tested. Examples of biological samples of the subject being tested include, but are not limited to, blood samples, urine, lymph, tissue fluid, saliva, throat swabs, nasal swabs, tissue slices, etc. The biological samples can be prepared by appropriately processing the body fluids or tissue slices collected from the subject.

[0179] The "blood sample" refers to a sample containing at least a part of blood components, and may be any of whole blood, serum, and plasma, or a dilution of these. The blood sample is preferably serum or plasma.

[0180] The blood sample of the test object is a sample containing blood components collected from the test object, preferably plasma or serum prepared from blood collected from the test object. The method for preparing plasma or serum from blood is not particularly limited, and known methods can be used. As a method for separating plasma from blood, for example, there can be cited a method of adding heparin, EDTA, sodium citrate, etc. to the blood and then centrifuging it. From the viewpoint of inhibiting the decomposition of disulfide bond cleaving enzymes, the centrifugation is preferably performed under cooling conditions (for example, 4°C).

[0181] <Measurement procedure: step (a)>

[0182] The method for measuring the concentration of the disulfide bond cleaving enzyme in the biological sample to be tested is not particularly limited, and a known method can be used.

[0183] Examples of methods for measuring disulfide bond cleaving enzymes include methods using a substance that specifically binds to disulfide bond cleaving enzymes.

[0184] For example, a biological sample to be tested is brought into contact with a specific binding substance for a disulfide bond cleaving enzyme that is bound to a solid phase carrier. Thus, the disulfide bond cleaving enzyme binds to the specific binding substance, and the disulfide bond cleaving enzyme in the biological sample is captured by the solid phase carrier. Next, a labeled secondary specific binding substance is brought into contact with the solid phase carrier. Thus, the secondary specific binding substance binds to the disulfide bond cleaving enzyme captured by the solid phase carrier. Next, by measuring the labeled substance bound to the secondary specific binding substance, the disulfide bond cleaving enzyme in the biological sample can be measured.

[0185] Specific examples of methods for measuring disulfide bond cleaving enzymes using a specific binding substance include enzyme immunoassay (EIA, ELISA), radioimmunoassay (RIA), fluorescent enzyme immunoassay (FLEIA), chemiluminescent enzyme immunoassay (CLEIA), chemiluminescent immunoassay (CLIA), electrochemiluminescent immunoassay (ECLIA), and fluorescent antibody method (FA).

[0186] The disulfide bond cleaving enzymes to be measured in this step may be one or more. Examples of the disulfide bond cleaving enzymes to be measured include the same enzymes as described above, preferably PDI family proteins (PDI, ERp46, ERp57, ERp72, P5, etc.).

[0187] <Other steps>

[0188] In addition to the above-mentioned determination step (step (a)), the present method may also include other steps. As other steps, for example, there can be listed a step of evaluating the risk of severe viral infection based on the concentration of the disulfide bond cleaving enzyme measured in the determination step, and a step of treating or preventing viral infection based on the evaluation result.

[0189] 《Evaluation steps: Step (b)》

[0190] In one embodiment, the method may include the step of evaluating the risk of severe viral infection based on the concentration of the disulfide bond cleaving enzyme measured in the measuring step.

[0191] For example, if the concentration of disulfide bond cleaving enzyme in the biological sample is lower than the reference value, the risk of severe viral infection of the test subject can be evaluated as high. Alternatively, if the concentration of disulfide bond cleaving enzyme in the biological sample is higher than the reference value, the risk of severe viral infection of the test subject can be evaluated as low.

[0192] The reference value may be, for example, a value calculated by statistical processing of the concentration of disulfide bond cleaving enzyme in a biological sample measured in a group of healthy persons consisting of an arbitrary number of people. The reference value may be, for example, a value calculated by statistical processing of the concentration of disulfide bond cleaving enzyme in a biological sample measured in a group of infected persons, patients and / or recovered persons of a viral infection consisting of an arbitrary number of people. The reference value may be, for example, a value calculated by statistical processing of the concentration of disulfide bond cleaving enzyme in a biological sample measured in a group of persons with mild viral infection. The reference value may be, for example, a value calculated by statistical processing of the concentration of disulfide bond cleaving enzyme in a biological sample measured in a group of persons with severe viral infection.

[0193] 《Treatment / Prevention Steps: Step (c)》

[0194] In one embodiment, the method may include the step of treating or preventing the viral infection based on the evaluation of the risk of severe disease performed in the evaluation step (step (b)).

[0195] The treatment method or the prevention method can be appropriately selected according to the type of viral infection and the evaluation of the risk of severe disease in the evaluation step. As a treatment method or a prevention method, for example, administration of an antiviral agent can be mentioned.

[0196] For example, when the risk of developing severe symptoms is evaluated as high in the evaluation step, a disulfide bond cleaving enzyme may be administered to the test subject. Therefore, the method may include the step of administering a disulfide bond cleaving enzyme to the test subject evaluated as having a high risk of developing severe symptoms in the evaluation step. The disulfide bond cleaving enzyme administered to the test subject may be in the form of an antiviral agent according to the first embodiment or a pharmaceutical composition according to the second embodiment.

[0197] In one embodiment, the method may include a step of determining a subject to be administered an antiviral agent based on the evaluation of the risk of severe illness performed in the evaluation step (step (b)). For example, in one embodiment, the method may be a method for determining a subject to be administered an antiviral agent, comprising the following steps.

[0198] A step (A) of measuring the concentration of a protein having disulfide bond cleaving activity in a biological sample to be tested;

[0199] A step (B) of evaluating the risk of the test subject's viral infection becoming severe based on the concentration of the protein having disulfide bond cleaving activity; and

[0200] The step (C) is to determine the test subject determined to have a high risk of developing severe symptoms as a test subject to be administered an antiviral agent.

[0201] The step (A) is the same as the step (a). The step (B) is the same as the step (b). The antiviral agent determined to be administered in the step (c) can be appropriately selected according to the type of virus. As the antiviral agent, for example, the antiviral agent according to the first embodiment can be listed.

[0202] In one embodiment, the present disclosure provides a method for determining a biological sample derived from a test subject with a higher risk of developing severe symptoms of a viral infection, comprising: a step (A1) of determining the concentration of a protein with disulfide bond cleaving activity in the biological sample of the test subject; and a step (B1) of determining a biological sample in which the concentration of the protein with disulfide bond cleaving activity is lower than a baseline value as a biological sample derived from a test subject with a higher risk of developing severe symptoms of a viral infection.

[0203] The step (A1) is the same as the step (a). The reference value in the step (B1) is the same as that in the step (b). Examples of viral infections to which the method can be applied include the same viral infections as those described above.

[0204] In one embodiment, the present disclosure provides a marker for determining the risk of severe viral infection, comprising a protein having disulfide bond cleavage activity.

[0205] According to the evaluation method of this aspect, the risk of a viral infection becoming severe can be evaluated by a simple method of measuring the concentration of a disulfide bond cleaving enzyme in a biological sample of a test object.

[0206] [Other embodiments]

[0207] In one embodiment, the present disclosure provides a method for treating or preventing a viral infection, comprising administering to a subject at least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein.

[0208] In one embodiment, the present disclosure provides at least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein for treating or preventing a viral infection.

[0209] In one embodiment, the present disclosure provides use of at least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein in the manufacture of a pharmaceutical composition for treating or preventing a viral infection.

[0210] Examples of proteins having disulfide bond cleaving activity (disulfide bond cleaving enzymes) include the same proteins as those described above, and specific examples include PDI family proteins (PDI, ERp46, ERp57, ERp72, P5, etc.) Examples of viral infections include the same viral infections as those described above.

[0211] Example

[0212] Hereinafter, the present invention will be described by way of examples, but the present invention is not limited to the following examples.

[0213] <Evaluation of disulfide bond cleavage activity of PDI family proteins>

[0214] The disulfide bond cleavage test of the RBD of SARS-CoV-2 (system B) was performed using genetic recombinants of human PDI family proteins (PDI: SEQ ID NO: 4, ERp46: SEQ ID NO: 8, ERp57: SEQ ID NO: 12, ERp72: SEQ ID NO: 16, P5: SEQ ID NO: 20).

[0215] 0.5 μM of the recombinant genes of various PDI family proteins and 2.5 mM of reduced glutathione were added to the PBS buffer, and then left to stand at 37°C for 10 minutes. After 10 minutes, 2.5 μM of the RBD of SARS-CoV-2 was added, and the reaction was started at 37°C. The reaction solutions at 0 minutes, 1 minute, 5 minutes, 10 minutes, 30 minutes, 60 minutes, and 180 minutes from the start of the reaction were reacted with 4 mM maleimide-PEG 2k specifically attached to the thiol group and analyzed by 10% SDS-PAGE.

[0216] The results are as follows Figure 3 shown. Figure 3 The residual rate of native RBD is used to represent the disulfide bond cleavage activity. Figure 3 In the table, "-PDIs" means that no PDI family proteins were added to the reaction solution, and "+PDI", "+ERp57", "+ERp72", "+ERp46" and "+P5" respectively mean that the recorded PDI family proteins were added to the reaction solution. The tested PDI family proteins all showed the activity of cleaving the disulfide bonds of RBD. The disulfide bond cleavage activity of RBD is ranked in descending order as PDI, ERp46, P5, ERp72 and ERp57. Among them, the disulfide bond cleavage activity of PDI is significantly higher.

[0217] <Evaluation of the antiviral activity of PDI family proteins>

[0218] Airway organoids were used to evaluate the antiviral activity of PDI family proteins (PDI, ERp46). Airway organoids were prepared by a previously reported method (Emi Sano et al., Communications Biology volume 5, Article number: 516 (2022)). 24 hours after the airway organoids were inoculated in a 96-well plate, a culture medium containing PDI family proteins was allowed to act. Immediately thereafter, SARS-CoV-2 was infected (MOI = 0.1). The cell culture supernatant was recovered 48 hours after infection, and the amount of SARS-CoV-2 genome contained therein was quantified. The method for quantifying the amount of SARS-CoV-2 genome contained in the cell culture supernatant is as described below.

[0219] The cell culture supernatant was mixed with an equal amount of 2× RNA dissolution buffer (containing 0.4 U / μL SUPERaseInRnase inhibitor (manufactured by Thermo Fisher Scientific), 2 v / v% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4) and 40 v / v% glycerol in distilled water) and incubated at room temperature for 10 minutes. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Biotech Co., Ltd.) using the QuantStudio 1 Real-Time PCR System (manufactured by Thermo Fisher Scientific). The standard curve used SARS-CoV-2 RNA (10 5 The sequences of the primers used in RT-PCR are shown below.

[0220] Forward primer: AGCCTCTTCTCGTTCCTCATCAC (SEQ ID NO: 21)

[0221] Reverse primer: CCGCCATTGCCAGCCATTC (SEQ ID NO: 22)

[0222] The results are as follows Figure 4 shown. Figure 4 The antiviral effect is expressed in terms of the number of SARS-CoV-2 viral copies. Figure 4 In the table, "-PDIs" means that none of the PDI family proteins were added to the culture medium, and "+PDI" and "+ERp46" respectively mean that the recorded PDI family proteins were added to the culture medium. Both PDI and ERp46 inhibited SARS-CoV-2 infection in a concentration-dependent manner. These results confirm that PDI and ERp46 have high antiviral activity against SARS-CoV-2. PDI family proteins are believed to inhibit infection of host cells by hindering the binding of SARS-CoV-2 to ACE2 by cutting the disulfide bond of RBD.

[0223] <Evaluation of cytotoxicity of PDI>

[0224] To evaluate whether PDI is cytotoxic to human cells. After 24 hours of inoculation of airway organoids in 96-well plates, a medium containing PDI family proteins was allowed to act. After 48 hours of the PDI family proteins acting, cell activity was evaluated. Cell Counting Kit-8 (Cell Counting Kit) (Dojin Chemical Research Institute) was used to measure cell activity.

[0225] The results are as follows Figure 5 shown. Figure 5 The cytotoxic activity of PDI is expressed as cell viability. It was confirmed that PDI is not cytotoxic to human cells. Based on this result, the risk of side effects of PDI is considered to be low.

[0226] <Evaluation of disulfide bond cleavage activity of SARS-CoV-2 mutants>

[0227] The disulfide bond cleavage activity of PDI was evaluated using the same method as in the above-mentioned <Evaluation of disulfide bond cleavage activity of PDI family proteins>, except that the RBD of SARS-CoV-2 variants (Delta strain, Omicron strain) was used instead of the RBD of SARS-CoV-2 (B system).

[0228] The results in the RBD of the Delta strain are as follows Figure 6 As shown, the results in the RBD of the Omicron strain are as follows Figure 7 shown. Figure 6 and Figure 7 The residual rate of native RBD was used to represent the disulfide bond cleavage activity. Figure 6 and Figure 7 In the figure, "-PDI" means that PDI was not added to the reaction solution, and "+PDI" means that PDI was added to the reaction solution. PDI showed disulfide bond cleavage activity for both RBDs of Delta strain and Omicron strain. The disulfide bond cleavage activity was particularly high for the RBD of Omicron strain.

[0229] <Evaluation of the antiviral activity of PDI against SARS-CoV-2 variants>

[0230] The antiviral activity of PDI against SARS-CoV-2 variants (Delta strain, Omicron strain) was evaluated. After 24 hours of airway organoids being inoculated in a 96-well plate, a medium containing PDI was allowed to act. Immediately thereafter, the SARS-CoV-2 variant was infected (MOI = 0.1). The cell culture supernatant was recovered 48 hours after infection, and the amount of the genome of the SARS-CoV-2 variant contained therein was quantified. The SARS-CoV-2 variants used in this experiment were all isolated from COVID-19 patients. The sequence information of Delta strain B.1.617.2 (GISAID accession number: EPI_ISL_9636792) and Omicron strains B.1.1.529 and BA1 (EPI_ISL_9638489) is registered in GISAID.

[0231] Figure 8 The results of the evaluation of the antiviral activity of PDI against the Delta strain are shown. Fig. 9 The results of the evaluation of the antiviral activity of PDI against the Omicron strain are shown. PDI showed high antiviral activity against both the Delta strain and the Omicron strain. PDI family proteins change the three-dimensional structure of RBD by cutting the disulfide bond of RBD, thereby hindering the binding of SARS-CoV-2 to ACE2, and are therefore believed to maintain a high infection inhibition effect against mutant strains.

[0232] <Evaluation of disulfide bond cleavage activity of RDB of hCoV-229E>

[0233] The disulfide bond cleavage activity of PDI was evaluated by the same method as in the above-mentioned <Evaluation of disulfide bond cleavage activity of PDI family proteins>, except that the RBD of SARS-CoV-2 (system B) was used instead of the RBD of hCoV-229E.

[0234] The results are as follows Fig.10 shown. Fig.10 The residual rate of native RBD was used to represent the disulfide bond cleavage activity. Fig.10 In the table, "-PDIs" means that no PDI family proteins were added to the reaction solution, and "+PDI", "+ERp57", "+ERp72", "+ERp46" and "+P5" respectively indicate that the recorded PDI family proteins were added to the reaction solution. The PDI family proteins tested all showed the activity of cutting the disulfide bonds of the RBD of hCoV-229E. The disulfide bond cutting activity of the RBD of hCoV-229E was ranked in descending order as PDI, ERp46, P5, ERp75 and ERp72. Among them, the disulfide bond cutting activity of PDI was significantly higher.

[0235] Possibility of industrial application

[0236] According to the present invention, an antiviral agent that can maintain antiviral activity against mutant strains of the pathogenic virus of a viral infection and a pharmaceutical composition for treating or preventing a viral infection comprising the antiviral agent are provided. In addition, a kit for evaluating the risk of severe symptoms of a viral infection and a method for evaluating the risk of severe symptoms of a viral infection are also provided.

[0237] The preferred embodiments of the present invention have been described above, but the present invention is not limited to these embodiments. Additions, omissions, substitutions and other changes may be made to the configuration without departing from the gist of the present invention. The present invention is not limited by the foregoing description, but only by the scope of the appended claims.

Claims

1. An antiviral agent comprising: At least one selected from the group consisting of (a) a protein having disulfide bond cleaving activity and (b) a polynucleotide comprising a nucleotide sequence encoding the protein.

2. The antiviral agent according to claim 1, wherein The protein is a protein disulfide isomerase family protein.

3. The antiviral agent according to claim 2, wherein The protein disulfide isomerase family protein is at least one selected from the group consisting of PDI, ERp46, ERp57, ERp72 and P5.

4. The antiviral agent according to claim 3, wherein The protein disulfide isomerase family protein is at least one selected from the group consisting of PDI and ERp46.

5. The antiviral agent according to claim 1, wherein It is applicable to a virus having a disulfide bond in at least one protein selected from the group consisting of a spike protein, an envelope protein, and a capsid protein.

6. A pharmaceutical composition for treating or preventing viral infections, comprising: The antiviral agent according to any one of claims 1 to 5; and a pharmaceutically acceptable carrier.

7. A kit for evaluating the risk of severe viral infection, comprising: A substance that specifically binds to proteins that have disulfide bond cleavage activity.

8. A method for evaluating the risk of severe viral infection, comprising: A step of measuring the concentration of a protein having disulfide bond cleaving activity in a biological sample to be tested.

9. A determination method, comprising: A step of measuring the concentration of a protein having disulfide bond cleaving activity in a biological sample to be tested; A step of evaluating the risk of the test subject's viral infection becoming severe based on the concentration of the protein having disulfide bond cleavage activity; as well as The step of determining the test subject determined to have a high risk of developing severe symptoms as a test subject to be administered an antiviral agent.

Images