Monoclonal antibody for resisting abrus precatorius toxin and application of monoclonal antibody

Abstract

The invention discloses a monoclonal antibody against abrus precatorius toxin and application thereof, belongs to the field of biological medicine, and provides a monoclonal antibody against abrus precatorius toxin, which has at least 95%, at least 96%, at least 97%, at least 98% and at least 99% sequence identity with amino acid sequences shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, of heavy chain variable region complementarity determining regions CDR1, CDR2 and CDR3. The light chain variable region complementarity determining regions CDR1, CDR2 and CDR3 have at least 95%, at least 96%, at least 97%, at least 98% and at least 99% of amino acid sequences shown as SEQ ID NO: 9, 10 and 11. The invention further provides application of the antibody to preparation of an antibody for detecting and treating abrus precatorius toxin poisoning and having a long-time treatment effect and related products.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and particularly relates to a monoclonal antibody against abrinus toxin and application thereof. Background Art

[0002] Abrin, also known as chicken pearl toxin, is a highly toxic substance found in the abrin plant. Abrin, also known as chicken pearl, is a poisonous plant native to Guangdong, Guangxi, Yunnan and other places in China. Its seeds are brightly colored, with a striking combination of red and black. They are about the same size as mung beans and look like chicken eyes from a distance, hence the name "chicken pearl". Abrin is mainly found in the cotyledons of the seeds and is a toxic protein. This toxin can enter the body's cells, disrupt the production of proteins by the cells, and eventually lead to cell death. After accidentally ingesting abrin toxin protein, symptoms of poisoning may appear hours or even days after ingestion. The main manifestations are loss of appetite, nausea, vomiting, abdominal pain, diarrhea, difficulty breathing, cyanosis of the skin, circulatory system failure and oliguria, and finally hemolysis and hematuria, gradually presenting respiratory asphyxiation and death.

[0003] There are four isoabrins of abrin toxin, namely abrin-a, abrin-b, abrin-c, and abrin-d, with relative molecular masses ranging from 63 ku to 67 ku. They are encoded by different genes in the same gene family. Among them, abrin-b and abrin-c have only weak cytotoxic effects due to their low B chain agglutination activity; while abrin-a and abrin-d are extremely cytotoxic, with an LD50 of 0.04 μg / kg in mice and a lethal dose of 0.1 μg / kg to 1.0 μg / kg for adults. They have been listed as one of the potential important toxin warfare agents and bioterrorism pathogens. Summary of the invention

[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0005] The present invention provides a monoclonal antibody against Abrinus sibiricum toxin, the monoclonal antibody comprising heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 2, and 3, And light chain variable region complementarity determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 9, 10, and 11.

[0006] Furthermore, the amino acid sequences of the heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 are shown in SEQ ID NOs: 1, 2, and 3, respectively. The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 of the light chain variable region are shown in SEQ ID NOs: 9, 10 and 11, respectively.

[0007] Furthermore, the monoclonal antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequences shown in SEQ ID NOs: 4, 5, 6, and 7, And light chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequences shown in SEQ ID NOs: 12, 13, 14, and 15.

[0008] Furthermore, the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3, and FR4 are shown in SEQ ID NOs: 4, 5, 6, and 7, respectively. The amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3, and FR4 are shown in SEQ ID NOs: 12, 13, 14, and 15, respectively.

[0009] Further, the heavy chain variable region of the monoclonal antibody has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 8, The light chain variable region has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO:16.

[0010] Furthermore, the heavy chain variable region of the monoclonal antibody has the amino acid sequence shown in SEQ ID NO:8, and the light chain variable region has the amino acid sequence shown in SEQ ID NO:16.

[0011] Furthermore, the monoclonal antibody comprises a heavy chain constant region having an amino acid sequence as shown in SEQ ID NO: 17, 18, or 19.

[0012] In some embodiments, a monoclonal antibody (mAB) or antibody refers to an antibody molecule with a single molecular composition obtained from a group of substantially identical antibodies. An antibody comprises two heavy (H) chains and two light (L) chains. A mammalian heavy chain consists of a variable region (VH) and a first, second, third, and optionally fourth constant region (CH1, CH2, CH3, CH4, respectively); a mammalian light chain consists of a variable region (VL) and a constant region. The antibody is Y-shaped, wherein the stem of the Y consists of the second and third constant regions of two heavy chains bound together by disulfide bonds. Each arm of the Y includes the variable region and the first constant region of a single heavy chain combined with the variable region and constant region of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding. The variable regions in the two chains generally contain three highly variable loops, called complementarity determining regions (CDRs), the light chain CDRs include LCDR1, LCDR2, and LCDR3, and the heavy chain CDRs include HCDR1, HCDR2, and HCDR3. The variable regions of the light and heavy chains also include framework regions (FRs). The light chain FRs include LFR1, LFR2, LFR3, and LFR4, and the heavy chain FRs include HFR1, HFR2, HFR3, and HFR4. The constant regions of the heavy and light chains do not participate in antigen binding, but exhibit various effector functions. Antibodies are classified based on the amino acid sequence of the constant region of the antibody heavy chain.

[0013] In some embodiments, the monoclonal antibodies described in the present invention are non-fucosylated. In some embodiments, the fucosylation refers to the presence of fucose residues in the oligosaccharides attached to the peptide backbone of the antibody. Specifically, the fucosylated antibody contains α (1, 6) linked fucose at the innermost N-acetylglucosamine (GlcNAc) residue of one or both of the N-linked oligosaccharides attached to the Fc region of the antibody, such as position Asn 297 of the human IgG1 Fc domain (EU numbering of Fc region residues). Due to minor sequence variations in immunoglobulins, Asn297 can also be located about +3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300. Non-fucosylated or fucose-deficient antibodies include glycosylated antibody variants of the Fc region in which the carbohydrate structure attached to the Fc region has reduced fucose or lacks fucose.

[0014] In some embodiments, the monoclonal antibodies also include immunoglobulins and immunoglobulin fragments, whether natural or partially or completely synthetically (e.g., recombinantly) produced, any fragment that includes at least a portion of the variable region of an immunoglobulin molecule that retains the binding specificity of a full-length immunoglobulin. Thus, antibodies include any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin antigen binding domain (antibody combining site).

[0015] The present invention provides a method for detecting abrin in a sample, the method comprising contacting the above-mentioned monoclonal antibody with the sample to be tested to detect the level or presence of abrin in the sample to be tested.

[0016] Furthermore, the method is a method for non-diagnostic purposes.

[0017] The present invention provides the use of the above-mentioned monoclonal antibody in detecting Abrinus abrinus toxin.

[0018] Further, the application is for non-diagnostic purposes.

[0019] The present invention provides the use of the above-mentioned monoclonal antibody in preparing a product for detecting abrin toxin.

[0020] Furthermore, the products include probes, test strips, test kits, and chips.

[0021] The present invention provides the use of the above-mentioned monoclonal antibody in neutralizing Abrinus sibiricum toxin.

[0022] Furthermore, the application is for non-therapeutic and non-diagnostic purposes.

[0023] The present invention provides the use of the above-mentioned monoclonal antibody in preparing a pharmaceutical composition for neutralizing Abrinus sibiricum toxin.

[0024] The present invention provides the use of the above-mentioned monoclonal antibody in preparing a pharmaceutical composition for long-term treatment of abrin toxin.

[0025] In some embodiments, the half-life of the antibody of the present invention using a mutant Fc region is improved, the time it remains in the body or cells is increased, and it has a longer-lasting therapeutic effect.

[0026] The present invention provides any one of the following substances.

[0027] The present invention provides a nucleic acid encoding the monoclonal antibody described above.

[0028] Furthermore, the nucleotides encoding the heavy chain constant region of the monoclonal antibody are shown in SEQ ID NOs: 20 and 21.

[0029] The present invention provides a vector, which comprises the nucleic acid described above.

[0030] Furthermore, the vector also includes a transcription promoter, an enhancer, or a stabilizing sequence.

[0031] Furthermore, the vector also includes a tag sequence for positioning or purification.

[0032] In the present invention, a transcription promoter, enhancer, or stabilizing sequence allows selection and maintenance of transformed cells. In some cases, a replication origin can be used to increase the copy number of the vector in the cell. The vector can also include an additional nucleotide sequence that is operably connected to the nucleic acid molecule connected.

[0033] In some embodiments, the vector comprises a common plasmid vector or a viral vector. In more specific embodiments, the viral vector comprises a retrovirus, adenovirus, parvovirus (such as adeno-associated virus), coronavirus, negative-strand RNA virus (such as orthomyxovirus (such as influenza virus), rhabdovirus (such as rabies and vesicular stomatitis virus), paramyxovirus (such as measles and Sendai virus), positive-strand RNA virus (such as picornavirus and alphavirus) and double-stranded DNA virus, including adenovirus, herpes virus (such as herpes simplex virus type 1 and type 2 and Epstein-Barr virus and cytomegalovirus) and pox virus (such as cowpox, fowlpox and canarypox). Other viruses include but are not limited to Norwalk virus, togavirus, flavivirus, reovirus, papillomavirus , hepatitis virus and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma, mammalian C-type, B-type virus, D-type virus, HTLV-BLV group, lentivirus or foamy virus. As non-limiting examples, vectors that can be used in the present invention include but are not limited to pQE-12, pUC-series, pBluescript (Stratagene), pET-series expression vectors (Novagen) or pCRTOPO (Invitrogen), λgt11, pJOE, pBBR1-MCS series, pJB861, pBSMuL, pBC2, pUCPKS, pTACT1, pTRE, pCAL-n-EK, pESP-1, pOP13CAT, E-027 pCAGKosak-Cherry (L45a) vector system, pREP (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc / CMV, pcDNA1, pcDNA3 (Invitrogen), pcDNA3.1, pSPORT1 (GIBCO BRL), pGEMHE (Promega), pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (EdgeBiosystems) pTriEx-Hygro (Novagen), and pCINeo (Promega).

[0034] The present invention provides a cell, which comprises the aforementioned nucleic acid and / or the aforementioned vector.

[0035] Furthermore, the cell is a host cell, including animal cells, plant cells, fungal cells, and prokaryotic cells.

[0036] Furthermore, the animal cells include mammalian cells.

[0037] Furthermore, the mammal includes a human or a non-human mammal.

[0038] Furthermore, the non-human mammals include mice, rats, guinea pigs, dogs, monkeys, pigs, rabbits, cats, horses, cows, sheep, donkeys, and camels.

[0039] The host cells that can be used in the present invention include eukaryotic or prokaryotic cells such as mammalian cells (e.g., human, monkey, rabbit, rat, hamster or mouse cells), plant cells, yeast cells, insect cells and bacterial cells (e.g., Escherichia coli (E. coli)) that replicate and / or express polynucleotide vectors. Preferably, the vector for transforming the host cell includes at least one selectable marker operably linked to a suitable promoter so that the polynucleotide can be expressed in the host cell.

[0040] In some embodiments, the cell is suitable for receiving, maintaining, replicating and amplifying the vector. For example, Escherichia coli suitable for plasmids include but are not limited to DH5α, BL21DE3, BL21DE3pLysS, JM109, TOP10. The cell can actually be any cell available for the expression vector. Including prokaryotic cells and eukaryotic cells, the prokaryotic cells include but are not limited to true bacteria, such as Gram-negative or Gram-positive organisms, such as Enterobacteriaceae, such as Escherichia, such as Escherichia (DH5α, BL21DE3, BL21DE3pLysS, JM109, TOP10, HB101, SCS110, E.coli JM110); Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella, such as Salmonella typhimurium (Salmonella typhimurium); Serratia, such as Serratia marcescans; and Shigella, as well as Bacilli, such as B. subtilis and B. licheniformis; Pseudomonas, such as P. aeruginosa; and Streptomyces.

[0041] The present invention provides a derivative, wherein the derivative comprises the aforementioned monoclonal antibody or a detectable agent is linked thereto.

[0042] Furthermore, the detectable reagents include fluorescent dyes, radioactive labels, metal ions, enzymes, magnetic beads, and colorimetric labels.

[0043] In some embodiments, the detectable agent can be any substance with a detectable physical or chemical property. Such detectable agents are well developed in the field of immunoassays, and in general, most of any label useful in such methods can be applied to the provided methods. Thus, the label can be any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical methods. Detectable agents include, but are not limited to, fluorescent dyes (e.g., fluorescein isothiocyanate, Texas Red, rhodamine, etc.), radioactive labels (e.g., 3H, 125I, 35S, 14C or 32P), in particular, radioactive labels (e.g., 157Gd, 55Mn, 162Dy, 52Cr and 56Fe), metal ions (e.g., 111In, 97Ru, 67Ga, 68Ga, 72As, 89Zr and 201Tl), enzymes (e.g., horseradish peroxidase, alkaline phosphatase, and other enzymes commonly used in ELISA), electron transfer agents (e.g., including metal binding proteins and compounds), luminescent and chemiluminescent labels (e.g., luciferin and 2,3-dihydrophtahlazinediones, e.g., luminol), magnetic beads (e.g., DYNABEADSTM), and colorimetric labels, such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex).

[0044] The present invention provides a product comprising the monoclonal antibody described above.

[0045] Furthermore, the products include probes, test strips, test kits, and chips.

[0046] Furthermore, the kit includes a buffer, a blocking reagent, a washing reagent, an enzyme substrate, and / or a solid support.

[0047] The present invention uses the term "probe" to refer to a structure including a polynucleotide that contains a nucleic acid sequence complementary to a nucleic acid sequence present in a target nucleic acid analyte (e.g., a nucleic acid amplification product). The polynucleotide region of the probe can be composed of DNA and / or RNA and / or synthetic nucleotide analogs. The length of the probe is generally compatible with all or part of the target sequence for specific detection of a target nucleic acid.

[0048] The present invention uses the term "chip", also known as "array", to refer to a solid support comprising connected nucleic acid or peptide probes. The array typically comprises a plurality of different nucleic acid or peptide probes attached to the surface of a substrate at different known positions. These arrays, also known as "microarrays", can typically be produced using mechanical synthesis methods or light-guided synthesis methods that incorporate a combination of photolithography and solid phase synthesis methods. The array may comprise a flat surface, or may be a nucleic acid or peptide on a bead, gel, polymer surface, fiber such as an optical fiber, glass or any other suitable substrate. The array may be packaged in a manner that allows for diagnosis of a fully functional device or other manipulations.

[0049] The present invention provides a pharmaceutical composition, which comprises the above-mentioned monoclonal antibody, the above-mentioned nucleic acid, the above-mentioned vector, the above-mentioned cell, and the above-mentioned derivative.

[0050] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0051] In some embodiments, the excipients include but are not limited to water, buffers, saline solutions, phosphate buffered saline solutions, various types of wetting agents, sterile solutions, alcohols, gum arabic, vegetable oils, benzyl alcohol, gelatin, glycerin, carbohydrates (such as lactose, sucrose, amylose or starch), magnesium stearate, talc, silicic acid, viscous paraffin, aromatic oils, fatty acid monoglycerides and diglycerides, pentaerythritol fatty acid esters, hydroxymethylcellulose, powders, etc.

[0052] In some embodiments, the pharmaceutical composition may contain other additives, including, for example, antioxidants, preservatives, antimicrobial agents, analgesics, binders, disintegrants, colorants, diluents, excipients, bulking agents, glidants, solubilizers, stabilizers, tonicity agents, vehicles, thickeners, flavoring agents, emulsions (such as oil / water emulsions), emulsifying and suspending agents (such as gum arabic, agar, alginic acid, sodium alginate, bentonite, carbomer, carrageenan, carboxymethyl cellulose, cellulose, cholesterol, gelatin, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, octoxynol 9, oleyl alcohol, polyvinyl pyrrolidone, propylene glycol monostearate, sodium lauryl sulfate, sorbitan esters, stearyl alcohol, tragacanth gum, xanthan gum and its derivatives), solvents, and various ingredients, such as crystalline cellulose, microcrystalline cellulose, citric acid, dextrin, glucose, liquid glucose, lactic acid, lactose, magnesium chloride, potassium metaphosphate, starch.

[0053] In some embodiments, the pharmaceutical compositions use components that do not significantly destroy the biological properties of the antibody or antigen-binding fragment thereof, such as binding to its specific epitope, and each component is pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient.

[0054] In some embodiments, the dosage form of the pharmaceutical composition includes, but is not limited to, tablets, pills, powders, liquid solutions or suspensions (e.g., including injectable, absorbable and topical preparations (e.g., eye drops, gels or ointments), aerosols (e.g., nasal sprays), liposomes, suppositories, injectable and infusible solutions, and sustained-release forms.

[0055] The present invention provides a method for preparing the above-mentioned monoclonal antibody, which comprises the steps of culturing the above-mentioned cell and recovering the monoclonal antibody.

[0056] As used herein, "treatment" (and grammatical variations thereof) refers to clinical intervention that attempts to alter the natural course of the individual being treated, and may be performed for prevention or during the course of clinical pathology. The desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, weakening any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, ameliorating or alleviating the disease state, and eliminating or improving prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 It is the SDS-PAGE electrophoresis diagram of Ab, Ab-5 and Ab-6. Lane 1: Marker; Lane 2: Ab reduced electrophoresis band; Lane 3: Ab-5 reduced electrophoresis band; Lane 4: Ab-6 reduced electrophoresis band; Lane 5: Ab non-reduced electrophoresis band; Lane 6: Ab-5 non-reduced electrophoresis band; Lane 7: Ab-6 non-reduced electrophoresis band.

[0058] Figure 2 This is a graph showing the binding ability of Ab, Ab-5 and Ab-6 to antigen detected by ELISA.

[0059] Figure 3 This is a graph showing the neutralization effects of Ab, Ab-5 and Ab-6 antibodies at the cellular level.

[0060] Figure 4 The neutralization results of Ab, Ab-5 and Ab-6 antibodies in the mouse model, where A: survival curve of mice challenged with toxin; B~C: protective survival curves of the three antibodies in the LD100 of mice challenged with toxin. The antibody doses were 10μg / kg (B) and 1μg / kg (C) (n=5).

[0061] Figure 5 The pharmacokinetic (A) and pharmacodynamic (B) results of antibody HM in human FcRn transgenic mice, where A: the curve of antibody concentration change over time in transgenic mice, initially injected with 500 μg / mouse (n=5). B: On the 55th day after the injection of the antibody, a lethal dose of toxin (13 μg / kg) was injected into hFCRN mice, and the survival curves of each group of mice in the three antibody groups (N=5) were different. DETAILED DESCRIPTION

[0062] Example 1

[0063] 1. Experimental methods In the early stage of the experiment, the Fc region was modified by computer-aided design, and the gene sequences of two improved Fc region mutants Fc5 and Fc6 were obtained. The design introduced two enzyme cleavage sites NotI and PmeI at both ends of the target gene. These genes were synthesized by Azenta Life Science, and then the unmutated and mutated Fc regions were synthesized with the heavy chain variable region and light chain variable region genes, respectively, to obtain Ab antibodies with unmutated Fc and Ab-5 and Ab-6 antibodies with mutated Fc, which were then cloned into antibody expression vectors. The specific sequences are shown in Table 1.

[0064] Table 1

[0065] The nucleotide sequence of the Fc region mutant Fc5 is shown below: GAACCTAAATCCTCCGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCTACATCACCCGGGAGCCCGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGA (SEQ ID NO:20).

[0066] The nucleotide sequence of the Fc region mutant Fc6 is shown below: (SEQ ID NO: 21).

[0067] Thaw ExpiCHO-S™ cells and transfer them to a 125 mL shake flask filled with pre-warmed ExpiCHO™ Expression Medium in a 37°C, 8% CO2 incubator until the cell density reaches 4 × 10 6 ~6×10 6 mL -1 The cells were diluted to 0.2×10 6 ~0.3×10 6 mL -1 , continue incubation.

[0068] The day before transfection, the cell density was adjusted to 3 × 10 6On the day of transfection, the concentration was adjusted to 6 × 10 6 mL -1 Plasmid DNA (100 μg 100 -1 mL -1 ) and ExpiFectamine™ CHO Transfection Reagent (320 μL) were diluted in cold OptiPRO™ SFM medium. After 5 minutes of mixing and incubation at room temperature, the complex was slowly added to the cell suspension and mixed gently. 18-22 hours after transfection, ExpiFectamine™ CHO Enhancer (600 μL) and ExpiCHO™ Feed (24 mL) were added.

[0069] After 8 days of culture, antibody protein was harvested from the culture supernatant, initially purified using a HiTrap MabSelet Protein A column, eluted with 150 nM acetic acid on an Akta purification system, and stored in PBS. Antibody concentration was determined by BSA concentration assay, while preliminary characterization of the antibody was accomplished by SDS electrophoresis.

[0070] ELISA detection of antibody expression level: select ELISA plates with good adsorption performance, low blank value, and high transparency of the bottom of the well, use coating buffer (such as pH7.2-7.4 phosphate buffer) to dilute the antigen to an appropriate concentration (such as 2μg / ml), add a certain volume (such as 0.1ml) to each well, and coat at 4℃ overnight or 37℃ for 2 hours. After coating, block nonspecific binding sites with blocking solution (such as 5% BSA) to reduce background noise, add a certain volume (such as 0.25ml) to each well, and block at 37℃ for 1-2 hours. Add the diluted sample or standard to be tested, a certain volume (such as 0.1ml) to each well, and incubate at 37℃ for 1 hour. Wash 3 times with washing buffer (such as PBST) for 3 minutes each time to remove unbound samples. Add enzyme-labeled secondary antibody, a certain volume (such as 0.1ml) to each well, and incubate at 37℃ for 30-60 minutes. Wash again with washing buffer 3 times for 3 minutes each time to remove unbound enzyme-labeled antibodies. Add enzyme substrate (such as TMB) to each well at a certain volume (such as 0.1 ml) and incubate at 37°C for 10-30 minutes. Add stop solution (such as 2M sulfuric acid) to each well at a certain volume (such as 0.05 ml) to terminate the enzyme reaction. Use an ELISA reader to measure the absorbance (OD value) of each well at a wavelength of 450 nm and calculate the concentration of the antibody in the sample based on the standard curve.

[0071] 2. Experimental results SDS-PAGE results are as follows Figure 1 As shown, the results showed that the antibody purity was excellent.

[0072] The affinity of antibodies Abs to solid-coated antigens was determined by indirect ELISA at an initial concentration of 20 μg / mL and a 3-fold dilution. Figure 2 As shown, antibodies Abs can specifically recognize antigens, this binding is dose-dependent, and the mutant antibodies also have good binding activity.

[0073] Example 2 Verification of the therapeutic function of Ab antibody, Ab-5 antibody, and Ab-6 antibody 1. Antibody neutralization experiment at the cell level Jurkat cells were selected as the cell model for the in vitro neutralization protection experiment of identifying antibodies. The toxin attack concentration was set to 1 ng / mL, and the antibody to be tested was gradiently diluted with 1640 medium (starting from 50 μg / mL, 5-fold dilution); the diluted antibody sample and toxin were added to the cell wells at the same time, 25 μL / well each; a cell positive control without toxin and a blank medium control without cells were set. After incubation in a constant temperature incubator for 48 hours, the cell viability was detected using a CCK-8 kit.

[0074] The addition of antibodies can effectively curb the killing effect of toxins on cells, and the mutant antibodies neutralize toxins and thus inhibit their eukaryotic cell killing function with the same effect. Figure 3 shown.

[0075] 2. Mouse toxin neutralization experiment In order to further verify the neutralizing effect of antibodies on toxins, 16-18g human mice (8 weeks old) were selected for toxin attack dose test. The toxin stored in the laboratory was diluted to a series of concentrations, and 100μL of toxin was injected intraperitoneally into each mouse. The survival status and mortality of the mice were then observed. The survival curve of the mice is shown in Figure 4 A: As shown, a dose of 20 μg / kg can be set as the lethal dose (LD100) of the toxin in the mouse model.

[0076] The neutralizing activity of the antibody was verified in mice by toxin challenge test. Different concentrations of antibody (10 μg / kg -1 , 1 μg / kg and 100 μL of toxin LD100 were intraperitoneally injected into mice. The PBS+toxin group was used as the control group to observe the survival of the poisoned mice. Figure 4 As shown in BC, all mice in the high-concentration 10 μg / kg group survived, while only about 50% of the mice in the low-concentration 1 μg / kg antibody group were protected, reflecting the dose-dependent protective effect of the antibody in vivo.

[0077] 3. Pharmacokinetic and pharmacodynamic studies in mice In human FcRn transgenic mice, 500 μg of antibody was injected into the mice on day 1, and the antibody concentration in the serum was measured at different time points by sandwich ELISA. Figure 5 As shown in A, the half-life of Ab-5 and Ab-6 is longer than that of the parent antibody. On day 55 after injection, a lethal dose of toxin was injected intraperitoneally into mice. Figure 5 As shown in B, both Ab-5 and Ab-6 can effectively protect mice from death, while all mice in the Ab group died within 72 hours, and all mice in the control group that were not vaccinated with antibodies died within 48 hours. The results show that Ab-5 and Ab-6 can effectively prolong the retention time in the body under the same initial conditions, thereby shortening the medication interval.

Claims

1. A monoclonal antibody against Abrinus sibiricum toxin, comprising heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequences shown in SEQ ID NOs: 1, 2, and 3, And light chain variable region complementarity determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 9, 10, and 11.

2. The monoclonal antibody according to claim 1, wherein the amino acid sequences of the heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 are as shown in SEQ ID NOs: 1, 2, and 3, respectively. The amino acid sequences of the complementary determining regions CDR1, CDR2, and CDR3 of the light chain variable region are shown in SEQ ID NOs: 9, 10, and 11, respectively; Preferably, the monoclonal antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3, FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequences shown in SEQ ID NO: 4, 5, 6, 7, and light chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequences shown in SEQ ID NOs: 12, 13, 14, and 15; Preferably, the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3, and FR4 are as shown in SEQ ID NOs: 4, 5, 6, and 7, respectively. The amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3, and FR4 are shown in SEQ ID NOs: 12, 13, 14, and 15, respectively; Preferably, the heavy chain variable region of the monoclonal antibody has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence shown in SEQ ID NO: 8, The light chain variable region has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence shown in SEQ ID NO: 16; Preferably, the heavy chain variable region of the monoclonal antibody has the amino acid sequence shown in SEQ ID NO: 8, and the light chain variable region has the amino acid sequence shown in SEQ ID NO: 16; Preferably, the monoclonal antibody comprises a heavy chain constant region having an amino acid sequence as shown in SEQ ID NO: 17, 18, or 19.

3. A method for detecting abrin in a sample, the method comprising contacting the monoclonal antibody according to claim 1 or 2 with the sample to be tested, and detecting the level or presence of abrin in the sample to be tested; Preferably, the method is a method for non-diagnostic purposes.

4. Use of the monoclonal antibody according to claim 1 or 2 in detecting Abrinus abrinus toxin; Preferably, the use is for non-diagnostic purposes.

5. Use of the monoclonal antibody according to claim 1 or 2 in the preparation of a product for detecting abrin toxin; Preferably, the products include probes, test strips, test kits, and chips.

6. Use of the monoclonal antibody according to claim 1 or 2 in neutralizing abrin toxin; Preferably, the use is for non-therapeutic and non-diagnostic purposes.

7. Use of the monoclonal antibody according to claim 1 or 2 in the preparation of a pharmaceutical composition for neutralizing Abrinus scabra toxin.

8. Use of the monoclonal antibody according to claim 1 or 2 in the preparation of a pharmaceutical composition for long-term treatment of abrin toxin.

9. Any of the following substances: 1) a nucleic acid encoding the monoclonal antibody according to claim 1 or 2; Preferably, the nucleotides encoding the heavy chain constant region of the monoclonal antibody are shown in SEQ ID NOs: 20 and 21; 2) A vector, the vector comprising the nucleic acid described in claim 9 1); Preferably, the vector further comprises a transcription promoter, an enhancer, or a stabilizing sequence; Preferably, the vector further comprises a tag sequence for localization or purification; 3) A cell, comprising the nucleic acid described in claim 9 1) and / or the vector described in claim 9 2); Preferably, the cell is a host cell, including animal cells, plant cells, fungal cells, and prokaryotic cells; Preferably, the animal cells include mammalian cells; Preferably, the mammal comprises a human or a non-human mammal; Preferably, the non-human mammals include mice, rats, guinea pigs, dogs, monkeys, pigs, rabbits, cats, horses, cows, sheep, donkeys, and camels; 4) A derivative, comprising the monoclonal antibody according to claim 1 or 2 or a detectable agent connected thereto; Preferably, the detectable agent comprises a fluorescent dye, a radioactive label, a metal ion, an enzyme, a magnetic bead, or a colorimetric label; 5) A product comprising the monoclonal antibody according to claim 1 or 2; Preferably, the product includes a probe, a test paper, a test kit, and a chip; Preferably, the kit comprises a buffer, a blocking reagent, a washing reagent, an enzyme substrate, and / or a solid support; 6) A pharmaceutical composition, comprising the monoclonal antibody according to claim 1 or 2, the nucleic acid according to claim 9 1), the vector according to claim 9 2), the cell according to claim 9 3), and the derivative according to claim 9 4).

10. A method for preparing the monoclonal antibody according to claim 1 or 2, the method comprising the steps of culturing the cell according to claim 9 (3) and recovering the monoclonal antibody.

Images