Application of ZmMETTL3 gene and related biological materials thereof in regulation and control of plant drought resistance

Abstract

The invention discloses an application of a ZmMETTL3 gene and a related biological material thereof in regulation and control of plant drought resistance, and belongs to the technical field of gene engineering. Researches find that the ZmMETTL3 gene can negatively regulate the drought resistance of a corn plant, and after the ZmMETTL3 gene is knocked out, the drought resistance of the corn plant can be enhanced. According to the invention, the gene is knocked out by using a CRISPR / Cas9 gene editing technology, three ZmMETTL3 gene knockout mutants are obtained, an epigenetic gene resource is provided for improvement of the drought resistance of corn, and a new biological resource is provided for breeding of a new drought-resistant variety of corn.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of ZmMETTL3 gene and related biological materials in regulating plant drought resistance. Background Art

[0002] Corn is an important food crop, as well as an important economic, feed and energy crop. However, due to the uneven terrain and precipitation in my country, corn often suffers from various abiotic stresses during its growth and development, resulting in a significant decrease in corn yield. Among abiotic stresses, drought stress has become one of the important factors restricting the increase in corn yield. Therefore, exploring corn drought-resistant genes and cultivating new corn varieties that are drought-resistant and high-yield are of great significance to ensuring food security.

[0003] N6-methyladenosine (m 6 Methyl A) refers to the modification of the sixth N element of the A base of RNA molecules with a methyl group, which plays an important role in regulating the diversity of genetic information in eukaryotic organisms. Studies have shown that m 6 Modification of A can affect plant embryonic development, leaf and flower organ growth, apical dominance and callus differentiation, and is also involved in processes such as fruit ripening and plant response to abiotic stress.

[0004] m in RNA 6 A modification is usually a dynamic and reversible process, which is mainly regulated by three types of proteins: methyltransferases (writers), demethyltransferases (erasers) and methyl recognition proteins (readers). Methyltransferases can add the methyl group (CH3) of S-adenosylmethionine (SAM) to the sixth nitrogen atom of the RNA adenine nucleotide, while demethyltransferases can reduce the methyl group (CH3) on RNA to H atoms. 6 A methyltransferase is considered to be a macromolecular complex composed of multiple proteins and was isolated and purified from human HeLa cells in 1994. In subsequent studies, researchers used a variety of methods to separate MT-A and MT-B, of which MT-A has a molecular weight of about 200 kDa and can bind to SAM. 6Other components of the RNA methyltransferase complex have also been identified, such as METTL3, METTL14, and WTAP. The functional protein of METTL3 is MT-A, which can bind to SAM and catalyze RNA methylation. It is the core component of RNA methyltransferase. METTL14 and METTL3 are highly homologous, and its functional protein is MT-B, which can interact with MT-A through hydrogen bonds to form a stable heterodimer, thereby increasing the catalytic activity of MT-A. Unlike METTL3 and METTL14, WTAP cannot directly participate in catalysis, but can help the METTL3 / METTL14 complex locate to nuclear spots, thereby regulating RNA m 6 A methylation process.

[0005] Research on RNA methyltransferases in plants has only gradually emerged in the past 10 years, and there is little research on their functions in crop response to abiotic stress. Therefore, conducting research on the involvement of RNA methyltransferase-related genes in drought stress response in corn is of great significance for the improvement of corn drought-resistant germplasm resources. Summary of the invention

[0006] The purpose of the present invention is to provide the application of ZmMETTL3 gene and its related biological materials in regulating plant drought resistance, so as to solve the problems existing in the above-mentioned prior art. The present invention has found that ZmMETTL3 gene can negatively regulate the drought resistance of corn plants, and after knocking out ZmMETTL3 gene, the drought resistance of corn plants can be enhanced. The present invention also uses CRISPR / Cas9 gene editing technology to knock out the gene, and obtains three ZmMETTL3 gene knockout mutants, which provides an epigenetic gene resource for improving the drought resistance of corn, and provides a new biological resource for the breeding of new drought-resistant corn varieties.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides application of a ZmMETTL3 gene or related biological materials in regulating plant drought resistance, wherein the Gramene ID of the ZmMETTL3 gene is Zm00001d017566; the regulation means that after knocking out or inhibiting the ZmMETTL3 gene, the drought resistance of the plant can be enhanced.

[0009] Optionally, the relevant biological material includes any one of the following:

[0010] A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene;

[0011] A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene;

[0012] A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene;

[0013] A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6;

[0014] The plants include corn.

[0015] The present invention also provides the use of the ZmMETTL3 gene or related biological materials in cultivating plant varieties with high drought resistance. The Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

[0016] Optionally, the relevant biological material includes any one of the following:

[0017] A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene;

[0018] A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene;

[0019] A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene;

[0020] A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6;

[0021] The plants include corn.

[0022] The present invention also provides the use of the ZmMETTL3 gene or related biological materials in early identification of plant varieties with high drought resistance. The Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

[0023] Optionally, the relevant biological material includes any one of the following:

[0024] A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene;

[0025] A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene;

[0026] A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene;

[0027] A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6;

[0028] The plants include corn.

[0029] The present invention also provides a method for enhancing plant drought resistance, comprising the steps of knocking out the ZmMETTL3 gene in the plant, constructing a ZmMETTL3 gene knockout mutant plant, and enhancing the plant drought resistance;

[0030] The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; and the plant includes corn.

[0031] The present invention also provides a ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NOs. 4-6.

[0032] The present invention also provides a method for constructing the above-mentioned ZmMETTL3 gene knockout mutant, comprising the steps of taking the sequence shown in SEQ ID NO.1 as a target, constructing a CRISPR / Cas9 knockout vector, knocking out the ZmMETTL3 gene in the plant body through genetic transformation technology, and obtaining the ZmMETTL3 gene knockout mutant.

[0033] The present invention discloses the following technical effects:

[0034] The present invention reveals that the ZmMETTL3 gene can negatively regulate the drought resistance of corn plants. Knocking out the corn ZmMETTL3 gene will lead to enhanced drought resistance of corn plants. The present invention further uses CRISPR / Cas9 gene editing technology to knock out specific targets of the ZmMETTL3 gene, and obtains three ZmMETTL3 gene knockout mutants. By comparing the gene knockout mutants and KN5585 wild-type plants, it is found that the ZmMETTL3 gene knockout mutant can actively respond to drought stress. After drought treatment, the single ear weight and ear grain weight of the mutant plants are significantly higher than those of the wild type, showing superior drought resistance. The present invention studies the regulatory effect of the ZmMETTL3 gene on corn drought resistance, provides an epigenetic gene resource for improving corn drought resistance, and the ZmMETTL3 gene knockout mutant provides a new biological resource for the breeding of new corn drought-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1 The structure of the ZmMETTL3 gene and the structure of the ZmMETTL3 gene knockout mutant;

[0037] Figure 2 The figures are the drought resistance test results of ZmMETTL3 mutant plants; WW refers to the drought control group and WS refers to the drought treatment group; A is the ear phenotype picture of the wild type and ZmMETTL3 mutant before and after drought stress; B is the statistical analysis result of single ear weight of the wild type and ZmMETTL3 mutant drought control group; C is the statistical analysis result of single ear weight of the wild type and ZmMETTL3 mutant drought treatment group; D is the statistical analysis result of grain weight of the wild type and ZmMETTL3 mutant drought control group; E is the statistical analysis result of grain weight of the wild type and ZmMETTL3 mutant drought treatment group. DETAILED DESCRIPTION

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0040] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0041] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0042] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0043] The materials or reagents involved in the embodiments of the present invention can be purchased through conventional channels unless otherwise specified.

[0044] Example 1 Preparation and detection of ZmMETTL3 gene knockout mutants

[0045] The ZmMETTL3 gene knockout strain was obtained by CRISPR / Cas9 gene editing technology. The specific process is as follows:

[0046] The ZmMETTL3 gene contains a core member of a methyltransferase, MT-A70. The ZmMETTL3 gene sequence was downloaded from the maizegdb official website (Gramene ID is Zm00001d017566), and the sgRNA target was designed before MT-A70 of the gene, and the target sequence was CTGCAGCAGTCGGATATGTGGGG (SEQ ID NO.1). The expression cassette with the target was connected to the CRISPR / Cas9 knockout vector and transferred into Agrobacterium EHA105. The young embryos of wild-type maize KN5585 were transformed by Agrobacterium-mediated transformation, and BASTA was used as a screening resistance. The ZmMETTL3 gene sequence of the offspring plants was sequenced to confirm that the ZmMETTL3 gene in vivo was successfully knocked out, and the T0 generation material was cultured and obtained.

[0047] The T0 generation mutant seeds were planted in the field, and the DNA of the leaves was extracted using the CTAB method. The DNA was used as a template to detect the editing of the ZmMETTL3 gene. The identification primers located upstream and downstream of the ZmMETTL3 gene target were designed, and their sequences were ZmMETTL3-1F: TGGGGGCAAGCAGATGACTA (SEQ ID NO.2) and ZmMETTL3-1R: CTGTAGGCCGGTGAATGAGA (SEQ ID NO.3), respectively. The reaction system for PCR amplification was: 2×Rapid taq Master PCRmix 12.5μL, 0.5μL of upstream and downstream primers, 1μL of DNA template, and 10.5μL of double distilled water was added to make up to 25μL. The amplification program was: 95℃ pre-denaturation for 2min; 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 10s, a total of 39 cycles; 72℃ incubation for 5min. The amplified PCR products were detected by 1.5% agarose gel electrophoresis and sent to Shanghai Bioengineering for sequencing.

[0048] The sequencing results of the mutant and wild type (KN5585 strain) were compared, and three homozygous mutant materials were successfully identified, namely ZmMETTL3 KO#1 、ZmMETTL3 KO#2 and ZmMETTL3 KO#3 The structures of the three gene mutants are as follows Figure 1 As shown, ZmMETTL3 KO#1There is a 6-bp deletion at the target site, resulting in the deletion of 2 amino acid residues in the protein sequence. KO#2 There is a 42-bp deletion at the target site, resulting in the deletion of 14 amino acid residues in the protein sequence. KO#3 There is a 57 bp base deletion at the target site, resulting in the deletion of 19 amino acid residues in the protein sequence.

[0049] ZmMETTL3 KO#1 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows, wherein 6 bases are deleted between the two double underlined bases:

[0050]

[0051]

[0052]

[0053] ZmMETTL3 KO#2 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows, wherein 42 bases are deleted between the two double underlined bases:

[0054]

[0055]

[0056]

[0057]

[0058] ZmMETTL3 KO#3 The nucleotide sequence of the ZmMETTL3 gene mutant in the mutant material is as follows, wherein a total of 57 bases are deleted between the two double underlined bases, wherein 22 bp are deleted on the left side of the dotted line CAT, and 35 bp are deleted on the right side:

[0059]

[0060]

[0061]

[0062] Example 2 Identification of drought resistance of ZmMETTL3 gene knockout mutants

[0063] The drought resistance of the knockout mutant and wild type KN5585 was identified in the adult stage. The specific process is as follows:

[0064] The ZmMETTL3 mutant material was planted in the field and artificial greenhouse as a drought control group (WW) and a drought treatment group (WS), and the wild-type KN5585 corn was used as a control. Before the jointing stage of corn, the drought control group and the drought treatment group were managed in the normal seedling stage. When the corn grew to the jointing stage, the drought treatment group stopped watering. The drought control group and the treatment group corn were pollinated naturally. After the grains matured, the single ear weight and grain weight of the corn ears were counted, and finally the statistical results were analyzed. The results are shown in Figure 2 As shown, the mutant ZmMETTL3 KO#1 and ZmMETTL3 KO#2 The ear weight and grain weight of Figure 2 A, B and D, P < 0.05), while the ear weight and grain weight of the three ZmMETTL3 mutants in the drought treatment group were significantly higher than those of the wild type ( Figure 2 The above results show that the root growth ability of the ZmMETTL3 mutant strain is better than that of the wild type after drought stress, and its yield is significantly higher than that of the wild type (P<0.05), indicating that inhibiting the ZmMETTL3 gene can significantly improve the resistance of maize to drought stress.

[0065] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

[0066] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of ZmMETTL3 gene or its related biological materials in regulating plant drought resistance, characterized in that: The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; the regulation means that after knocking out or inhibiting the ZmMETTL3 gene, the drought resistance of the plant can be enhanced.

2. The use according to claim 1, characterized in that: The relevant biological material includes any one of the following: A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene; A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene; A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene; A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6; The plants include corn.

3. Application of ZmMETTL3 gene or its related biological materials in breeding plant varieties with high drought resistance, characterized in that: The Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

4. The use according to claim 3, characterized in that: The relevant biological material includes any one of the following: A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene; A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene; A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene; A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6; The plants include corn.

5. Application of ZmMETTL3 gene or its related biological materials in early identification of plant varieties with high drought resistance, characterized in that: The Gramene ID of the ZmMETTL3 gene is Zm00001d017566.

6. The use according to claim 5, characterized in that: The relevant biological material includes any one of the following: A1. An expression cassette for knocking out or inhibiting the ZmMETTL3 gene; A2. A recombinant vector having the function of knocking out or inhibiting the ZmMETTL3 gene; A3. A recombinant microorganism capable of knocking out or inhibiting the ZmMETTL3 gene; A4.ZmMETTL3 gene knockout mutant, whose nucleotide sequence is shown in any one of SEQ ID NO.4-6; The plants include corn.

7. A method for enhancing drought resistance of plants, characterized in that: The method comprises the steps of knocking out the ZmMETTL3 gene in the plant and constructing a ZmMETTL3 gene knockout mutant plant to enhance the drought resistance of the plant; The Gramene ID of the ZmMETTL3 gene is Zm00001d017566; and the plant includes corn.

8. A ZmMETTL3 gene knockout mutant, characterized in that: Its nucleotide sequence is shown in any one of SEQ ID NO.4-6.

9. The method for constructing the ZmMETTL3 gene knockout mutant according to claim 8, characterized in that: The method comprises the steps of taking the sequence shown in SEQID NO.1 as a target, constructing a CRISPR / Cas9 knockout vector, knocking out the ZmMETTL3 gene in the plant through genetic transformation technology, and obtaining the ZmMETTL3 gene knockout mutant.

Images