A primer of STON1 gene molecular marker related to the trait of chicken double-yolk eggs and its application

Abstract

The present invention relates to a STON1 gene molecular marker primer related to the trait of chicken double-yolk eggs and its application, belonging to the field of biotechnology. The molecular marker of the STON1 gene of the present invention is the base at position 7,867,409 on chromosome 3 of the chicken reference genome GRCg7b version, with the base mutation being A or G, and the genotypes being A / A, A / G, and G / G. The proportion of double-yolk eggs in chickens with the G / G genotype is higher than that in individuals with the A / G and A / A genotypes, and the proportion of double-yolk eggs in chickens with the A / G genotype is higher than that in individuals with the A / A genotype. The present invention uses forward and reverse primer pairs to amplify the fragment containing the above molecular marker site, and performs Sanger sequencing on the amplification product to quickly and accurately identify the genotype of an individual as a genetic marker for chicken breeding, and select chickens with a higher proportion of double-yolk eggs; it can efficiently and accurately detect the trait of double-yolk eggs, improve the breeding accuracy and breeding efficiency of the proportion of chicken double-yolk eggs, and has important value for chicken breeding and production.

Description

Technical Field

[0001] The present invention relates to an STON1 gene molecular marker primer related to the trait of double-yolk eggs in chickens and its application, belonging to the field of biotechnology. Background Art

[0002] The quality of eggs not only directly affects the hatching success rate, but is also crucial for the smooth progress of breeding work. Double-yolk eggs refer to eggs containing two egg yolks within one eggshell, which are usually much larger than ordinary eggs, and contain more than a dozen times more lecithin, amino acids, and free fatty acids than ordinary eggs. However, the yield of double-yolk eggs is not high and it is difficult to produce them on a large scale, so it is difficult to form an industrial chain to meet the market demand for diversified double-yolk egg products. Double-yolk eggs commonly occur in poultry production, with an incidence rate of 4% - 12.5% during the first 3 months of egg production in breeding hens and 1.1% - 3.5% in laying hens. Therefore, it is necessary to find suitable molecular markers to quickly and accurately identify the trait of double-yolk eggs in chickens for breeding individuals with a high double-yolk egg production rate to meet the market demand for diversified double-yolk egg products.

[0003] Marker-Assisted Selection (MAS) is a genetic improvement technology that enhances traditional selection methods through molecular markers. Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide on the genome, which can be stably inherited to offspring during the transmission of genetic material. SNPs can be applied to MAS technology to help breeders precisely select individuals with desired traits before the trait manifestation, thereby achieving the purposes of early selection, improving the selection efficiency, reducing the feeding cost, and enhancing the selection accuracy. Research has found that due to the high expression level of the STON1 gene leading to hyperandrogenism and obesity, the expression level of the STON1 gene is elevated in women with polycystic ovary syndrome. Compared with normal-sized mice, a higher expression level of the STON1 gene has been found in the ovaries and adipocytes of obese mice, and obesity is one of the reasons for the decline in reproductive performance. These studies have all revealed a close relationship between the STON1 gene and reproduction, but there is no report in chickens. Summary of the Invention

[0004] The object of the present invention is to study the relationship between the STON1 gene and the trait of double-yolk eggs in view of the defects existing in the prior art, and to propose an STON1 gene molecular marker primer related to the trait of double-yolk eggs in chickens and its application to quickly detect and screen chickens with a high proportion of double-yolk eggs.

[0005] The present invention measures the trait of the double-yolk egg proportion in chickens, uses the second-generation sequencing technology for whole-genome SNP genotyping, and screens out the STON1 gene molecular markers significantly related to the trait of double-yolk eggs through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of the trait of double-yolk eggs.

[0006] The present invention solves the technical problems through the following technical solutions: First, a molecular marker primer of STON1 gene related to the double-yolk egg ratio is provided. The nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2. The molecular marker is located at the 7,867,409th base on chromosome 3 of the chicken reference genome GRCg7b version, and the base mutation is A or G. It is the 109th base of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

[0007] The present invention further provides the application of the above molecular marker primer for detecting the SNP genotype related to the double-yolk egg ratio. The detection method includes the following steps.

[0008] First step: Provide a DNA sample of the chicken to be tested, and perform PCR amplification with the molecular marker primer pair to obtain an amplification product. The length of the amplification product is 538 bp, and it contains the 7,867,409th base on chicken chromosome 3.

[0009] Second step: Perform Sanger sequencing on the PCR product.

[0010] Third step: Determine the SNP molecular marker genotype of the 7,867,409th base on chicken chromosome 3 according to the sequencing result of the second step.

[0011] Among them, the deoxyribonucleotide sequence of the molecular marker primer pair in the first step is:

[0012] Upstream primer: 5’-CCACTGCACTTGCTCAACAT-3’ (SEQID NO:1)

[0013] Downstream primer: 5’-CATCCAGCTGAATCAAAGCA-3’ (SEQID NO:2)

[0014] Calculated based on the final concentration of the reaction system of 25 μl,

[0015] DNA of the chicken to be tested 50 ng,

[0016] 2 x Accurate Taq Master Mix 12.5 μl,

[0017] Upstream primer 1 μl,

[0018] Downstream primer 1 μl,

[0019] Sterilized water is supplemented to 25 μl.

[0020] The reaction conditions for the PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; storage at 4°C; the nucleotide sequence of the amplification product was as shown in SEQ ID NO: 3 or SEQ ID NO: 4, the length of the amplification product was 538 bp, and it contained the base at position 7,867,409 on chicken chromosome 3.

[0021] In the third step, the judgment criterion was that the proportion of double-yolk eggs in chickens with the G / G genotype at the SNP locus was higher than that in individuals with the A / G and A / A genotypes, and the proportion of double-yolk eggs in chickens with the A / G genotype was higher than that in individuals with the A / A genotype.

[0022] The present invention detected the genotype of the double-yolk egg trait through the STON1 gene molecular marker, and obtained that the proportion of double-yolk eggs in individuals with the G / G genotype was higher than that in individuals with the A / G genotype and the A / A genotype, and the proportion of double-yolk eggs in individuals with the A / G genotype was higher than that in individuals with the A / A genotype. Using the genomic DNA of the chicken to be tested as a template, specific primers were used for PCR amplification, and then the PCR amplification product was subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, the selection of the double-yolk egg trait in chickens can be achieved. In breeding, according to the breeding goal, individuals with the A / G and A / A genotypes can be eliminated, and individuals with the G / G genotype can be retained. The beneficial effect is that this molecular marker can be used as a genetic marker for chicken breeding to breed chickens with a high proportion of double-yolk eggs; it can efficiently and quickly identify the double-yolk egg trait in chickens, providing a scientific basis for the early selection of chickens, and having important value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a Manhattan plot of the genome-wide association analysis of the double-yolk egg trait after onset of lay.

[0024] Figure 2 is the Sanger sequencing result of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The following examples are applicable to chicken breeding, and the chicken breeds cited are not limited to the following examples.

[0026] Example 1

[0027] In this example, the phenotypic traits of double-yolk eggs after onset of lay in Recessive White Rock chickens were measured. The second-generation sequencing technology was used for genome-wide SNP genotyping, and the STON1 gene molecular marker significantly related to the proportion of double-yolk eggs was screened through genome-wide association analysis. The results were as Figure 1 shown.

[0028] In this example, the following experiment was conducted to identify and apply the STON1 gene molecular marker related to the double yolk egg trait of chickens.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and phenotypic determination of 36-week-old double-yolk eggs

[0031] A total of 2301 recessive White Rock chickens were selected and raised under the same feeding conditions with free access to feed and water throughout the whole process. The number and type of eggs laid by each chicken were recorded after the start of laying. At 36 weeks of age, the proportion of double-yolk eggs of each chicken was calculated as the phenotypic data of double-yolk eggs.

[0032] (2) Extraction of genomic DNA

[0033] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0034] (3) PCR amplification

[0035] Using the genomic DNA extracted as above as a template, a fragment containing the site at base position 7867409 on chromosome 3 was amplified.

[0036] Upstream primer: 5'-CCACTGCACTTGCTCAACAT-3' (SEQ ID NO: 1)

[0037] Downstream primer: 5'-CATCCAGCTGAATCAAAGCA-3' (SEQ ID NO: 2)

[0038] The final concentration of the reaction system is 25 μl.

[0039] DNA to be tested 50 ng,

[0040] 2 x Accurate Taq Master Mix 12.5 μl,

[0041] Upstream primer 1 μl,

[0042] Downstream primer 1 μl,

[0043] Add sterile water to 25 μl.

[0044] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; storage at 4°C; 10 μl was taken for agarose detection, and the amplified product with a single target band length of 538 bp was obtained, and it contained the SNP molecular marker at the 7867409th base site on chicken chromosome 3. The sequence of the amplified product is as follows:

[0045] SEQ ID NO:3

[0046] CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAAAGGCACAAAAGGATTCAGGCGAAAAAGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTGAGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTCAGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG

[0047] SEQ ID NO:4

[0048] CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAGAGGCACAAAAGGATTCAGGCGAAAAAGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTGAGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTCAGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG

[0049] (4)Sanger sequencing and genotyping

[0050] The PCR products of each sample were subjected to Sanger sequencing, and the obtained sequencing peak maps of different genotypes are as Figure 2 shown.

[0051] 2. Correlation analysis

[0052] A total of 2,301 recessive white Rock hens at 36 weeks of age with clear records of double-yolk egg phenotypes were selected for correlation analysis. The ANOVA test function of the R 4.2 statistical plotting software was used for statistical testing. The mean comparison mode between pairs was selected to statistically test the genotypes and double-yolk egg traits of the experimental chicken flock. A P value less than 0.05 indicated a significant difference. The results are shown in Table 1. The proportions of double-yolk eggs among chickens with three genotypes were significantly different (P<0.05). The proportion of double-yolk eggs in G / G genotype individuals was 1.80%, higher than that in A / G genotype individuals (1.57%, P<0.05) and A / A genotype individuals (1.27%, P<0.05). The proportion of double-yolk eggs in A / G genotype individuals was higher than that in A / A genotype individuals (P<0.05). The results indicate that the molecular marker of the chicken STON1 gene is significantly correlated with the double-yolk egg trait in chickens. According to the actual breeding goal, G / G genotype individuals can be selected to breed chickens with a high proportion of double-yolk eggs, improve the production rate of double-yolk eggs, and improve the breeding efficiency.

[0053] Table 1 Statistical analysis of the genotypes and phenotypes of the STON1 gene molecular marker

[0054] Genotype Count / individual Proportion of double-yolk eggs Total number of eggs laid / egg A / A 451 <![CDATA[1.27% a > 66.1 A / G 1173 <![CDATA[1.57% b > 65.9 G / G 677 <![CDATA[1.80% c > 66.1

[0055] Note: Data in the same column with the same superscript letter indicate no significant difference, while data with different superscript letters indicate a significant difference (P<0.05).

[0056] Example 2

[0057] Genotype frequencies of different breeds

[0058] Step 1. Collection of blood samples

[0059] Blood samples of 15 breeds, including Beijing Fatty Chicken, Dagu Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian River Tern Chicken, Liyang Chicken, Xinghua Chicken, Guangxi Sanhuang Chicken, White Leghorn Laying Hen, and Recessive White Rock Chicken, were collected by wing vein blood collection method and stored at -20°C for later use.

[0060] Step 2. Extraction of genomic DNA

[0061] Taking the tissue samples obtained in Step 1, genomic DNA was extracted using Omega's tissue genomic DNA extraction kit, and the specific method was referred to the standard operation procedure provided by Omega.

[0062] Step 3. Detection of genotypes

[0063] Using the genomic DNA obtained in Step 2 as a template, PCR amplification and Sanger sequencing were performed with a primer pair consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the G / G genotype, G / A genotype, and A / A genotype of the individual.

[0064] Step 4. Result analysis

[0065] Beijing Youji, Daguji, Dawenshan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Chahua Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken, and Guangxi Sanhuang Chicken are well-known Chinese local chicken breeds. Recessive White Rock is a commercially popular breed in the market. White Leghorn is a common commercial laying hen breed with a high egg production rate and moderate and uniform egg shapes. Among them, Chinese local chickens have not been selected for a long time, have a low egg production, a small proportion of abnormal eggs, and the A allele frequency in the population is higher than that of Recessive White Rock. As the most common improved laying hen, White Leghorn has been selected for egg quality traits for a long time, has a high egg production, a small proportion of abnormal eggs, and the A allele frequency in the population is higher than that of Recessive White Rock. These results can confirm that this SNP locus can be used as a molecular marker for double-yolk eggs in chickens. See Table 2.

[0066] Table 2. Allele frequency distribution of the STON1 gene molecular marker in different breeds

[0067]

[0068] In addition to the above embodiments, the present invention may have other embodiments. Any technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope required by the present invention.

Claims

1. Application of STON1 gene SNP primer related to chicken double-yolk egg trait, characterized in that: The SNP primers are used to detect the double-yolk egg trait of chickens. The nucleotide sequences of the SNP primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The SNP is located at the 7,867,409th base on chromosome 3 of the chicken reference genome GRCg7b version, and the base mutation is A or G. The proportion of double-yolk eggs in chickens with the G / G genotype at the SNP locus is higher than that in individuals with the A / G and A / A genotypes, and the proportion of double-yolk eggs in chickens with the A / G genotype is higher than that in individuals with the A / A genotype.

2. Use of the STON1 gene SNP primer related to the trait of chicken double-yolk eggs according to claim 1, characterized in that: The detection method includes the following steps. First, provide a DNA sample of the chicken to be tested, and perform PCR amplification using the SNP primers shown in SEQ ID NO:1-2 to obtain an amplification product. The length of the amplification product is 538 bp and contains the 7,867,409th base on chromosome 3 of the chicken reference genome GRCg7b version. Second, perform Sanger sequencing on the PCR product. Third, determine the SNP genotype of the 7,867,409th base on chromosome 3 of the chicken reference genome GRCg7b version according to the sequencing result of the second step.

3. Use of the STON1 gene SNP primer related to the trait of chicken double-yolk eggs according to claim 2, characterized in that: Calculated based on the final volume of the reaction system being 25 μl. DNA of the chicken to be tested: 50 ng 2×Accurate Taq Master Mix: 12.5 μl Forward primer: 1 μl Reverse primer: 1 μl Sterilized water: Make up to 25 μl. The reaction conditions for the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; store at 4°C. The nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images