Molecular marker, method, primer pair and kit for identifying thin-skinned muskmelon seed size character and application of molecular marker, method, primer pair and kit

Abstract

The invention discloses a molecular marker, a method, a primer pair and a kit for identifying the size character of thin-skinned muskmelon seeds and application of the molecular marker, and belongs to the technical field of molecular marker-assisted breeding. The invention aims to obtain a chromosome segment and a molecular marker which are closely linked with the size of a thin-skinned muskmelon seed. The invention provides a molecular marker for identifying the size character of a thin-skinned muskmelon seed. The molecular marker is shown as SEQ ID NO. 1 or SEQ ID NO. 2. According to the identification method, the genome DNA of the to-be-detected muskmelon sample is extracted in the seedling stage, so that the size of the muskmelon seed can be identified, the operation is simple and convenient, the identification accuracy and efficiency are high, and an effective breeding tool and technology are provided for molecular marker-assisted selection breeding of the size of the muskmelon seed.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and in particular relates to molecular markers, methods, primer pairs, kits and applications thereof for identifying size traits of thin-skinned melon seeds. Background Art

[0002] Muskmelon (Cucumis melo L.) is an annual vine herbaceous plant of the genus Cucurbitaceae. It is widely cultivated in my country and around the world and is an important economic crop in the world. The morphological indicators of melon seeds include seed shape, size, smoothness, etc. The size of seeds (mainly referring to the length and width of seeds) is an important factor affecting yield formation, stress resistance, and fruit quality. Generally, larger seeds can store more nutrients and endogenous hormones, which is conducive to seed germination and seedling growth, forming strong plants, and thus improving fruit quality and yield; small seeds have more advantages in reproduction and natural propagation due to their small size and light weight; the rich variation of melon seed size is the common result of natural selection and artificial selection. It is of great significance to explore the key main effect loci of thin-skinned melon petal size and apply them to germplasm resource screening and molecular breeding processes.

[0003] InDel molecular markers are polymorphic molecular markers formed by the deletion and insertion of bases in chromosome sequences. This type of marker is widely distributed in the genome, easy to operate, easy to observe, and generally applicable to different germplasm resources of the same species. Therefore, it is of great significance to explore InDel molecular markers that can be used for the identification of seed size traits of thin-skinned melons and apply them to the screening of melon germplasm resources and molecular breeding. Summary of the invention

[0004] The purpose of the present invention is to apply molecular markers to the screening and gene aggregation of muskmelon germplasm resources with different seed sizes, obtain chromosome segments and molecular markers closely linked to the seed size of muskmelon, and then more quickly and accurately identify the seed size of muskmelon in the seedling stage.

[0005] The invention provides a molecular marker for identifying the seed size trait of thin-skinned melon. The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0006] The invention provides a primer pair for amplifying and identifying a molecular marker for the size trait of thin-skinned melon seeds. The sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0007] The invention provides a kit for identifying the size trait of thin-skinned melon seeds, and the kit comprises the above-mentioned primer pair.

[0008] The present invention provides an application of the molecular marker, the primer pair or the kit in identifying the size trait of thin-skinned melon seeds.

[0009] The present invention provides an application of the molecular marker, the primer pair or the kit in auxiliary identification, auxiliary breeding and screening of the size trait of thin-skinned melon seeds.

[0010] It is further defined that the seed length range of the large seed trait is 8.16mm-5.20mm, and the seed width range is: 3.64mm-2.65mm, and the seed length range of the small seed trait is: 4.76mm-3.15mm, and the seed width range is: 2.06mm-1.72mm.

[0011] The present invention provides a method for identifying the size traits of thin-skinned melon seeds, and the method is as follows:

[0012] Step 1: Extracting the genomic DNA of the thin-skinned melon to be tested;

[0013] Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product to determine the size characteristics of muskmelon seeds.

[0014] Further defined, the PCR reaction system in step 1 is: 1 μL of upstream and downstream primers each, primer concentration is 2 pM, DNA template 2 μL, DNA template concentration is 30 ng / μL, 1 μL of 10×PCR Buffer, 0.15 μL of dNTP, dNTP concentration is 10 mM, 0.1 μL of Taq enzyme, Taq enzyme concentration is 5 U / μL, and 6.75 μL of sterile deionized water; the PCR reaction program is: pre-denaturation at 94°C for 7 min, denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 30 s, 30 cycles, extension at 72°C for 10 min, and storage at 4°C.

[0015] It is further defined that in step 2, if the amplified product contains a 194 bp fragment, it is determined to be a large seed type; if the amplified product contains a 184 bp fragment, it is determined to be a small seed type.

[0016] It is further defined that the seed length range of the large seed trait is 8.16mm-5.20mm, and the seed width range is: 3.64mm-2.65mm, and the seed length range of the small seed trait is: 4.76mm-3.15mm, and the seed width range is: 2.06mm-1.72mm.

[0017] Beneficial effects: In the early stage of the present invention, a genetic population with large seeds (cultivated species of thin-skinned melon) and small seeds (wild species of thin-skinned melon) as parents was constructed, and a chromosome segment closely linked to the seed size trait of thin-skinned melon was obtained by using genome resequencing and BSA-seq (Bulked Segregation Analysis) technology. A stable main effect positioning interval was obtained by performing phenotypic identification and QTL (Quantitative Trait Loci) analysis in the genetic population in one year and two seasons, and it was named Cmss2.1. InDel molecular markers were developed in the main effect chromosome segment, and the markers were located in the Cmss2.1 positioning interval of the key site of the seed size trait of thin-skinned melon. A common interval of about 1.43Mb was obtained in spring and autumn, which was closely linked to the seed size (seed length and seed width) trait. By using the molecular marker-assisted selection method, the genomic DNA of the sample to be tested can be extracted in the seedling stage of thin-skinned melon to perform molecular marker-assisted selection on the seed size of thin-skinned melon, thereby improving the accuracy and efficiency of breeding. This molecular marker can be applied to molecular breeding of muskmelon, providing an efficient molecular breeding tool for molecular identification of muskmelon seed size.

[0018] The present invention designs primer pairs using molecular markers closely linked to the seed size trait of muskmelon developed and obtained using parent resequencing data. Due to the polymorphism of short sequence insertion and deletion in the molecular marker fragments in different melon materials, the genomic DNA of melon seedlings is amplified by PCR using the obtained primer pairs, and the size of the PCR product fragments is detected by polyacrylamide gel electrophoresis, so that the seed size of muskmelon can be molecularly identified at the seedling stage. The identification method can identify the seed size of muskmelon by extracting the genomic DNA of the tested muskmelon sample at the seedling stage. The operation is simple, and the identification accuracy and efficiency are high, which provides an effective breeding tool and technology for molecular marker-assisted selection breeding of muskmelon seed size. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of the main effect locus Cmss2.1 of the seed size of thin-skinned melon in spring and autumn in Example 1 are shown in Figure A. The results are shown in spring; and Figure B is shown in autumn.

[0020] Figure 2 This is a graph showing the results of polyacrylamide gel electrophoresis detection of amplification products obtained after PCR amplification of large-seeded and small-seeded materials in a natural population using the primer pairs described in Example 2. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below in conjunction with specific embodiments and drawings. Except for the contents specifically mentioned below, the processes, conditions, experimental methods and reagents for implementing the present invention are common knowledge in the art and conventional products on the market, and the present invention has no particular limitations.

[0022] Method for extraction of genomic DNA:

[0023] The genomic DNA extraction method was based on the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.), and was improved on this basis.

[0024] The specific steps are as follows:

[0025] ① Wash and dry the collected young true leaves with sterile water, take 0.2 g and put them into a 1.5 mL centrifuge tube, add liquid nitrogen and grind them thoroughly into white powder, add 800 μL of 2% CTAB solution preheated at 65°C (2% CTAB, 100 mmol / L Tris-HCl pH=8.0), 1.4 mol / L NaCl, 20 mmol / L EDTA pH=8.0, 2% β-mercaptoethanol) and mix thoroughly, place in a 65°C water bath for 1 hour, and shake gently every 10 minutes.

[0026] ②Take out the centrifuge tube, wait for it to cool to room temperature, and centrifuge at 13000rpm for 10 minutes. Aspirate the supernatant and place it in a new centrifuge tube. To prevent mechanical shear force from damaging the DNA, the tip of the pipette used for transfer needs to be cut off with scissors in advance to expand the pipette port.

[0027] ③ Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0028] ④ Take out the centrifuge tube and use the same method as above to suck out 700 μL of supernatant with the pipette tip against the wall and place it in a new centrifuge tube.

[0029] ⑤ Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, gently shake the centrifuge tube to fully mix the solution, let it stand for 10 minutes, then centrifuge at 13000 rpm for 10 minutes.

[0030] ⑥ Aspirate 650 μL of supernatant and place it in a new tube, add 2 μL RNase (10 mg / mL), mix well, and place in a 37°C water bath for 2 hours.

[0031] ⑦ Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0032] ⑧ Aspirate 550 μL of supernatant from the tube and place it in a new tube. Add 550 μL of -20℃ pre-cooled isopropanol (add it to the tube wall). Close the tube cap tightly, turn it upside down several times, and place it in a -20℃ refrigerator for 60 minutes.

[0033] ⑨Take out the centrifuge tube and centrifuge it at 13000rpm for 10min. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.

[0034] ⑩ Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, add 200 μL ddH2O to dissolve, and store at -20°C for later use.

[0035] Example 1: Molecular markers tightly linked to the seed size trait of muskmelon and methods for obtaining the same

[0036] This embodiment provides a key gene linkage locus for the seed size trait of muskmelon, an InDel marker, and a method for obtaining the marker.

[0037] (1) Selection of test materials:

[0038] The test materials include maternal, paternal, F1 and F2 generation populations;

[0039] The male parent material is: m1-15, a cultivated thin-skinned melon, with a seed length of 6.92±0.39mm and a seed width of 2.98±0.22mm;

[0040] The female material is: 1190wd, wild thin-skinned melon, seed length is 3.02±0.16mm, seed width is 1.53±0.09mm;

[0041] The above female and male parents are disclosed in Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, LiuHongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297melon accessions reveals the genomic history of improvement and locirelated to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.

[0042] The F1 generation is: the F1 generation obtained by hybridizing the above two materials as parents;

[0043] The F2 generation population is: the F2 generation population obtained by self-pollination of the above-mentioned F1 generation, and 650 and 153 F2 generation populations are sown in spring and autumn of 2023, respectively.

[0044] (2) Identification of seed size phenotype of test materials: Seeds were collected from mature fruits, dried in the sun, and 20 full seeds were selected from each fruit. The length and width of the seeds were measured using a vernier caliper.

[0045] The survey results of this step show that the seed length of the F1 generation is 3.75±0.12mm, and the seed width is 1.88±0.11mm, which is between the two parents. The seed length and seed width show a normal distribution in the F2 generation, indicating that the melon seed size is a quantitative trait.

[0046] (3) Using BSA-seq and genetic linkage analysis methods, we obtained the chromosome segments that are closely linked to the seed size trait of thin-skinned melon:

[0047] In the F2 generation, 50 plants with large seeds (seed length range: 5.00-6.30mm) and 50 plants with small seeds (seed length range: 2.36-3.38mm) were selected, and DNA from each plant was extracted. After adjusting the DNA concentration to be consistent, equal amounts were mixed to construct a gene pool for thin-skinned melon seed size, and BSA-seq analysis was performed. According to the analysis results combined with the genome resequencing data of the two parents, InDel molecular markers were developed within the chromosome segment of the BSA-seq analysis results, and genetic linkage analysis was performed on the F2 generation populations in spring and autumn of 2023. Finally, the key major effect loci of the thin-skinned melon seed size trait were located on chromosome 2 of the melon genome. The common interval in spring and autumn was about 978.5Kb (chromosome physical position: 1339914bp-2758915bp), which was named Cmss2.1. Figure 1 These are the preliminary results of localizing the main locus Cmss2.1 of muskmelon seed size.

[0048] (4) Development of candidate InDel markers:

[0049] Based on the resequencing data of the two parents, InDel molecular markers were developed, and genotyping of each plant in the natural population was performed. Combined with the phenotypic data, the consistency between genotype and phenotype was determined. The results showed that the change of an InDel site in this segment was closely linked to seed size.

[0050] Furthermore, the present invention obtains the Chr02-884280 molecular marker tightly linked to the seed size of thin-skinned melon, the Chr02-884280 molecular marker is a 194bp nucleotide fragment of the nucleotide sequence as shown in SEQ ID NO.1 and a 184bp nucleotide fragment of the nucleotide sequence as shown in SEQ ID NO.2; the SEQ ID NO.1 is tightly linked to the large seed shape, and the SEQ ID NO.2 is tightly linked to the small seed trait.

[0051] In the present invention, the seed length of the large seed trait ranges from 8.16 mm to 5.20 mm, and the seed width ranges from 3.64 mm to 2.65 mm. The seed length of the small seed trait ranges from 4.76 mm to 3.15 mm, and the seed width ranges from 2.06 mm to 1.72 mm.

[0052] SEQ ID NO.1:

[0053] TATTTAGGATGATTGAGGCACTGAGTTGGTTATTATAATTTGTGTCTTTCATATATA TATTATAATGATATATACTATAATAGATCAATTTTAGAAGTGGTTTAATTTGGGTATTGCTA AGGTGGGACCTCTCCTT[AATAAAATTTG]ATAAAATTTGATATGGTTTGAGAAT GAACT AAGGCAGAAATTATTGG;

[0054] SEQ ID NO.2:

[0055] TATTTAGGATGATTGAGGCACT GAGTTGGTTATTATAATTTGTGTCTTTCATATATA TATTATAATGATATATACTATAATAGATCAATTTTAGAAGTGGTTTAATTTGGGTATTGCTA AGGTGGGACCTCTCCTT[A]ATAAAATTTGATATGGTTTGAGAAT GAACTAAGGCAGAA ATTATTGG.

[0056] Example 2: Acquisition of primer pairs for identifying the seed size trait of muskmelon

[0057] According to the results of parental resequencing data development, the Chr02-884280 molecular marker closely linked to the seed size trait of thin-skinned melon was designed, and a primer pair for amplifying the molecular marker was designed. Specifically, within the preliminary positioning interval of Example 1, primers were designed based on the InDel differences in the sequencing data of the two parents, and an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4 were obtained.

[0058] The upstream primer sequence is Chr02-884280-F (SEQ ID NO. 3): 5'-TATTTAGGATGATTGAGGCACT-3'; the downstream primer sequence is Chr02-884280-R (SEQ ID NO. 4): 5'-CCAATAATTTCTGCCTTAGTTC-3'.

[0059] Example 3: A method for identifying the size characteristics of thin-skinned melon seeds

[0060] A method for identifying the size traits of thin-skinned melon seeds, specifically comprising the following steps:

[0061] (1) Extract genomic DNA from leaves or other tissues of the thin-skinned melon sample to be tested.

[0062] The identification method of the present invention can use thin-skinned melon seedlings at different stages as materials. In order not to affect the optimal period of subsequent growth, this embodiment uses leaves of melon seedlings (two leaves and one heart stage) as materials to extract DNA.

[0063] (2) Using the Chr02-884280 primer pair obtained in Example 2, PCR amplification was performed on the genomic DNA of different samples to obtain amplified products, and the amplified products were detected by polyacrylamide gel electrophoresis. If the amplified product contained a 194 bp fragment, it was determined to be a large seed type; if the amplified product contained a 184 bp fragment, it was determined to be a small seed type.

[0064] The seed length of the large seed trait is in the range of 8.16 mm to 5.20 mm, and the seed width is in the range of 3.64 mm to 2.65 mm. The seed length of the small seed trait is in the range of 4.76 mm to 3.15 mm, and the seed width is in the range of 2.06 mm to 1.72 mm.

[0065] The PCR reaction system is as follows: 1 μL of upstream and downstream primers (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10× PCR Buffer (containing Mg 2+ 15mM), dNTP 0.15μL (concentration is 10mM), Taq enzyme 0.1μL (5U / μL), sterile deionized water 6.75μL.

[0066] The PCR reaction program was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0067] PCR product detection method: Take 2μL of PCR product, add 2μL Loading Buffer, mix well and spot into polyacrylamide gel, perform electrophoresis at 220V / 400mA for 50-60min.

[0068] The identification method of the present invention can be used to determine the seed size characteristics of thin-skinned melons during the seedling stage, and the sampling time is approximately the two-leaf and one-heart period; while conventional breeding requires measuring the seed size after the fruit matures, the identification method of the present invention can effectively shorten the breeding time and speed up the breeding speed.

[0069] Example 4: Screening the seed size of a natural melon population using the primer pairs obtained in Example 2

[0070] In order to determine the accuracy of the molecular markers obtained in Example 1, the primer pairs obtained in Example 2, and the identification method obtained in Example 3 in identifying the seed size of thin-skinned melons, samples of a natural population of thin-skinned melons were selected, and the seed size of each sample was identified according to the identification method described in Example 3. At the maturity stage of the melon fruit, the field phenotypic data of the seed size, including the seed length and the seed width, were measured.

[0071] In this example, genomic DNA of each individual plant in the male parent, female parent, F1 generation and natural population in Example 1 was extracted respectively, and the genomic DNA of the above samples was amplified by PCR using the primer pairs obtained in Example 2 to obtain PCR products. The PCR products were detected by polyacrylamide gel electrophoresis. The results are shown in FIG. Figure 2 .

[0072] Natural group materials Figure 2 Lane 4 to Lane 19, these natural population materials are disclosed in the following articles:

[0073] Liu Shi,Gao Peng,Zhu Qianglong,Zhu Zicheng,Liu Hongyu,Wang Xuezheng,Weng Yiqun,Gao Meiling and Luan Feishi*.Resequencing of 297melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon.2020,18,2545-2558,Plant Biotechnology Journal.

[0074] like Figure 2As shown, the PCR product detection results of the female parent (P1) showed a fragment of 184 bp, and the enzyme digestion results of the male parent (P2) showed a fragment of 194 bp, judging that the female parent was a small seed and the male parent was a large seed, which was consistent with the seed size measurement results of the male and female parents in Example 1. The PCR product detection results of the natural population in lanes 4-11 showed a fragment of 194 bp, and the PCR product detection results of the natural population in lanes 12-19 showed a fragment of 184 bp, judging that the natural population in lanes 4-11 had a large seed trait, and the natural population in lanes 12-19 had a small seed trait. According to the actual measurement of the seed size of the natural population, it was found that the seed length of the natural population in lanes 4-11 varied in the range of 8.16mm-5.20mm, the seed width varied in the range of 3.64mm-2.65mm, and the seed length of the natural population in lanes 12-19 varied in the range of 4.76mm-3.15mm, and the seed width varied in the range of 2.06mm-1.72mm. Therefore, the seed size trait of the thin-skinned melon determined by the electrophoresis results of the PCR products (marker gene typing results) was highly consistent with the actual seed size of each melon variety, the genotype and phenotype were completely consistent, and the molecular marker identification results were 100% consistent with the actual seed size trait. This further illustrates that the molecular markers provided in Example 1, the primer pairs provided in Example 2, and the method for identifying the seed size trait of the thin-skinned melon provided in Example 3 are feasible and accurate, and can be applied to the molecular marker identification of the seed size of the thin-skinned melon in the seedling stage.

[0075] Example 5: A kit for identifying the size traits of thin-skinned melon seeds

[0076] A kit for identifying the size trait of thin-skinned melon seeds includes the following reagents:

[0077] Chr02-884280-F and Chr02-884280-R described in Example 2 (both at 2 pM), 10×PCRBuffer (containing Mg 2+ 15 mM), dNTP (concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.

[0078] Example 6: Method for using a kit for identifying the size trait of thin-skinned melon seeds

[0079] (1) Extract genomic DNA from the tested thin-skinned melon and adjust the genomic DNA concentration to 30 ng / μL.

[0080] (2) Add samples and reagents according to the following PCR system:

[0081] DNA template 2 μL;

[0082]

[0083] (3) PCR amplification was performed. The reaction procedure of PCR amplification was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0084] (4) PCR products were detected by polyacrylamide gel electrophoresis, and the petal size trait of the thin-skinned melon was determined by the detection results. Specifically, if the amplified product was a 194 bp fragment, it was determined to be a large seed trait; if the amplified product was a 184 bp fragment, it was determined to be a small seed trait. The identification results matched the following ranges: the seed length range of the large seed trait was 8.16 mm-5.20 mm, and the seed width range was: 3.64 mm-2.65 mm, and the seed length range of the small seed trait was 4.76 mm-3.15 mm, and the seed width range was: 2.06 mm-1.72 mm.

[0085] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A molecular marker for identifying the size trait of muskmelon seeds, characterized in that: The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.

2.

2. A primer pair for amplifying and identifying molecular markers for the size trait of muskmelon seeds, characterized in that: The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit for identifying the size characteristics of thin-skinned melon seeds, characterized in that: The kit comprises the primer pair according to claim 2.

4. Use of the molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in identifying the size trait of muskmelon seeds.

5. Use of the molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in auxiliary identification, auxiliary breeding and screening of the size trait of thin-skinned melon seeds.

6. The use according to claim 4 or 5, characterized in that: The seed length of the large seed trait ranges from 8.16 mm to 5.20 mm, and the seed width ranges from 3.64 mm to 2.65 mm. The seed length of the small seed trait ranges from 4.76 mm to 3.15 mm, and the seed width ranges from 2.06 mm to 1.72 mm.

7. A method for identifying the size characteristics of thin-skinned melon seeds, characterized in that: The method described is as follows: Step 1: Extracting the genomic DNA of the thin-skinned melon to be tested; Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product to determine the size characteristics of muskmelon seeds.

8. The method according to claim 7, characterized in that The PCR reaction system in step 1 is: 1 μL of upstream and downstream primers, primer concentration is 2 pM, DNA template 2 μL, DNA template concentration is 30 ng / μL, 1 μL of 10×PCR Buffer, 0.15 μL of dNTP, dNTP concentration is 10 mM, 0.1 μL of Taq enzyme, Taq enzyme concentration is 5 U / μL, and 6.75 μL of sterile deionized water; the PCR reaction program is: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

9. The method according to claim 7, characterized in that: In step 2, if the amplified product contains a 194 bp fragment, it is determined to be a large seed type; if the amplified product contains a 184 bp fragment, it is determined to be a small seed type.

10. The method according to claim 9, characterized in that The seed length of the large seed trait ranges from 8.16 mm to 5.20 mm, and the seed width ranges from 3.64 mm to 2.65 mm. The seed length of the small seed trait ranges from 4.76 mm to 3.15 mm, and the seed width ranges from 2.06 mm to 1.72 mm.

Images