Construction method and application of IVA type mucopolysaccharide storage disease rat model

Abstract

The invention provides a construction method of an IVA type mucopolysaccharide storage disease rat model, which is characterized by comprising the following steps: acquiring a GALNS p.M320R heterozygote mutation rat and a GALNS p.M320R homozygote mutation rat; a GALNS p.M320R male heterozygote mutation rat and a GALNS p.M320R female homozygote mutation rat are subjected to mating, and the IVA type mucopolysaccharide storage disease rat model is constructed. According to the application, by simulating common GALNS p.M318R mutation of clinical patients, the rat model has a relatively high survival rate, and shows mild IVA type mucopolysaccharide storage disease; secondly, the rat model constructed by the application shows obvious skeletal system phenotype within 3-4 weeks, and the onset time of the rat model is closer to the onset time of clinical IVA type mucopolysaccharide storage disease; meanwhile, the severity of disease phenotypes can be regulated and controlled.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a method for constructing a rat model of type IVA mucopolysaccharidosis and its application. Background Art

[0002] Mucopolysaccharidosis (MPS) is an autosomal recessive lysosomal storage disease caused by mutations in the hydrolases that degrade Glycosaminoglycans (GAGs). As a result, GAGs cannot be degraded and are subsequently accumulated in the body, causing disease. In severe cases, it can cause disability or death.

[0003] Among them, type IVA mucopolysaccharidosis, also known as Morquio A syndrome, is caused by mutations in the GALNS gene encoding N-acetylgalactosamine (N-acetyl)-6-sulfatase, which leads to abnormal accumulation of its metabolic substrates, chondroitin sulfate (CS) and keratan sulfate (KS), in the body. Children with the disease generally have no abnormal symptoms at birth, but as they age, they gradually develop severe bone and joint abnormalities and a series of other organ damage, including bone deformities, short stature, spinal cord compression, respiratory and heart diseases, visual and hearing impairment, and tooth deformities. Most patients die of cardiopulmonary failure, and their life expectancy is around 30 years old.

[0004] Unlike other MPS, children with MPS type IVA have normal intellectual development, but their bone damage is more extensive and severe than other types of MPS. Traditional mouse models cannot reproduce the skeletal phenotype of MPS type IVA, and only show mild pathological changes at the histological level and abnormal ankle curvature; and existing rat models have problems such as high mortality.

[0005] Therefore, there is an urgent need to improve the animal model of MPS type IVA disease. Summary of the invention

[0006] Based on this, one or more embodiments of the present application provide a method for constructing and applying a rat model with good survival rate, controllable disease phenotype severity, and consistent with the genetic characteristics of patients with type IVA mucopolysaccharidosis.

[0007] According to a first aspect of an embodiment of the present application, a method for constructing a rat model of type IVA mucopolysaccharidosis is provided, characterized in that it comprises the following steps:

[0008] Obtain GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats;

[0009] The GALNS p.M320R male heterozygous mutant rats were mated with the GALNS p.M320R female homozygous mutant rats to construct the type IVA mucopolysaccharidosis rat model.

[0010] In one embodiment, the step of obtaining a GALNS p.M320R heterozygous mutant rat comprises:

[0011] Design sgRNA and Donor Oligo for the GALNS p.M320R mutation in target rats;

[0012] The Cas9 mRNA, the sgRNA and the Donor Oligo are transferred into the fertilized eggs of the target rats to obtain F0 generation rats with GALNS p.M320R mutation;

[0013] The F0 generation rats were mated with wild-type rats to obtain the GALNS p.M320R heterozygous mutant rats.

[0014] In one embodiment, the step of obtaining the GALNS p.M320R female homozygous mutant rat comprises:

[0015] The GALNS p.M320R heterozygous mutant rats were self-crossed to obtain the GALNS p.M320R homozygous females.

[0016] In one embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1.

[0017] In one embodiment, the nucleotide sequence of the Donor Oligo is shown in SEQ ID NO:2.

[0018] In one embodiment, it is characterized in that the construction method further includes the following step: using primers with nucleotide sequences such as SEQ ID NO: 3 and SEQ ID NO: 4 to identify the genotype of the rat model.

[0019] In one embodiment, the identification method comprises one or more of PCR and Sanger sequencing.

[0020] In one embodiment, it is characterized in that the construction method further includes the following step: using primers with nucleotide sequences such as SEQ ID NO:5 and SEQ ID NO:6 to identify the genotype of the rat model.

[0021] In one embodiment, the identification method comprises PCR-RFLP.

[0022] According to a second aspect of an embodiment of the present application, there is provided a use of a type IVA mucopolysaccharidosis rat model constructed by any of the construction methods described above in screening drugs for treating type IVA mucopolysaccharidosis.

[0023] Compared with the traditional technology, this application has the following beneficial effects:

[0024] First, this application simulates the common GALNS p.M318R mutation in clinical patients, and the rat model has a high survival rate and shows mild IVA type mucopolysaccharidosis; secondly, the homozygous mutant rats obtained by hybridizing heterozygous male rats and homozygous female rats show obvious skeletal system phenotypes in 3 to 4 weeks. Compared with the existing rat model, the onset time of clinical classic IVA type mucopolysaccharidosis is closer; in addition, by selecting different rats as hybrid mothers, the severity of the disease phenotype of the rat model can be regulated. In summary, the animal model constructed in this application can meet a variety of different application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 A in the middle is the result of the amino acid sequence comparison between humans and rats. Figure 1 Middle B is the predicted protein structure of human GALNS before and after p.M318R mutation;

[0027] Figure 2 Schematic diagram of the principle of constructing the GALNS p.M320R point mutation rat model for this application;

[0028] Figure 3 This is the gel electrophoresis detection diagram of F0 generation positive rats;

[0029] Figure 4 This is the Sanger sequencing peak diagram of the F0 generation positive rats;

[0030] Figure 5 This is the Sanger sequencing peak diagram of the F1 generation positive rats;

[0031] Figure 6The gel electrophoresis images of PCR-RFLP amplification products of wild-type rats, heterozygous rats and homozygous rats;

[0032] Figure 7 The figure is the statistical result of GALNS enzyme activity in the peripheral blood of wild-type rats and homozygous rats;

[0033] Figure 8 The incisor appearance of wild-type rats and homozygous rats at three months of age;

[0034] Fig. 9 The statistical results are the average body weights of wild-type rats, heterozygous rats and homozygous rats;

[0035] Fig.10 The statistical result of the average weight of offspring obtained by hybridization of females with different genotypes;

[0036] Fig.11 For GALNS M318R / M318R Toluidine blue staining of rat offspring obtained by hybridization with female rats as maternal parents;

[0037] Fig.12 This is a phenotypic comparison chart of the offspring obtained by hybridizing mothers with different genotypes. DETAILED DESCRIPTION

[0038] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present application. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application, etc. can be purchased from the market or can be prepared by existing methods.

[0040] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0041] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0042] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0043] Herein, “preferred”, “better”, “more preferred” and “suitable” are merely used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute limitations on the scope of protection of this application.

[0044] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0045] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0046] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0047] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1-10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0048] Traditional animal models of MPS IVA are mostly mouse models, that is, the GALNS gene is knocked out in the mouse genome or the mutant GALNS protein is expressed. However, the phenotypes of these mouse disease models are not obvious, with only mild pathological changes and abnormal ankle curvature at the histological level, which cannot fully simulate the clinical symptoms of MPS IVA. The reported GALNS p.R386C mutation rat model simulates a more common mutation type associated with MPS IVA in other regions except China, but the model gradually shows a skeletal system phenotype after one month of age; and the survival rate after one month of age is less than 50%, which makes it impossible to study diseases of different severities and different stages of onset.

[0049] Based on this, the first aspect of the present application provides a method for constructing a type IVA mucopolysaccharidosis rat model, comprising steps S10 and S20:

[0050] Step S10: obtaining GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats;

[0051] Step S20: mating GALNS p.M320R male heterozygous mutant rats with GALNS p.M320R homozygous female mutant rats to construct the type IVA mucopolysaccharidosis rat model.

[0052] Compared with the traditional mouse model, the point mutation rat model constructed by the method of the present application has genetic characteristics and symptoms similar to those of patients with the common GALNS p.M318R mutation clinically seen in Asia, and can be used to simulate type IVA mucopolysaccharidosis carrying the GALNS p.M318R mutation at different stages and severities in clinical practice; and the rat model constructed by the present application has a good survival rate.

[0053] The present application has found through research that using rats of different genotypes as maternal parents can regulate the severity of the phenotype of offspring rats; specifically, the offspring mice obtained by hybridizing male heterozygotes with female homozygotes show disease phenotypes earlier than the offspring obtained by self-fertilization of heterozygous rats. In this way, the research process can be accelerated, the experimental cycle can be shortened, and it is easier to gain a deeper understanding of the disease mechanism and intervene and study the early stages of the disease.

[0054] In some embodiments, in step S10, the step of obtaining a GALNS p.M320R heterozygous mutant rat comprises steps S11 to S13:

[0055] Step S11: Design sgRNA and Donor Oligo for the GALNS p.M320R mutation of the target rat;

[0056] Step S12: transferring Cas9 mRNA, sgRNA and Donor Oligo into the fertilized eggs of target rats to obtain F0 generation rats with GALNS p.M320R mutation;

[0057] Step S13: F0 generation rats are mated with wild-type rats to obtain GALNS p.M320R heterozygous mutant rats.

[0058] In some embodiments, in step S11, the nucleotide sequence of sgRNA is as shown in SEQ ID NO:1.

[0059] Specifically, the nucleotide sequence shown in SEQ ID NO: 1 is as follows: TACGTTTGAAGGCGGGATGAGGG.

[0060] In some embodiments, in step S11, the nucleotide sequence of Donor Oligo is as shown in SEQ ID NO:2.

[0061] Specifically, the nucleotide sequence shown in SEQ ID NO: 2 is as follows: TCCTCAGGTGGCAGCAATGGTCCCT TCCTGTGTGGGAAGCAGACTACGTTTGAAGGCGGGAGGAGGGAGCCTGCAATCGCTTG GTGGCCAGGGCACATTGCCGCAGGCCAGGTGAGTCACACA.

[0062] Using the sgRNA and Donor Oligo with the above-mentioned specific nucleotide sequence, a rat model containing the GALNS p.M320R point mutation can be constructed quickly and efficiently.

[0063] In some embodiments, in step S12, the method of transferring is microinjection.

[0064] In some embodiments, the rat is a Sprague Dawley rat.

[0065] It can be understood that in step S20, the F1 generation heterozygotes obtained by mating the F0 generation rats with the wild-type rats include F1 generation male heterozygotes and F1 generation female heterozygotes.

[0066] Furthermore, female homozygotes and male homozygotes can be obtained by hybridizing F1 generation male heterozygotes and F1 generation female heterozygotes.

[0067] In some embodiments, in step S10, the step of obtaining a GALNS p.M320R homozygous mutant rat comprises:

[0068] Step S14: The GALNS p.M320R heterozygous mutant rats were self-pollinated to obtain GALNS p.M320R homozygous females.

[0069] It is understandable that in the above step S14, the female homozygous rats can be F2 generation female homozygous rats directly obtained by self-pollination of F1 generation heterozygous rats, or can be offspring obtained by further breeding and mating with F2 generation rats as mothers.

[0070] In some embodiments, the construction method further comprises the following step: using primers with nucleotide sequences such as SEQ ID NO: 3 and SEQ ID NO: 4 to identify the genotype of the rat model.

[0071] Specifically, the nucleotide sequence shown in SEQ ID NO: 3 is as follows: TGTGCCTAATGAGTTCAGAAG.

[0072] Specifically, the nucleotide sequence shown in SEQ ID NO:4 is as follows: CAGACTGAGGTCTCAGAAGGATAC.

[0073] In some embodiments, the method of identification using the above primer pairs includes one or more of PCR and Sanger sequencing.

[0074] It can be understood that the above primers can also be used to identify the genotypes of F0 generation rats, F1 generation rats, F2 generation rats and their offspring rats.

[0075] In some embodiments, the construction method further comprises the step of identifying the genotype of the rat model using primers having nucleotide sequences such as SEQ ID NO: 5 and SEQ ID NO: 6.

[0076] Specifically, the nucleotide sequence shown in SEQ ID NO:5 is as follows: GTTCAGAAGTCAGGGTAGGCC.

[0077] Specifically, the nucleotide sequence shown in SEQ ID NO:6 is as follows: CCTGCCCCTTGTAGTAAGTCC.

[0078] In some embodiments, the method of identifying SEQ ID NOs: 5 to 6 using primers includes PCR-RFLP (restriction fragment length polymorphism).

[0079] It can be understood that the above primers can also be used to identify the genotypes of F0 generation rats, F1 generation rats, F2 generation rats and their offspring rats.

[0080] Compared with PCR and Sanger sequencing, identification of rat genotypes based on PCR-RFLP technology has the advantages of rapidity, high efficiency and low cost.

[0081] The type IVA mucopolysaccharidosis rat model constructed by the method of the present application has at least the following advantages: first, the constructed rat model shows obvious disease phenotypes at 3 to 4 weeks of age, which is closer to the onset time of classic type IVA mucopolysaccharidosis; second, the above method can improve the survival rate of the rat model, thereby effectively improving the effectiveness of the experiment and saving experimental costs; in addition, the present application can achieve regulation of the phenotypic severity of the animal model, can simulate type IVA mucopolysaccharidosis at different stages and degrees of clinical onset, and has broad application prospects.

[0082] The rat model constructed using the above method exhibits disease symptoms that are similar to those of patients with the clinical GALNSp.M318R mutation, providing a new idea for the research and analysis of mucopolysaccharidosis type IVA.

[0083] In a second aspect of the present application, there is provided the use of a type IVA mucopolysaccharidosis rat model constructed by any of the above-mentioned construction methods in screening drugs for treating type IVA mucopolysaccharidosis.

[0084] The rat model constructed by the method of the present application can be used for disease mechanism research, drug development, drug efficacy evaluation and other related work of type IVA mucopolysaccharidosis, thereby promoting the research progress of the disease.

[0085] The present application will be further described below in conjunction with specific examples and comparative examples, but they should not be construed as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be sourced from commercial sources, the instruments used, unless otherwise specified, can all be sourced from commercial sources, and the processes involved, unless otherwise specified, are all conventionally selected by those skilled in the art.

[0086] Embodiment 1:

[0087] (1) Sequence comparison revealed that the GALNS p.M320R mutation in the rat genome (NM_001047851) was homologous to the GALNS p.M318R mutation in the human genome. Figure 1 A in the middle is the amino acid sequence comparison diagram between human and rat; Figure 1 Middle B shows the protein structure of human GALNSp.M318R before and after mutation.

[0088] Based on this, the applicant specifically designed and synthesized the sgRNA with a nucleotide sequence as shown in SEQ ID NO: 1 and the Donor Oligo with a nucleotide sequence as shown in SEQ ID NO: 2 for the GALNS p.M320R mutation in rats; the specific principle is as follows Figure 2 shown.

[0089] sgRNA (SEQ ID NO: 1)

[0090] TACGTTTGAAGGCGGGATGAGGG.

[0091] Donor Oligo (SEQ ID NO: 2)

[0092] TCCTCAGGTGGCAGCAATGGTCCCTTCCTGTGTGGGAAGCAGACTACGTTTGAAGG CGGGAGGAGGGAGCCTGCAATCGCTTGGTGCCAGGGCACATTGCCGCAGGCCAGGTG AGTCACACA.

[0093] (2) Construction of mutant rat model

[0094] (2.1) The synthesized sgRNA, Donor Oligo and Cas9 mRNA were microinjected into the fertilized eggs of Sprague-Dawley (SD) rats, and then the fertilized eggs were transplanted into the uterus of pseudo-pregnant female mice to obtain F0 generation rats.

[0095] (2.2) DNA was extracted from the tail tissue samples of the above-mentioned F0 rats, and PCR amplification and Sanger sequencing analysis were performed using primers with nucleotide sequences such as SEQ ID NO: 3 (F1) and SEQ ID NO: 4 (R1), thereby screening and obtaining two F0 generation positive rats (No. 6 and No. 9) containing the target mutation. Figure 3 The gel electrophoresis of the PCR amplification products of rats No. 6 and No. 9 ( Figure 3 The channels from left to right in the gel electrophoresis diagram are: No. 9 positive rat, No. 6 positive rat, wild-type rat, water and Marker); Figure 4 This is the Sanger sequencing peak diagram of positive rats No. 6 and No. 9.

[0096] F1 (SEQ ID NO: 3)

[0097] TGTGCCTAACAATGAGTTCAGAAG.

[0098] R1 (SEQ ID NO:4)

[0099] CAGACTGAGGTCTCAGAAGGATAC.

[0100] The reaction system (25 μL) of PCR amplification includes: 1.5 μL of rat tail tissue DNA sample, 1 μL of F1 primer, 1 μL of R1 primer, 12.5 μL of Green Taq Mix (Vazyme P131), and 9 μL of ddH2O.

[0101] The reaction procedure of PCR amplification included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

[0102] (2.3) The F0 positive rats obtained by the above screening were mated with wild-type SD rats, and PCR amplification and Sanger sequencing analysis were performed using primers with nucleotide sequences as shown in SEQ ID NO:3 (F1) and SEQ ID NO:4 (R1) to obtain stable inherited F1 generation positive rats GALNS M318R / + , Figure 5 This is the Sanger sequencing peak diagram of the F1 generation positive rats.

[0103] Based on the destruction of the BtsC1 recognition site by the above point mutation, a primer pair for PCR-RFLP rapid genotyping technology was specifically designed, with nucleotide sequences such as SEQ ID NO: 5 (F2) and SEQ ID NO: 6 (R2) for typing and identification of wild-type, heterozygous and homozygous rats.

[0104] F2 (SEQ ID NO: 5)

[0105] GTTCAGAAGTCAGGGTAGGCC.

[0106] R2 (SEQ ID NO:6)

[0107] CCTGCCCCTTGTAGTAAGTCC.

[0108] The PCR-RFLP reaction system (20 μL) included: 1 μL of rat tail tissue DNA sample, 0.5 μL of F2 primer, 0.5 μL of R2 primer, 10 μL of 2×Master Mix (Green Taq), and 8 μL of ddH2O.

[0109] The reaction procedure of PCR-RFLP included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

[0110] The product obtained after PCR-RFLP amplification was 360 bp in length. After digestion with BtsCI endonuclease, the PCR-RFLP amplification product of wild-type rats was digested to obtain fragments of 189 bp, 104 bp, and 67 bp. M318R / M318R After restriction digestion, the fragments of 265 bp and 104 bp were obtained in rats; heterozygous GALNS M318R / + After enzyme digestion, the fragments of 265 bp, 189 bp and 104 bp were obtained from rats. The gel electrophoresis of the PCR-RFLP amplification products is shown in Figure 6 As shown (the channels from left to right are 100bpDNA ladder, homozygous GALNS M318R / M318R , wild type, homozygous GALNS M318R / M318R and heterozygous GALNS M318R / + ).

[0111] The enzyme digestion reaction system (20 μL) includes: 15 μL of PCR product, 2 μL of 10×CutSmart Buffer, 0.25 μL (5U) of restriction endonuclease BtsCI (20 U / uL), and 2.75 μL of H2O.

[0112] The enzyme digestion reaction includes the following steps: digestion at 50°C for 50 minutes, termination at 80°C for 5 minutes, natural cooling, and separation by electrophoresis on 2% agarose gel.

[0113] (2.4) The above F1 positive rats were further mated with SD rats for at least three generations to eliminate the potential off-target effects caused by CRISPR / Cas9 technology and obtain stable heterozygous GALNS M318R / + .

[0114] (2.5) The stable heterozygous GALNS constructed in step (2.4) above M318R / + Self-pollination was performed to obtain homozygous GALNS M318R / M318R Rat.

[0115] Submandibular vein collection of wild-type rats, heterozygous GALNS M318R / + Rats and homozygous GALNS M318R / M318R The peripheral blood of rats was separated, and the serum was incubated with the substrate 4-Methylumbelliferylβ-D-Galactopyranoside-6-SulfateSodium Salt (MCE, MU-Gal-6S) at 37°C for 17 hours, and the fluorescent substrate obtained by the reaction was measured to detect the activity of GALNS enzyme in the peripheral blood of three rats. The results are shown in Figure 7 Shown: Homozygous GALNS M318R / M318RThe GALNS enzyme activity in the peripheral blood of rats was significantly reduced, about 20% of the wild type.

[0116] Compared with wild-type rats, GALNS M318R / M318R When rats grow to three months old, abnormal incisor growth can be seen. Figure 8 shown.

[0117] At 4, 8, 12, 16 and 20 weeks of age, 4 to 5 wild-type rats, heterozygous rats and homozygous rats were weighed and the average body weight was calculated. Fig. 9 As shown: Compared with wild-type rats, the body weight of homozygous rats did not decrease significantly until 12 weeks of age.

[0118] At the same time, the survival rate of the rat offspring obtained by the above construction was statistically analyzed, and the statistical results of the survival rate around 150 days after birth are shown in Table 1.

[0119] Table 1

[0120]

[0121] The above results indicate that a rat model with a skeletal system phenotype of mild type IVA mucopolysaccharidosis was successfully constructed using the specific sgRNA, donor oligo and method of the present application.

[0122] (2.6) Further, using GALNS M318R / + Male rats were used as paternal parents and GALNS M318R / M318R When female rats were used as maternal parents for crossbreeding, the weight of the homozygous offspring rats was significantly smaller than that of their heterozygous siblings at 3 to 4 weeks of age, and the disease phenotype appeared earlier than the p.R386C homozygous mutant rats constructed by traditional technology. This shows that the offspring of rats obtained by crossbreeding using homozygous rats as maternal parents can show skeletal system phenotypes earlier.

[0123] Specifically, GALNS M318R / + The offspring of heterozygous rats obtained by self-fertilization and the offspring of rats with GALNS M318R / + Male rats were used as paternal parents and GALNS M318R / M318R The statistical results of the average body weight of the offspring obtained by hybridization with female rats as the mother within 42 days of age are shown in Table 2 and Fig.10 shown.

[0124] Table 2 (unit: g)

[0125]

[0126] At 6 weeks of age, take the above-mentioned GALNS M318R / M318RThe offspring of the rats GALNS obtained by hybridization with female rats as the mother M318R / M318R and GALNS M318R / + The tibia bone tissue was decalcified and paraffin-embedded, and the tissue sections were stained with toluidine blue and observed under a microscope. Fig.11 Shown: GALNS M318R / M318R At 6 weeks of age, the chondrocytes in the resting and proliferative zones of the bone growth plate of homozygous rats have hypertrophy, and the chondrocytes in the proliferative zone are disordered and their number is significantly reduced. M318R / M318R Female rats as maternal GALNS M318R / M318R The offspring had stiff limbs, altered gait, and X-rays showed scoliosis in addition to dental dysplasia. Fig.12 ), while the heterozygous GALNS M318R / M318R At three months of age, only dental hypoplasia was observed, and the spinal column morphology was normal.

[0127] Furthermore, the above-mentioned GALNS M318R / M318R The survival rate of rat offspring obtained by hybridization with female rats as maternal parents was statistically analyzed, and the statistical results of the survival rate around 150 days after birth are shown in Table 3.

[0128] Table 3

[0129]

[0130] In summary, the above method of the present application can be used to construct a type IVA mucopolysaccharidosis rat model that has both a skeletal system phenotype and a good survival rate; at the same time, the model shows growth and development disorders in infancy, which is closer to the onset time of type IVA mucopolysaccharidosis in clinical practice; in addition, the present application can also construct rat models with different degrees of severity, thereby meeting different research purposes and application scenarios.

[0131] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0132] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the attached claims.

Claims

1. A method for constructing a rat model of mucopolysaccharidosis type IVA, characterized in that: The steps include: Obtain GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats; The GALNS p.M320R male heterozygous mutant rats were mated with the GALNS p.M320R female homozygous mutant rats to construct the type IVA mucopolysaccharidosis rat model.

2. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 1, characterized in that: The steps for obtaining GALNS p.M320R heterozygous mutant rats include: Design sgRNA and Donor Oligo for the GALNS p.M320R mutation in target rats; The Cas9 mRNA, the sgRNA and the Donor Oligo are transferred into the fertilized eggs of the target rats to obtain F0 generation rats with GALNSp.M320R mutation; The F0 generation rats were mated with wild-type rats to obtain the GALNS p.M320R heterozygous mutant rats.

3. The method for constructing a rat model of type IVA mucopolysaccharidosis according to claim 2, characterized in that: The steps of obtaining the GALNS p.M320R female homozygous mutant rats include: The GALNS p.M320R heterozygous mutant rats were self-crossed to obtain the GALNS p.M320R homozygous females.

4. The method for constructing a rat model of type IVA mucopolysaccharidosis according to claim 2, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1.

5. The method for constructing a rat model of type IVA mucopolysaccharidosis according to claim 2, characterized in that: The nucleotide sequence of the Donor Oligo is shown in SEQ ID NO:

2.

6. The method for constructing a rat model of type IVA mucopolysaccharidosis according to any one of claims 1 to 5, characterized in that: The construction method further comprises the following step: using primers with nucleotide sequences such as SEQ ID NO: 3 and SEQ ID NO: 4 to identify the genotype of the rat model.

7. The method for constructing a rat model of type IVA mucopolysaccharidosis according to claim 6, characterized in that: The identification method includes one or more of PCR and Sanger sequencing.

8. The method for constructing a rat model of type IVA mucopolysaccharidosis according to any one of claims 1 to 5, characterized in that: The construction method further comprises the following step: using primers with nucleotide sequences such as SEQ ID NO: 5 and SEQ ID NO: 6 to identify the genotype of the rat model.

9. The method for constructing a rat model of type IVA mucopolysaccharidosis according to claim 8, characterized in that: The identification method includes PCR-RFLP.

10. Use of the type IVA mucopolysaccharidosis rat model constructed by the construction method according to any one of claims 1 to 9 in screening drugs for treating type IVA mucopolysaccharidosis.

Images