Construction and application of rat model of mucopolysaccharidosis type IVA

By introducing the GALNS p.M320R mutation into the rat model and using CRISPR/Cas9 technology and genotype identification methods, the problem that the existing model was unable to simulate the skeletal system phenotype and low survival rate of mucopolysaccharidosis type IVA was solved, and efficient disease simulation and research were achieved.

CN119325948BActive Publication Date: 2025-09-12ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411358997.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-26
Publication Date
2025-09-12
Estimated Expiration
2044-09-26

AI Technical Summary

Technical Problem

Existing mouse and rat models cannot effectively simulate the skeletal system phenotype of mucopolysaccharidosis type IVA, and have low survival rates, which cannot meet the needs of studying different severities and stages of disease.

Method used

By constructing GALNS p.M320R heterozygous and homozygous rat models, CRISPR/Cas9 technology was used to introduce specific mutations into the rat genome, and genotype identification was performed in combination with PCR and Sanger sequencing to achieve regulation of disease phenotypes and improve survival rates.

Benefits of technology

The constructed rat model shows obvious disease phenotypes at 3 to 4 weeks of age and has a high survival rate. It can simulate type IVA mucopolysaccharidosis of varying degrees of severity, shorten the research cycle, and improve experimental efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119325948B_ABST
    Figure CN119325948B_ABST
Patent Text Reader

Abstract

The present application provides a method for constructing a rat model of mucopolysaccharidosis type IVA, characterized by comprising the following steps: obtaining rats with a GALNS p.M320R heterozygous mutation and a GALNS p.M320R homozygous mutation; and mating male GALNS p.M320R heterozygous mutation rats with female GALNS p.M320R homozygous mutation rats to construct the rat model of mucopolysaccharidosis type IVA. By simulating the GALNS p.M318R mutation, a common clinical patient, the rat model has a high survival rate and exhibits mild mucopolysaccharidosis type IVA. Furthermore, the rat model constructed in the present application exhibits a clear skeletal phenotype at 3 to 4 weeks of age, which is closer to the clinical onset of mucopolysaccharidosis type IVA. Furthermore, the present application enables the regulation of the severity of the disease phenotype.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a method for constructing and applying a rat model of mucopolysaccharidosis type IVA. Background Art

[0002] Mucopolysaccharidosis (MPS) is an autosomal recessive lysosomal storage disease caused by mutations in the hydrolases that degrade Glycosaminoglycans (GAGs). This leads to the inability to degrade GAGs, which then accumulate in the body and cause disease. In severe cases, it can cause disability or even death.

[0003] Among them, mucopolysaccharidosis type IVA, also known as Morquio A syndrome, is caused by mutations in the GALNS gene, which encodes the enzyme N-acetylgalactosamine-6-sulfatase. This leads to the abnormal accumulation of its metabolic substrates, chondroitin sulfate (CS) and keratan sulfate (KS). Affected children generally present with no abnormalities at birth, but with age, they develop severe skeletal and joint abnormalities and a range of other organ damage, including skeletal deformities, short stature, spinal cord compression, respiratory and heart disease, visual and hearing impairment, and dental deformities. Most patients die from cardiopulmonary failure, with a life expectancy of around 30 years.

[0004] Unlike other MPS types, children with MPS type IVA have normal intellectual development, but their skeletal damage is more extensive and severe than in other MPS types. Traditional mouse models are unable to reproduce the skeletal phenotype of MPS type IVA, demonstrating only mild histological changes and abnormal ankle curvature. Existing rat models also suffer from high mortality rates.

[0005] Therefore, there is an urgent need to improve the animal model of mucopolysaccharidosis type IVA. Summary of the Invention

[0006] Based on this, one or more embodiments of the present application provide a method for constructing and applying a rat model with a good survival rate, controllable disease phenotype severity, and consistent with the genetic characteristics of patients with type IVA mucopolysaccharidosis.

[0007] According to a first aspect of the embodiments of the present application, a method for constructing a rat model of mucopolysaccharidosis type IVA is provided, characterized in that it comprises the following steps:

[0008] Obtain GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats;

[0009] Male GALNS p.M320R heterozygous mutant rats were mated with female GALNS p.M320R homozygous mutant rats to establish the type IVA mucopolysaccharidosis rat model.

[0010] In one embodiment, the step of obtaining a rat with a GALNS p.M320R heterozygous mutation comprises:

[0011] Design sgRNA and Donor Oligo for the target rat GALNS p.M320R mutation;

[0012] The Cas9 mRNA, the sgRNA, and the Donor Oligo were transferred into the fertilized eggs of the target rats to obtain F0 generation rats with the GALNS p.M320R mutation;

[0013] The F0 generation rats were mated with wild-type rats to obtain the GALNS p.M320R heterozygous mutant rats.

[0014] In one embodiment, the step of obtaining the GALNS p.M320R homozygous female mutant rat comprises:

[0015] The GALNS p.M320R heterozygous mutant rats were self-crossed to obtain the GALNS p.M320R homozygous females.

[0016] In one embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0017] In one embodiment, the nucleotide sequence of the Donor Oligo is shown in SEQ ID NO: 2.

[0018] In one embodiment, it is characterized in that the construction method further includes the following step: using primers with nucleotide sequences such as SEQ ID NO: 3 and SEQ ID NO: 4 to identify the genotype of the rat model.

[0019] In one embodiment, the identification method comprises one or more of PCR and Sanger sequencing.

[0020] In one embodiment, it is characterized in that the construction method further includes the following step: using primers with nucleotide sequences such as SEQ ID NO: 5 and SEQ ID NO: 6 to identify the genotype of the rat model.

[0021] In one embodiment, the identification method comprises PCR-RFLP.

[0022] According to a second aspect of the embodiments of the present application, there is provided a use of a type IVA mucopolysaccharidosis rat model constructed by any of the construction methods described above in screening drugs for treating type IVA mucopolysaccharidosis.

[0023] Compared with traditional technologies, this application has the following beneficial effects:

[0024] First, this application simulates the common GALNS p.M318R mutation in clinical patients. The rat model has a high survival rate and manifests as mild type IVA mucopolysaccharidosis. Secondly, the homozygous mutant rats obtained by hybridizing heterozygous male rats and homozygous female rats show obvious skeletal system phenotypes at 3 to 4 weeks. Compared with the existing rat model, the onset time of the classic type IVA mucopolysaccharidosis is closer to that of the clinically diagnosed type IVA mucopolysaccharidosis. In addition, by selecting different rats as hybrid mothers, the severity of the disease phenotype of the rat model can be regulated. In summary, the animal model constructed by this application can meet a variety of different application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the specific implementation methods or the description of the prior art. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0026] Figure 1 A in the middle is the result of amino acid sequence comparison between human and rat. Figure 1 Middle B is the predicted protein structure of human GALNS before and after the p.M318R mutation;

[0027] Figure 2 Schematic diagram of the principle of constructing the GALNS p.M320R point mutation rat model for this application;

[0028] Figure 3 This is the gel electrophoresis detection diagram of F0 generation positive rats;

[0029] Figure 4 This is the Sanger sequencing peak diagram of F0 generation positive rats;

[0030] Figure 5 This is the Sanger sequencing peak diagram of the F1 generation positive rats;

[0031] Figure 6Gel electrophoresis images of PCR-RFLP amplification products of wild-type rats, heterozygous rats, and homozygous rats;

[0032] Figure 7 The figure shows the statistical results of GALNS enzyme activity in the peripheral blood of wild-type rats and homozygous rats;

[0033] Figure 8 The incisor appearance of wild-type rats and homozygous rats at three months of age is shown;

[0034] Figure 9 The statistical results are the average body weights of wild-type rats, heterozygous rats and homozygous rats;

[0035] Figure 10 The statistical results of the average weight of offspring obtained by hybridization of female parents with different genotypes;

[0036] Figure 11 For GALNS M318R / M318R Toluidine blue staining of rat offspring obtained by hybridization with female rats as maternal parents;

[0037] Figure 12 This is a phenotypic comparison chart of the offspring obtained by hybridizing female parents with different genotypes. DETAILED DESCRIPTION

[0038] In order to make the above-mentioned objects, features and advantages of the present application more clearly understood, the specific embodiments of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways than those described herein, and those skilled in the art can make similar improvements without violating the connotations of the present application. Therefore, the present application is not limited to the specific embodiments disclosed below.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the technical field of this application. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or can be prepared by existing methods.

[0040] In this application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0041] As used herein, "combination thereof", "any combination thereof", "any combination thereof" and the like include all suitable combinations of any two or more of the listed items.

[0042] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0043] Herein, "preferred", "better", "more preferred" and "suitable" are merely used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of this application.

[0044] In this application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be understood as limiting the scope of protection of this application.

[0045] In this application, the terms "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If a technical solution contains multiple "optional" clauses, each "optional" clause is independent unless otherwise specified and there are no contradictions or constraints.

[0046] In this application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0047] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, as well as each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to an integer within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1-10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

[0048] Traditional animal models for MPS type IVA are mostly mouse models, in which the GALNS gene is knocked out or a mutant GALNS protein is expressed. However, these mouse models exhibit subtle phenotypes, with only mild histological changes and abnormal ankle curvature, failing to fully replicate the clinical symptoms of MPS type IVA. The reported GALNS p.R386C mutation in rats mimics a common mutation associated with MPS type IVA outside of China. However, this model only gradually manifests skeletal phenotypes after one month of age. Furthermore, the survival rate after one month is less than 50%, making it difficult to study disease severity and stages.

[0049] Based on this, the first aspect of the present application provides a method for constructing a rat model of mucopolysaccharidosis type IVA, comprising steps S10 and S20:

[0050] Step S10: obtaining GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats;

[0051] Step S20: mating male GALNS p.M320R heterozygous mutant rats with female GALNS p.M320R homozygous mutant rats to construct the type IVA mucopolysaccharidosis rat model.

[0052] Compared with traditional mouse models, the point mutation rat model constructed using the method of the present application has genetic characteristics and symptoms similar to those of patients with the GALNS p.M318R mutation, which is common clinically in Asia. It can be used to simulate type IVA mucopolysaccharidosis carrying the GALNS p.M318R mutation at different stages and degrees of severity in clinical practice; and the rat model constructed in the present application has a good survival rate.

[0053] This study found that using rats with different genotypes as maternal parents can modulate the severity of phenotypic changes in offspring. Specifically, mice produced by crossing heterozygous males with homozygous females exhibit disease phenotypes earlier than offspring produced by self-fertilization of heterozygous rats. This approach can accelerate research progress, shorten experimental cycles, and facilitate a deeper understanding of disease mechanisms, allowing for intervention and research at earlier stages of the disease.

[0054] In some embodiments, in step S10, the step of obtaining a GALNS p.M320R heterozygous mutant rat includes steps S11 to S13:

[0055] Step S11: Design sgRNA and donor oligo for the GALNS p.M320R mutation of the target rat;

[0056] Step S12: Cas9 mRNA, sgRNA, and Donor Oligo are transferred into the fertilized eggs of target rats to obtain F0 generation rats with the GALNS p.M320R mutation;

[0057] Step S13: F0 generation rats were mated with wild-type rats to obtain GALNS p.M320R heterozygous mutant rats.

[0058] In some embodiments, in step S11, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:1.

[0059] Specifically, the nucleotide sequence shown in SEQ ID NO: 1 is as follows: TACGTTTGAAGGCGGGATGAGGG.

[0060] In some embodiments, in step S11, the nucleotide sequence of Donor Oligo is as shown in SEQ ID NO: 2.

[0061] Specifically, the nucleotide sequence shown in SEQ ID NO: 2 is as follows: TCCTCAGGTGGCAGCAATGGTCCCT TCCTGTGTGGGAAGCAGACTACGTTTGAAGGCGGGAGGAGGGAGCCTGCAATCGCTTG GTGGCCAGGGCACATTGCCGCAGGCCAGGTGAGTCACACA.

[0062] Using the above-mentioned specific nucleotide sequence sgRNA and Donor Oligo, a rat model containing the GALNS p.M320R point mutation can be quickly and efficiently constructed.

[0063] In some embodiments, in step S12, the transferring method is microinjection.

[0064] In some embodiments, the rat is a Sprague Dawley rat.

[0065] It can be understood that in step S20, the F1 generation heterozygotes obtained by mating the F0 generation rats with the wild-type rats include F1 generation male heterozygotes and F1 generation female heterozygotes.

[0066] Furthermore, homozygous females and homozygous males can be obtained by hybridizing heterozygous males of the F1 generation with heterozygous females of the F1 generation.

[0067] In some embodiments, in step S10, the step of obtaining a GALNS p.M320R homozygous mutant rat comprises:

[0068] Step S14: GALNS p.M320R heterozygous mutant rats were self-crossed to obtain GALNS p.M320R homozygous females.

[0069] It is understandable that in the above step S14, the female homozygous rats can be F2 generation female homozygous rats directly obtained by self-pollination of F1 generation heterozygotes, or can be offspring obtained by further breeding and mating with F2 generation rats as the mother.

[0070] In some embodiments, the above construction method further comprises the following step: identifying the genotype of the rat model using primers with nucleotide sequences such as SEQ ID NO: 3 and SEQ ID NO: 4.

[0071] Specifically, the nucleotide sequence shown in SEQ ID NO: 3 is as follows: TGTGCCTAATGAGTTCAGAAG.

[0072] Specifically, the nucleotide sequence shown in SEQ ID NO: 4 is as follows: CAGACTGAGGTCTCAGAAGGATAC.

[0073] In some embodiments, the method of identification using the above primer pairs comprises one or more of PCR and Sanger sequencing.

[0074] It is understandable that the above primers can also be used to identify the genotypes of F0 generation rats, F1 generation rats, F2 generation rats and their offspring rats.

[0075] In some embodiments, the construction method further comprises the step of identifying the genotype of the rat model using primers whose nucleotide sequences are shown as SEQ ID NO: 5 and SEQ ID NO: 6.

[0076] Specifically, the nucleotide sequence shown in SEQ ID NO: 5 is as follows: GTTCAGAAGTCAGGGTAGGCC.

[0077] Specifically, the nucleotide sequence shown in SEQ ID NO: 6 is as follows: CCTGCCCCTTGTAGTAAGTCC.

[0078] In some embodiments, the method of identifying SEQ ID NOs: 5-6 using primers includes PCR-RFLP (restriction fragment length polymorphism).

[0079] It is understandable that the above primers can also be used to identify the genotypes of F0 generation rats, F1 generation rats, F2 generation rats and their offspring rats.

[0080] Compared with PCR and Sanger sequencing, PCR-RFLP technology has the advantages of rapidity, high efficiency and low cost in identifying rat genotypes.

[0081] The rat model of mucopolysaccharidosis type IVA constructed using the method of the present application has at least the following advantages: first, the constructed rat model exhibits obvious disease phenotypes at 3 to 4 weeks of age, which is closer to the onset time of classic mucopolysaccharidosis type IVA; second, the above method can improve the survival rate of the rat model, thereby effectively improving the effectiveness of the experiment and saving experimental costs; in addition, the present application can regulate the severity of the phenotype of the animal model and can simulate mucopolysaccharidosis type IVA at different stages and degrees of clinical disease, and has broad application prospects.

[0082] The rat model constructed using the above method exhibits disease symptoms that are relatively close to those of patients with the clinical GALNSp.M318R mutation, providing new ideas for the research and analysis of mucopolysaccharidosis type IVA.

[0083] In a second aspect, the present application provides the use of a type IVA mucopolysaccharidosis rat model constructed by any of the above-mentioned construction methods in screening drugs for treating type IVA mucopolysaccharidosis.

[0084] The rat model constructed using the method of the present application can be used for disease mechanism research, drug development, efficacy evaluation and other related work of mucopolysaccharidosis type IVA, thereby promoting the research progress of the disease.

[0085] The present application will be further described below in conjunction with specific examples and comparative examples, but they should not be construed as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be sourced from commercial sources, the instruments used, unless otherwise specified, can all be sourced from commercial sources, and the processes involved, unless otherwise specified, are all routinely selected by those skilled in the art.

[0086] Example 1:

[0087] (1) Sequence alignment revealed that the GALNS p.M320R mutation in the rat genome (NM_001047851) was homologous to the GALNS p.M318R mutation in the human genome. Figure 1 Middle A is the amino acid sequence alignment between human and rat; Figure 1 Middle B shows the protein structure of human GALNSp.M318R before and after mutation.

[0088] Based on this, the applicant specifically designed and synthesized the sgRNA with the nucleotide sequence shown in SEQ ID NO: 1 and the Donor Oligo with the nucleotide sequence shown in SEQ ID NO: 2 for the GALNS p.M320R mutation in rats; the specific principle is as follows Figure 2 shown.

[0089] sgRNA (SEQ ID NO: 1)

[0090] TACGTTTGAAGGCGGGATGAGGG.

[0091] Donor Oligo (SEQ ID NO: 2)

[0092] TCCTCAGGTGGCAGCAATGGTCCCTTCCTGTGTGGGAAGCAGACTACGTTTGAAGG CGGGAGGAGGGAGCCTGCAATCGCTTGGTGCCAGGGCACATTGCCGCAGGCCAGGTG AGTCACACA.

[0093] (2) Construction of mutant rat model

[0094] (2.1) The synthesized sgRNA, donor oligo, and Cas9 mRNA were microinjected into fertilized eggs of Sprague-Dawley (SD) rats, and the fertilized eggs were then transplanted into the uterus of pseudopregnant female rats to obtain F0 generation rats.

[0095] (2.2) DNA was extracted from tail tissue samples of the F0 rats, and PCR amplification and Sanger sequencing analysis were performed using primers with nucleotide sequences as shown in SEQ ID NO: 3 (F1) and SEQ ID NO: 4 (R1), thereby screening two F0 generation positive rats (No. 6 and No. 9) containing the target mutation. Figure 3 The gel electrophoresis diagram of the PCR amplification products of rats No. 6 and No. 9 ( Figure 3 The channels from left to right in the gel electrophoresis image are: positive rat No. 9, positive rat No. 6, wild-type rat, water, and marker); Figure 4 This is the Sanger sequencing peak diagram of positive rats No. 6 and No. 9.

[0096] F1 (SEQ ID NO: 3)

[0097] TGTGCCTAACAATGAGTTCAGAAG.

[0098] R1 (SEQ ID NO: 4)

[0099] CAGACTGAGGTCTCAGAAGGATAC.

[0100] The PCR amplification reaction system (25 μL) included: 1.5 μL of rat tail tissue DNA sample, 1 μL of F1 primer, 1 μL of R1 primer, 12.5 μL of Green Taq Mix (Vazyme P131), and 9 μL of ddH2O.

[0101] The PCR amplification reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

[0102] (2.3) The F0 positive rats obtained by the above screening were mated with wild-type SD rats, and the primers with nucleotide sequences as shown in SEQ ID NO: 3 (F1) and SEQ ID NO: 4 (R1) were used for PCR amplification and Sanger sequencing analysis to obtain the stable inherited F1 generation positive rat GALNS M318R / + , Figure 5 This is the Sanger sequencing peak diagram of the F1 generation positive rats.

[0103] Based on the destruction of the BtsC1 recognition site by the above-mentioned point mutation, a primer pair for PCR-RFLP rapid genotyping technology was specifically designed, with the nucleotide sequences such as SEQ ID NO: 5 (F2) and SEQ ID NO: 6 (R2), which was used to type and identify wild-type, heterozygous and homozygous rats.

[0104] F2 (SEQ ID NO: 5)

[0105] GTTCAGAAGTCAGGGTAGGCC.

[0106] R2 (SEQ ID NO: 6)

[0107] CCTGCCCCTTGTAGTAAGTCC.

[0108] The PCR-RFLP reaction system (20 μL) included: 1 μL of rat tail tissue DNA sample, 0.5 μL of F2 primer, 0.5 μL of R2 primer, 10 μL of 2× Master Mix (Green Taq), and 8 μL of ddH2O.

[0109] The PCR-RFLP reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 5 min.

[0110] The product obtained after PCR-RFLP amplification was 360 bp in length. After digestion with BtsCI endonuclease, the PCR-RFLP amplification product of wild-type rats was digested to obtain fragments of 189 bp, 104 bp, and 67 bp. M318R / M318R After enzyme digestion, 265bp and 104bp fragments were obtained in rats; heterozygous GALNS M318R / + After enzyme digestion, the rat fragments of 265 bp, 189 bp and 104 bp were obtained. The gel electrophoresis of the PCR-RFLP amplification products is shown in the figure below. Figure 6 As shown (the channels from left to right are 100bpDNA ladder, homozygous GALNS M318R / M318R , wild type, homozygous GALNS M318R / M318R and heterozygous GALNS M318R / + ).

[0111] The enzyme digestion reaction system (20 μL) includes: 15 μL of PCR product, 2 μL of 10× CutSmart Buffer, 0.25 μL (5U) of restriction endonuclease BtsCI (20 U / uL), and 2.75 μL of H2O.

[0112] The enzyme digestion reaction includes the following steps: digestion at 50°C for 50 minutes, termination at 80°C for 5 minutes, natural cooling, and separation by electrophoresis on 2% agarose gel.

[0113] (2.4) The F1 generation positive rats were further mated with SD rats for at least three generations to eliminate the potential off-target effects caused by CRISPR / Cas9 technology and obtain stable heterozygous GALNS M318R / + .

[0114] (2.5) The stable heterozygous GALNS constructed in step (2.4) above M318R / + Self-pollination was performed to obtain homozygous GALNS M318R / M318R Rat.

[0115] Submandibular vein collection of wild-type rats, heterozygous GALNS M318R / + Rats and homozygous GALNS M318R / M318R The serum was separated from the peripheral blood of rats and incubated with the substrate 4-Methylumbelliferylβ-D-Galactopyranoside-6-SulfateSodium Salt (MCE, MU-Gal-6S) at 37°C for 17 hours to measure the fluorescent substrate obtained in the reaction to detect the activity of GALNS enzyme in the peripheral blood of three rats. The results are shown in Figure 2. Figure 7 Shown: Homozygous GALNS M318R / M318RThe GALNS enzyme activity in the peripheral blood of rats was significantly reduced, about 20% of the wild type.

[0116] Compared with wild-type rats, GALNS M318R / M318R When rats grow to three months old, abnormal incisor growth can be seen, as shown in the following example: Figure 8 shown.

[0117] At the age of 4 weeks, 8 weeks, 12 weeks, 16 weeks and 20 weeks, 4 to 5 wild-type rats, heterozygous rats and homozygous rats were weighed and the average body weight was calculated. Figure 9 As shown: Compared with wild type rats, the body weight of homozygous rats did not decrease significantly until 12 weeks of age.

[0118] At the same time, the survival rate of the rat offspring obtained by the above construction was statistically analyzed, and the statistical results of the survival rate around 150 days after birth are shown in Table 1.

[0119] Table 1

[0120]

[0121] The above results indicate that a rat model with a skeletal system phenotype of mild type IVA mucopolysaccharidosis was successfully constructed using the specific sgRNA, donor oligo and method of the present application.

[0122] (2.6) Further, with GALNS M318R / + Male rats were used as fathers and GALNS M318R / M318R When female rats were used as maternal parents, the resulting homozygous offspring weighed significantly less than their heterozygous siblings at 3 to 4 weeks of age and developed disease phenotypes earlier than rats homozygous for the p.R386C mutation, generated using conventional techniques. This suggests that offspring derived from hybrids using homozygous rats as maternal parents can develop skeletal phenotypes earlier.

[0123] Specifically, GALNS M318R / + The offspring of heterozygous rats obtained by self-fertilization and the offspring of rats with GALNS M318R / + Male rats were used as fathers and GALNS M318R / M318R The statistical results of the average weight of the offspring of rats obtained by hybridization with female rats as the mother within 42 days of age are shown in Table 2 and Figure 10 shown.

[0124] Table 2 (unit: g)

[0125]

[0126] At 6 weeks of age, the above-mentioned GALNS M318R / M318RThe offspring of the rats GALNS were obtained by hybridization with female rats as the mother. M318R / M318R and GALNS M318R / + The tibial bone tissue was decalcified and paraffin-embedded, and the tissue sections were stained with toluidine blue and observed microscopically. Figure 11 Shown: GALNS M318R / M318R At 6 weeks of age, the chondrocytes in the resting and proliferative zones of the bone growth plate of homozygous rats have become hypertrophic, while the chondrocytes in the proliferative zone are disordered and their number is significantly reduced. M318R / M318R Female rats as maternal GALNS M318R / M318R The offspring had stiff limbs, altered gait, and X-rays showed scoliosis in addition to dental dysplasia. Figure 12 ), while the heterozygote self-crossed GALNS M318R / M318R At three months of age, only dental hypoplasia was observed, and the spinal column was normal in morphology.

[0127] Furthermore, the above-mentioned GALNS M318R / M318R The survival rates of rat offspring obtained by hybridization with female rats as maternal parents were statistically analyzed, and the statistical results of survival rates around 150 days after birth are shown in Table 3.

[0128] Table 3

[0129]

[0130] In summary, the above-mentioned method of the present application can construct a rat model of mucopolysaccharidosis type IVA that has both a skeletal system phenotype and a good survival rate; at the same time, the model shows growth and development disorders in infancy, which is closer to the onset time of mucopolysaccharidosis type IVA clinically; in addition, the present application can also construct rat models with different degrees of severity, thereby meeting different research purposes and application scenarios.

[0131] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0132] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present application, and these modifications and improvements fall within the scope of protection of the present application. Therefore, the scope of protection of the present application shall be determined by the appended claims.

Claims

1. A method for constructing a rat model of mucopolysaccharidosis type IVA, characterized in that: The steps include: Obtain GALNS p.M320R heterozygous mutant rats and GALNS p.M320R homozygous mutant rats; Male GALNS p.M320R heterozygous mutant rats were mated with female GALNS p.M320R homozygous mutant rats to establish the type IVA mucopolysaccharidosis rat model.

2. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 1, characterized in that: The steps for obtaining GALNS p.M320R heterozygous mutant rats include: Design sgRNA and Donor Oligo for the target rat GALNS p.M320R mutation; The Cas9 mRNA, the sgRNA, and the Donor Oligo were transferred into the fertilized eggs of target rats to obtain F0 generation rats with the GALNSp.M320R mutation; The F0 generation rats were mated with wild-type rats to obtain the GALNS p.M320R heterozygous mutant rats.

3. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 2, characterized in that: The steps of obtaining the GALNS p.M320R homozygous female mutant rats include: The GALNS p.M320R heterozygous mutant rats were self-crossed to obtain the GALNS p.M320R homozygous females.

4. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 2, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1.

5. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 2, characterized in that: The nucleotide sequence of the Donor Oligo is shown in SEQ ID NO:

2.

6. The method for constructing a rat model of mucopolysaccharidosis type IVA according to any one of claims 1 to 5, characterized in that: The construction method further comprises the following step: using primers with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 to identify the genotype of the rat model.

7. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 6, characterized in that: The identification method includes one or more of PCR and Sanger sequencing.

8. The method for constructing a rat model of mucopolysaccharidosis type IVA according to any one of claims 1 to 5, characterized in that: The construction method further comprises the following step: using primers with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6 to identify the genotype of the rat model.

9. The method for constructing a rat model of mucopolysaccharidosis type IVA according to claim 8, characterized in that: The identification method includes PCR-RFLP.

10. Use of the mucopolysaccharidosis type IVA rat model constructed by the construction method according to any one of claims 1 to 9 in screening drugs for treating mucopolysaccharidosis type IVA.

Citation Information

Patent Citations

  • Construction method and application of Sox30 knockout and restorable mouse animal model

    CN110616232A

  • Construction method of dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model

    CN110777167A