Medicine for improving senescence of corium layer tissue and application thereof

Abstract

The invention provides a medicine for improving dermal layer tissue aging and application thereof, and belongs to the technical field of biomedicine, the medicine comprises a miR-940 inhibitor used for down-regulating the expression quantity of miR-940 in aging fibroblasts, and the nucleotide sequence of miR-940 is shown as SEQ ID NO: 1. The invention has important significance in the aspects of in-depth study of a fibroblast aging mechanism, discovery of aging markers and potential anti-aging treatment means.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedical technology, and in particular to a drug for improving dermal tissue aging and application thereof. Background Art

[0002] Dermal fibroblasts (FB) are the main cell type in the dermis of the skin and are responsible for the synthesis of collagen, elastin and other extracellular matrix (ECM) proteins, which are essential for maintaining the structure and function of the skin. With age, dermal fibroblasts undergo senescence, which is often referred to as cellular senescence or replicative senescence, and this process is closely related to the overall aging of the skin. Characteristics of cellular senescence include a decrease in cell proliferation ability, changes in cell morphology and function, cell cycle arrest, and changes in the cell secretory phenotype. In dermal fibroblasts, senescence leads to a decrease in the synthesis of collagen and elastin, while increasing the expression of matrix metalloproteinases (MMPs), which can degrade ECM proteins, resulting in a decrease in skin elasticity and firmness. In addition, senescent fibroblasts also produce more pro-inflammatory cytokines and free radicals, such as interleukins (ILs), tumor necrosis factor α (TNF-α), and reactive oxygen species (ROS), which can trigger or aggravate inflammatory responses, damage surrounding healthy cells, and accelerate the skin aging process. Another important feature of skin aging is the accumulation of DNA damage, which affects the normal function of dermal fibroblasts. Over time, the ability to repair DNA damage decreases, leading to further deterioration of genetic stability and cell function. In general, the aging of dermal fibroblasts is closely related to skin aging. As fibroblast function declines, the skin's regenerative and repair abilities weaken, ultimately leading to significant aging changes in the skin's appearance and function. Therefore, studying how to delay or reverse the aging process of fibroblasts is of great significance for the development of anti-aging treatment strategies.

[0003] MicroRNAs (miRNAs) are a class of short non-coding RNA molecules that regulate gene expression at the post-transcriptional level. They regulate cell differentiation, proliferation, apoptosis and aging by binding to the 3'UTR (untranslated region) of target mRNA. The role of miRNAs in fibroblast aging suggests that they can be used as biomarkers of cell aging status and may become new targets for anti-aging treatment. Although studies have revealed the role of miRNAs in cell aging, the specific application of many miRNAs as fibroblast aging markers has not yet been clarified. Summary of the invention

[0004] In order to overcome the problems existing in the related technologies, this specification provides a drug for improving the aging of dermal tissue and its application, which is of great significance in the in-depth study of the aging mechanism of fibroblasts, the discovery of aging markers, and potential anti-aging treatments.

[0005] According to a first aspect of the present disclosure, a drug for improving aging of dermal tissue is provided, comprising:

[0006] The miR-940 inhibitor is used to downregulate the expression of miR-940 in senescent fibroblasts, wherein the nucleotide sequence of the miR-940 is shown in SEQ ID NO: 1.

[0007] In some exemplary embodiments, the miR-940 inhibitor is capable of increasing the viability of senescent fibroblasts.

[0008] According to a second aspect of the present disclosure, there is provided a use of a biomarker in preparing a product for diagnosis, auxiliary diagnosis, and treatment of dermal tissue aging, wherein the biomarker is a fibroblast aging biomarker, comprising:

[0009] miR-940, the nucleotide sequence is shown in SEQ ID NO:1.

[0010] In some exemplary embodiments, the expression level of miR-940 in senescent fibroblasts is higher than that in young fibroblasts.

[0011] According to a third aspect of the present disclosure, there is provided a kit set for detecting in vitro dermal tissue, comprising an RNA reverse transcription kit and a PCR amplification kit, wherein the RNA reverse transcription kit is used to reverse transcribe RNA containing fibroblast aging biomarkers to synthesize cDNA, and the PCR amplification kit is used to amplify the cDNA synthesized by reverse transcription;

[0012] Wherein, the fibroblast aging biomarker includes miR-940, and the nucleotide sequence is shown in SEQ ID NO:1.

[0013] In some exemplary embodiments, the RNA reverse transcription kit comprises:

[0014] The reverse transcription primer has a nucleotide sequence as shown in SEQ ID NO:2.

[0015] In some exemplary embodiments, the PCR amplification kit comprises:

[0016] Forward primer, the nucleotide sequence is shown in SEQ ID NO: 3;

[0017] The reverse primer has a nucleotide sequence as shown in SEQ ID NO:4.

[0018] According to a fourth aspect of the present disclosure, a method for detecting in vitro dermal tissue is provided, wherein the detection is performed using the kit set for in vitro dermal tissue sample detection as described in the third aspect.

[0019] In some exemplary embodiments, a method of detecting dermal tissue in vitro includes:

[0020] Extracting RNA from dermal tissue, and using the RNA reverse transcription kit to reverse transcribe and synthesize cDNA;

[0021] Amplifying the cDNA synthesized by reverse transcription using the PCR amplification kit;

[0022] The expression level of miR-940 was determined.

[0023] According to the fifth aspect of the present disclosure, provided is the use of a drug for improving dermal tissue aging as described in the first aspect, a kit set for detecting in vitro dermal tissue as described in the second aspect, and a method for detecting in vitro dermal tissue as described in the third aspect in the preparation of products for diagnosis, auxiliary diagnosis, and treatment of dermal tissue aging.

[0024] The technical solution provided by the present disclosure may have the following beneficial effects:

[0025] The present invention collects dermal tissue samples from people aged 20-30 (young group, group Y) and people aged 50-70 (senile group, group S), and uses RT-PCR technology to detect the difference in the expression of miR-940 in the dermal tissue of the two groups of people. The results show that the expression of miR-940 in the senile group is significantly higher than that in the young group, indicating that miR-940 may be a potential marker of dermal tissue aging.

[0026] The present invention uses natural passage to induce fibroblast senescence in vitro, constructs a FB cell senescence model (the 4th generation FB cells are set as the young group, and the 20th generation cells are set as the aged group), and uses RT-PCR technology to detect the difference in the expression of miR-940 in the dermis tissue of the two groups of people. The results showed that the expression of miR-940 in the aged group was significantly higher than that in the young group, further indicating that miR-940 may be a potential marker of dermis tissue senescence.

[0027] The present invention verifies the anti-aging effect of miR-940 inhibitor on FB cells, and uses young FB cells and aged FB cells as the young group and aged group in the control group, respectively, and uses aged FB cells transfected with miR-940 inhibitor (miR-940inhibitor) as the drug-treated group (miR-940-in). The results showed that using the C12FDG staining method, the average fluorescence intensity of C12FDG staining in the aged group increased significantly compared with the young group, while the average fluorescence intensity of the drug-treated group decreased significantly compared with the aged group. Using the CCK8 kit, the viability of aged FB cells in the aged group decreased significantly compared with the young group, while the viability of FB cells in the drug-treated group increased significantly compared with the aged group. The above shows that miR-940-in can restore the cell viability of aged FB cells.

[0028] Through a series of experiments, the present disclosure found that there is a significant difference in the expression of miR-940 between young and old people. This result provides a new specific biomarker for identifying and monitoring skin aging. The discovery of this biomarker provides a new method to improve skin health, enhance skin regeneration and slow down the aging process.

[0029] In summary, the present disclosure is of great significance in the in-depth study of the aging mechanism of fibroblasts, the discovery of aging markers, and potential anti-aging treatments.

[0030] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present specification. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the specification and, together with the description, serve to explain the principles of the specification.

[0032] Figure 1 This is a graph showing the differential expression of miR-940 in the dermis tissue of the aging population and the young population in Example 1 of the present disclosure;

[0033] Figure 2 This is a diagram showing the results of β-galactosidase detection and identification of senescent generation fibroblasts in Example 2 of the present disclosure;

[0034] Figure 3 This is a diagram showing the results of β-galactosidase detection and identification of young generation fibroblasts in Example 2 of the present disclosure;

[0035] Figure 4 This is a diagram showing the results of C12FDG staining detection and identification of senescent and young generation fibroblasts in Example 2 of the present disclosure;

[0036] Figure 5 is a graph showing the differential expression of miR-940 in aged fibroblasts and young fibroblasts in Example 3 of the present disclosure;

[0037] Figure 6 This is a graph showing the effect of the miR-940 inhibitor on fibroblast senescence in Example 4 of the present disclosure;

[0038] Figure 7 This is a graph showing the effect of the miR-940 inhibitor on fibroblast viability in Example 4 of the present disclosure. DETAILED DESCRIPTION

[0039] Example embodiments will now be described more fully with reference to the accompanying drawings. However, the example embodiments can be implemented in a variety of forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present disclosure will be comprehensive and complete and fully convey the concepts of the example embodiments to those skilled in the art. The same reference numerals in the figures represent the same or similar structures, and thus their detailed description will be omitted. In addition, the drawings are only schematic illustrations of the present disclosure and are not necessarily drawn to scale.

[0040] The terms "a", "an", "the", "said" and "at least one" are used to indicate the presence of one or more elements / components / etc.; the terms "including" and "having" are used to express an open-ended inclusive meaning and mean that additional elements / components / etc. may exist in addition to the listed elements / components / etc.; the terms "first", "second" and "third" etc. are used merely as labels and are not intended to limit the quantity of their objects.

[0041] The term "and / or" or "and / or" refers to any and all combinations of one or more of the associated listed items.

[0042] The term "plurality" means more than two; "multiple" means more than two; and "above" when combined with a number to express a quantity includes the number itself, for example "more than two" includes two.

[0043] The term "diagnosis" includes auxiliary diagnosis, recurrence risk assessment, assessment of cancer risk and degree, and prognosis.

[0044] The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. The typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. The typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.

[0045] Reverse Transcription (RT): In this step, a specific RNA molecule (usually mRNA) is transcribed into cDNA (complementary DNA) by reverse transcriptase (a special DNA polymerase). Reverse transcriptase is able to synthesize a DNA chain on the RNA template, and this process requires a primer that specifically binds to the RNA sequence.

[0046] Polymerase Chain Reaction (PCR): The cDNA obtained by reverse transcription is then used as a template for PCR. During the PCR process, a specific DNA sequence is recognized and amplified by a pair of primers. PCR increases the target DNA sequence exponentially through repeated denaturation, annealing, and extension steps, so that it can be detected and analyzed.

[0047] The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a portion thereof. Typically, the PCR primers used to amplify a polynucleotide sequence can be random primers or specific primers. The exact length of the primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnosis and prognosis applications, oligonucleotide primers typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence.

[0048] "Random primer" refers to the use of random hexamers, a non-specific primer, to copy the full-length mRNA when it is difficult to copy the full-length sequence of a specific mRNA because it contains a sequence that terminates the reverse transcriptase. When using this method, all RNA molecules in the system serve as cDNA first-strand templates, and the specificity required by the PCR primer during the amplification process is usually used to synthesize cDNA using this primer.

[0049] "Specific primers" are short DNA fragments used in molecular biology experiments. They are designed to complement specific regions of target DNA or RNA sequences. Unlike random primers, the sequence of specific primers is predetermined and is usually designed based on the known sequence of the target gene or RNA molecule.

[0050] The term "RT-PCR", which stands for Reverse Transcription Polymerase Chain Reaction, is a molecular biology technique used to detect and quantify specific RNA molecules. This technique combines two main steps: reverse transcription and polymerase chain reaction (PCR).

[0051] The term "trizol" is a total RNA extraction reagent that can extract total RNA directly from cells or tissues. It contains substances such as phenol and guanidine isothiocyanate, which can quickly break cells and inhibit nucleases released by cells. The main component of trizol is phenol. Trizol can maintain the integrity of RNA when breaking and dissolving cells, so it is very useful for purifying RNA and standardizing RNA production.

[0052] The term "DEPC water" is water treated with diethyl pyrocarbonate, a reagent commonly used in molecular biology experiments to remove RNase (ribonuclease) and other enzymes that may contaminate the experiment. DEPC is an effective RNase inhibitor that reacts with the active site in RNase, thereby inhibiting its activity.

[0053] The term "X-gal", also known as 5-Bromo-4-chloro-3-indolylβ-D-galactopyranoside or 5-Bromo-4-chloro-3-indolylβ-D-galactoside, X-Gal is a chromogenic substrate of β-galactosidase, which produces a blue product under the catalysis of β-galactosidase. It is often used for in situ staining detection of β-galactosidase and blue-white screening.

[0054] The term "C12FDG" refers to 5-dodecanoylaminofluorescein di-β-D-galactopyranoside, which is a lipophilic green fluorescent substrate for β-galactosidase detection and can detect the content of intracellular β-galactosidase.

[0055] The term "Formazan" is a compound commonly used in biochemistry and molecular biology experiments. It is generated by the reduction of tetrazole compounds (such as MTT or WST-8) by dehydrogenases in living cells. Formazan formation is an indicator of cell activity and is often used to assess cell proliferation, cytotoxicity, and cell survival.

[0056] Example 1 Differential expression analysis of miR-940 in skin dermis samples of young and old people

[0057] 1.1 Sample collection

[0058] In this embodiment, people aged 20-30 are set as the young group (Y), and people aged 50-70 are set as the aging group (S). Ten dermis tissue samples are taken from group Y and ten dermis tissue samples are taken from group S, respectively.

[0059] 1.2 RNA extraction

[0060] (1) The collected tissue or cells were placed in 1 ml of trizol for lysis. The tissue was additionally ground and centrifuged. After standing at room temperature for 5 min, the cells were repeatedly blown;

[0061] (2) Transfer the lysate into a 1.5 mL EP tube (centrifuge tube), add 0.2 times the volume of chloroform, shake for 15 seconds, leave at room temperature for 3 minutes, and centrifuge at 12,000 rpm for 10 minutes;

[0062] (3) Pipette the upper aqueous phase into a new EP tube, then add an equal volume of isopropanol and mix thoroughly by inversion; centrifuge at 12,000 rpm for 5 min and discard the filtrate in the collection tube;

[0063] (4) Add 1 ml of 70% ice-cold ethanol to the EP tube, centrifuge at 12,000 rpm for 5 min, and discard the filtrate in the EP tube;

[0064] (5) Dry the residual ethanol at room temperature, add 50 μL of DEPC water, cover the lid, and leave at room temperature for 3 min to dissolve the RNA;

[0065] (6) Measure the concentration and purity of the extracted RNA using an ultra-micro spectrophotometer and store at -80°C.

[0066] 1.3RT-PCR detection

[0067] An RNA reverse transcription kit was used to perform reverse transcription using the extracted RNA as a template. The reverse transcription primer sequence was CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGGGAGCG (SEQ ID NO: 2). The reverse transcription primer was a random primer. The reaction system was shown in Table 1.

[0068] Table 1

[0069] Tissue composition 20ul system 2×ES reaction mix 10ul Random primer 1ul Total RNA template 500ng RNase-free water (DEPC water) Make up to 20ul

[0070] A PCR amplification kit was used to perform PCR amplification using the reversed cDNA as a template, wherein the primer sequences used to detect the cDNA product are shown in SEQ ID NOs: 3-4, the PCR amplification system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0071] Forward primer: AGTGTCGTCAGAAGGCAGGGCC (SEQ ID NO: 3)

[0072] Reverse primer: CTCAACTGGTGTCGTGGAGTC (SEQ ID No: 4)

[0073] Table 2

[0074]

[0075]

[0076] Table 3

[0077]

[0078] In this example, the population aged 20-30 was set as the young group (Y), and the population aged 50-70 was set as the aging group (S). Ten dermis tissue samples were taken from the Y group and 10 dermis tissue samples were taken from the S group. The expression difference of miR-940 (sequence: UGGGUUGCCUGUCUUGCUUGG, SEQ ID NO: 1) in the dermis tissue of the two groups was detected by RT-PCR technology. The results are as follows: Figure 1 As shown (the horizontal axis is the grouping, and the vertical axis is the expression level of miR-940). The expression level of miR-940 in group S was significantly higher than that in group Y, indicating that miR-940 may be a potential marker of dermal tissue aging.

[0079] Example 2 Construction of fibroblast senescence model and verification of the correlation between miR-940 and fibroblast senescence

[0080] 2.1 Construction of fibroblast senescence model

[0081] Using natural passage to induce fibroblast (FB) senescence in vitro, β-galactosidase staining was first used to detect cell senescence. Most normal cells are believed to have limited division ability and enter senescence after they cannot divide. Senescent cells usually become larger in size and express β-galactosidase, which has high enzyme activity at pH 6.0. Using X-Gal as a substrate, a dark blue product is generated under the catalysis of senescence-specific β-galactosidase. Therefore, it is easy to observe cells expressing β-galactosidase that turn blue under an optical microscope.

[0082] (1) Inducing natural cell senescence by cell culture

[0083] ① Culture FB cells and subculture them at a ratio of 1:2 when the cell confluence reaches 100%;

[0084] ② The 4th generation FB cells were set as the young group, and the 20th generation cells were set as the aging group.

[0085] (2) Detection of cell senescence by β-galactosidase staining

[0086] The β-galactosidase staining kit (purchased from Bio-Tech Biotechnology Co., Ltd.) was used for staining. The specific steps are as follows:

[0087] ① For cells cultured in 6-well plates, remove the cell culture medium, wash once with PBS or HBSS, add 1 ml of β-galactosidase staining fixative, and fix at room temperature for 15 minutes. For other types of culture plates, refer to this ratio for the amount of fixative and subsequent solutions;

[0088] ② Remove the cell fixative and wash the cells three times with phosphate-buffered saline (PBS) or Hanks' balanced salt solution (HBSS), each time for 3 minutes;

[0089] ③ Aspirate PBS or HBSS and add 1 ml of staining solution to each well. For the preparation method of staining solution, refer to Table 4;

[0090] Table 4

[0091] Tissue composition 20ul system β-Galactosidase staining solution A 10μl β-Galactosidase staining solution B 10μl β-Galactosidase staining solution C 930μl X-Gal Solution 50μl

[0092] ④Incubate at 37℃ overnight. You can seal the 6-well plate with sealing film or plastic wrap to prevent evaporation. Note: Incubation at 37℃ cannot be performed in a carbon dioxide incubator;

[0093] ⑤Observe under ordinary optical microscope and use Image-J software to analyze and count positive cells.

[0094] The staining results are as follows Figure 2 (Group Y) and Figure 3 As shown in (S group), it was found that most cells in the S group had a darker blue dye staining by β-galactosidase staining, while only a small number of cells in the Y group had a lighter blue dye staining. The above results indicate that the FB aging cell model has been successfully constructed.

[0095] (3) C12FDG staining to detect cell senescence

[0096] ① Cultivate cells overnight at a density of 5×105 cells / mL in a 6-well plate;

[0097] ② Wash the cells once with 200 μL PBS, and then fix them with 100 μL fixative (2% formaldehyde / 0.2% glutaraldehyde in distilled water) at room temperature for 5 minutes;

[0098] ③ Wash the cells twice with 200 μL PBS and stain with 100 μL 33 μM C12FDG (PBS, pH=6.0) for 10 minutes;

[0099] ④ Detection was performed using a flow cytometer with 488 nm excitation light.

[0100] The results are as follows Figure 4 As shown, the ordinate is the fluorescence intensity and the abscissa is the grouping. Compared with the Y group, the average fluorescence intensity of C12FDG staining in the S group increased significantly. The above results further indicate that the FB senescent cell model has been successfully constructed.

[0101] 2.2RT-PCR detection

[0102] The operation steps are the same as 1.3.

[0103] In this example, FB cell senescence was induced in vitro by natural passage to construct an FB senescence model. The relative expression of miR-940 in senescent (S) and non-senescent (Y) FB cells was then detected by RT-PCR. Figure 5 As shown in the figure, the expression level of miR-940 in the FB cells of group S was significantly upregulated compared with that in the FB cells of group Y, indicating that miR-940 may be a potential senescence marker of dermal fibroblasts.

[0104] Example 3: Verification of the anti-aging effect of miR-940 inhibitor on FB cells

[0105] 3.1C12FDG staining

[0106] Young FB cells and senescent FB cells cultured with ordinary DMEM complete medium (purchased from Gibco, with a formula of DMEM + 10% fetal bovine serum) were used as the young group (Y) and senescent group (S) in the control group, respectively, and senescent FB cells transfected with miR-940 inhibitor (miR-940inhibitor) were used as the drug treatment group (miR-940-in). The inhibitory effect of miR-940inhibitor on FB cell aging was detected by C12FDG staining. The specific operation method refers to Example 2.

[0107] The results are as follows Figure 6 As shown, it was found that the average fluorescence intensity of C12FDG staining in group S was significantly increased compared with group Y, while the average fluorescence intensity of miR-940-in group was significantly decreased compared with group S. The above results indicate that miR-940 inhibitors can significantly inhibit FB cell senescence.

[0108] 3.2 Detection of FB cell proliferation ability by CCK8 kit

[0109] The proliferation ability of FB cells was detected by the Cell Counting Kit-8 detection kit (Shanghai Biyuntian Biotechnology Co., Ltd.), referred to as the CCK8 kit. CCK8 is a kit based on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylbenzene)-2H-tetrazolyl monosodium salt)) and is widely used in the rapid and highly sensitive detection of cell proliferation and cytotoxicity. WST-8 is a compound similar to MTT ((3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)) and can be reduced by some dehydrogenases in mitochondria to generate orange-yellow formazan in the presence of electron coupling reagents. The more and faster the cell proliferation, the darker the color; the lower the cell activity, the lighter the color. For the same cells, the depth of color is linearly related to the number of cells. The specific operation steps are as follows:

[0110] ① The cells were divided into Y, S, and miR-940-in groups according to the experiment. 100 μL of 2000 FB cell inoculum was added to each well of a 96-well plate, with 6 replicate wells in each group;

[0111] ②After 48 h of culture, add 10 μL CCK-8 solution to each well;

[0112] ③Continue incubating in the cell culture incubator for 3 hours;

[0113] ④Measure the absorbance at 450nm.

[0114] The results are as follows Figure 6As shown, compared with the Y group, the cell viability of senescent FB cells in the S group was significantly decreased, while compared with the S group, the FB cell viability in the miR-940-in group was significantly increased, and statistics showed that there was no statistical difference between it and the Y group, proving that miR-940-in can restore the cell viability of senescent FB cells.

[0115] The present invention collects dermal tissue samples from people aged 20-30 (young group, group Y) and people aged 50-70 (senile group, group S), and uses RT-PCR technology to detect the difference in the expression of miR-940 in the dermal tissue of the two groups of people. The results show that the expression of miR-940 in the senile group is significantly higher than that in the young group, indicating that miR-940 may be a potential marker of dermal tissue aging.

[0116] The present invention uses natural passage to induce fibroblast senescence in vitro, constructs a FB cell senescence model (the 4th generation FB cells are set as the young group, and the 20th generation cells are set as the aged group), and uses RT-PCR technology to detect the difference in the expression of miR-940 in the dermis tissue of the two groups of people. The results show that the expression of miR-940 in the aged group is significantly higher than that in the young group, further indicating that miR-940 may be a potential marker of dermis tissue aging.

[0117] The present invention verifies the anti-aging effect of miR-940 inhibitor on FB cells, and uses young FB cells and aged FB cells as the young group and aged group in the control group, respectively, and uses aged FB cells transfected with miR-940 inhibitor (miR-940inhibitor) as the drug-treated group (miR-940-in). The results showed that using the C12FDG staining method, the average fluorescence intensity of C12FDG staining in the aged group increased significantly compared with the young group, while the average fluorescence intensity of the drug-treated group decreased significantly compared with the aged group. Using the CCK8 kit, the viability of aged FB cells in the aged group decreased significantly compared with the young group, while the viability of FB cells in the drug-treated group increased significantly compared with the aged group. The above shows that miR-940-in can restore the cell viability of aged FB cells.

[0118] Through a series of experiments, the present disclosure found that there is a significant difference in the expression of miR-940 between young and old people. This result provides a new specific biomarker for identifying and monitoring skin aging. The discovery of this biomarker provides a new method to improve skin health, enhance skin regeneration and slow down the aging process.

[0119] In summary, the present disclosure is of great significance in the in-depth understanding of the aging mechanism of fibroblasts, the discovery of aging markers, and potential anti-aging treatments.

[0120] Those skilled in the art will readily appreciate other embodiments of the present disclosure after considering the specification and practicing the invention disclosed herein. This application is intended to cover any modification, use or adaptation of the present disclosure, which follows the general principles of the present disclosure and includes common knowledge or customary techniques in the art that are not disclosed in the present disclosure. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present disclosure are indicated by the appended claims.

Claims

1. A drug for improving dermal tissue aging, characterized in that: include: The miR-940 inhibitor is used to downregulate the expression of miR-940 in senescent fibroblasts, wherein the nucleotide sequence of miR-940 is shown in SEQ ID NO:

1.

2. The drug for improving dermal tissue aging according to claim 1, characterized in that: The miR-940 inhibitor can enhance the viability of senescent fibroblasts.

3. Use of a biomarker in the preparation of a product for diagnosis, auxiliary diagnosis, and treatment of dermal tissue aging, characterized in that: The biomarkers are fibroblast aging biomarkers, including: miR-940, the nucleotide sequence is shown in SEQ ID NO:

1.

4. The use according to claim 2, characterized in that: The expression level of miR-940 in senescent fibroblasts is higher than that in young fibroblasts.

5. A kit for detecting in vitro dermal tissue, characterized in that: It comprises an RNA reverse transcription kit and a PCR amplification kit, wherein the RNA reverse transcription kit is used to reverse transcribe RNA containing fibroblast aging biomarkers to synthesize cDNA, and the PCR amplification kit is used to amplify the cDNA synthesized by reverse transcription; Wherein, the fibroblast aging biomarker includes miR-940, and the nucleotide sequence is shown in SEQ ID NO:

1.

6. The kit for detecting in vitro dermal tissue according to claim 5, characterized in that: The RNA reverse transcription kit comprises: The reverse transcription primer has a nucleotide sequence as shown in SEQ ID NO:

2.

7. The kit for detecting in vitro dermal tissue according to claim 5, characterized in that: The PCR amplification kit comprises: Forward primer, the nucleotide sequence is shown in SEQ ID NO:3; The reverse primer has a nucleotide sequence as shown in SEQ ID NO:

4.

8. A method for detecting dermal tissue in vitro, characterized in that: The detection is performed using the kit set for in vitro dermal tissue sample detection as described in any one of claims 5 to 7.

9. The method for detecting in vitro dermal tissue according to claim 8, characterized in that: include: Extracting RNA from dermal tissue, and using the RNA reverse transcription kit to reverse transcribe and synthesize cDNA; Amplifying the cDNA synthesized by reverse transcription using the PCR amplification kit; The expression level of miR-940 was determined.

10. Use of the drug for improving dermal tissue aging as claimed in claim 1 or 2, the kit set for detecting in vitro dermal tissue as claimed in any one of claims 5 to 7, or the method for detecting in vitro dermal tissue as claimed in claim 8 or 9 in the preparation of products for diagnosis, auxiliary diagnosis, and treatment of dermal tissue aging.

Images