Novel anti-tuberculosis medicine for targeting mycobacterium DNA (deoxyribonucleic acid) gyrase aggregate fibrosis

Abstract

The invention relates to the field of biotechnology and pharmacy, in particular to a novel anti-tuberculosis medicine for targeting mycobacterium DNA rotary enzyme aggregate fibrosis, which comprises an aggregate-fibrosis inducer of mycobacterium tuberculosis DNA rotary enzyme, such as MfpA; according to the present invention, the condensation body-fibrosis characteristic of the mycobacterium tuberculosis DNA rotary enzyme is firstly adopted as the new tuberculosis treatment target, based on the condensation body-fibrosis characteristic of the mycobacterium tuberculosis DNA rotary enzyme, the DNA simulation protein such as MfpA is adopted so as to induce the phase change from the liquid to the solid in the DNA rotary enzyme, and in addition, the phase change of the liquid to the solid can be further induced; the MfpA4-7 protein fragment can further promote fibrosis of the DNA gyrase aggregate, so that the effect of the medicine is enhanced.

Description

Technical Field

[0001] The invention relates to the fields of biotechnology and pharmaceuticals, and in particular to a novel anti-tuberculosis drug targeting the fibrillation of mycobacterial DNA gyrase aggregates. Background Art

[0002] Tuberculosis, an ancient global infectious disease, is still ravaged by Mycobacterium tuberculosis, posing a heavy burden on global public health. With the widespread use of antibiotics, although the spread of tuberculosis has been curbed for a time, the rapid rise of drug resistance, especially the emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis strains, has made traditional treatment methods face unprecedented difficulties, which not only aggravates the difficulty and pain of treatment for patients, but also poses a severe challenge to the global tuberculosis prevention and control system.

[0003] In this context, it is particularly urgent and important to develop new anti-tuberculosis drugs, especially innovative therapies that can target drug resistance mechanisms and attack the root causes of the disease. Fluoroquinolones are one of the key weapons in the current treatment of drug-resistant tuberculosis. They inhibit the function of DNA gyrase A subunit (GyrA), effectively blocking bacterial DNA synthesis and demonstrating strong antibacterial activity. However, the rapid evolution of drug resistance continues to weaken this advantage, forcing the scientific community to constantly look for new breakthroughs.

[0004] The discovery of the new antibiotic Evybactin has brought new hope for the treatment of drug-resistant tuberculosis. It also acts on the A subunit of DNA gyrase, but its unique mechanism of action and potential broad-spectrum activity indicate that it may be possible to overcome existing drug resistance problems. However, any new drug must be carefully evaluated before its promotion for the risk of drug resistance it may cause to ensure its effectiveness and safety in long-term use.

[0005] Therefore, exploring new drug targets and developing innovative drug strategies are of great significance for breaking the deadlock of drug-resistant tuberculosis and protecting global public health security, bringing brighter treatment prospects for tuberculosis patients. Summary of the invention

[0006] In order to overcome the rapid rise of drug resistance, especially the emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis strains, traditional treatment methods are facing unprecedented difficulties.

[0007] The technical scheme of the present invention is: a novel anti-tuberculosis drug targeting the fibrosis of mycobacterium DNA gyrase aggregates, comprising an aggregate-fibrosis inducer of mycobacterium tuberculosis DNA gyrase, such as MfpA.

[0008] Preferably, the MfpA4-7 protein fragment is also included to promote the fibrillation of DNA gyrase aggregates.

[0009] Preferably, the drug works by interfering with the DNA replication and repair mechanisms of Mycobacterium tuberculosis.

[0010] The present invention also provides a new anti-tuberculosis drug development idea targeting the fibrosis of mycobacterial DNA gyrase aggregates, and the steps are as follows:

[0011] S1: Isolation of Mycobacterium tuberculosis DNA gyrase by biochemical methods and study of its coacervation-fibrillation properties;

[0012] S2: Synthesize MfpA and MfpA4-7 protein fragments and test their effects on DNA gyrase condensation-fibrillization under in vitro conditions;

[0013] S3: Design and synthesize a series of small molecule compounds to synergize the effects of MfpA and MfpA4-7 protein fragments and evaluate their anti-tuberculosis activity.

[0014] The beneficial effects of the present invention are as follows: for the first time, it is proposed to use the coacervate-fibrosis property of Mycobacterium tuberculosis DNA gyrase as a new target for the treatment of tuberculosis. Based on the coacervate-fibrosis property of Mycobacterium tuberculosis DNA gyrase, the present invention uses DNA mimetic proteins, such as MfpA, which can induce a liquid-to-solid phase transition in the DNA gyrase. In addition, the MfpA4-7 protein fragment can further promote the fibrillation of the DNA gyrase coacervate, thereby enhancing the effect of the drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Shown is the analysis of the disordered region of the Mycobacterium MfpA protein using the PONDER algorithm;

[0016] Figure 2 Shown is the prediction of aggregation regions in the MfpA sequence using the TANGO algorithm;

[0017] Figure 3 What is shown is the effect of MfpA4-7 on promoting the morphology of liquid condensates of DNA gyrase;

[0018] Figure 4 The electron micrograph shows the DNA gyrase fiber formation promoted by MfpA4-7.

[0019] Figure 5 Shown are the effects of MfpA4-7 on the level of Mycobacterium marinum infection in zebrafish;

[0020] Figure 6 Shown are the effects of MfpA4-7 on the levels of mycobacterial infection in mice. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0022] 1. Mycobacterial DNA mimic protein MfpA induces liquid-solid phase transition of DNA gyrase

[0023] The study found that the DNA mimic protein MfpA can induce DNA gyrase to transform from a liquid condensate to a solid fibrous structure. The following are the specific steps of the study:

[0024] 1.1 Bioinformatics prediction

[0025] The characteristics of the DNA mimic protein MfpA were studied, especially its tendency to form aggregates. Bioinformatics analysis showed that its specific sequence had the potential to form aggregates, which was confirmed by TANGO analysis. This showed that MfpA has the potential to form aggregates.

[0026] 1.1.1 Protein sequence acquisition

[0027] Data source: The protein sequence of Mycobacterium MfpA was obtained from the Mycobrowser database (https: / / mycobrowser.epfl.ch / );

[0028] 1.1.2 IDRs prediction

[0029] Tool selection: Use the PONDER (Prediction of Naturally Disordered Regions) algorithm to predict IDRs in MfpA sequences;

[0030] Parameter settings:

[0031] PONDER algorithm (http: / / www.pondr.com / ) setting parameters (XL1-XT);

[0032] Result analysis: The prediction results using the PONDR XL1-XT algorithm showed that IDRs existed at both ends of MfpA (such as Figure 1 As shown), the predicted result is that MfpA has the potential to form aggregates;

[0033] 1.1.3 Prediction of Aggregation Tendency

[0034] Tool selection: Use the TANGO algorithm to predict aggregation propensity in MfpA sequences;

[0035] Parameter setting: The TANGO algorithm (version tango2_3) was downloaded from http: / / tango.embl.de / TANGO. The parameters were set as follows: C-terminal protection, N-terminal protection, temperature set to 298 Kelvin, pH value of 7, salt concentration of 100 mM, and fragments containing more than 5 consecutive amino acid residues and scoring more than 5% were marked as potential aggregation regions. The prediction results of the TANGO algorithm showed that the MfpA sequence contained high aggregation regions (e.g. Figure 2 shown);

[0036] Results: The aggregation tendency of MfpA was predicted using the TANGO algorithm, and the results showed that the MfpA sequence contained high aggregation regions, indicating the ability of MfpA to form aggregates.

[0037] 1.1.4 MfpA4-7 protein fragment promotes the fibrillation of DNA gyrase

[0038] The MfpA4-7 protein fragment (fragment 69-149) was used to promote the fibrillization of DNA gyrase condensates;

[0039] A. Recombinant protein expression:

[0040] To obtain recombinant proteins of the mycobacterial DNA gyrase GyrA and GyrB subunits, gene cloning and protein expression techniques were used;

[0041] PCR amplification of a gene fragment

[0042] - Template: The genomic DNA of the model strain of Mycobacterium tuberculosis, Mycobacterium smegmatis mc2155, is used as the template.

[0043] - Amplified gene fragments: gene fragments encoding GyrA and GyrB subunits and MfpA;

[0044] - Primer design:

[0045] pET28a-GyrA-YFP

[0046] -28a-GyrA-YFP-F:GTATTTCCAGGGCCATATGatgactgatacgacgctgccg

[0047] -GyrA-LINKER-R:tccacctccacctcctccacctcccgcctcgggtgactcggcgg

[0048] -LINKER-YFP-F:ggaggtggaggaggtggaggtggaatggtgagcaagggcgaggagctgtt

[0049] -28a-GyrA-YFP-R:CGAGTGCGGCCGCAAGCTTCTAttgtacagctcgtccatgc

[0050] pET28a-GyrB-mCherry

[0051] -28a-GB-MC-F:GTATTTCCAGGGCCATATGgtggctgcccagaagaacaat

[0052] -GyrB-LINKER-R:TCCACCTCCTCCACCTCCaacatccaggaagcgaacg

[0053] -LINKER-mCherry-F:

[0054] cttcctggatgttGGAGGTGGAGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGA

[0055] -28a-GB-MC-R:TCGAGTGCGGCCGCAAGCTTTCActtgtacagctcgtccatgc

[0056] pQE80L-MfpA4-7

[0057] 80L-MfpA-4-F:GCATCACCATCACCATCACGGATCCagcac

[0058] 80L-MfpA-7-R:AGTCCAAGTCCAGCTAATTAAGCTTctcctccaggcgtgcgtcct

[0059] b. Preparation of plasmid vector

[0060] pET28a plasmid was selected as the expression vector, which has a strong promoter and an N-terminal His tag) for protein purification. First, the pET28a plasmid was double-digested with Nde I and Hind III restriction endonucleases (Fermentas, catalog numbers FD0583 and FD0504) to linearize the vector fragment. The pQE80L plasmid was double-digested with EcoRI and HindIII (Fermentas, catalog numbers FD0074 and FD0504) to linearize the vector fragment.

[0061] Construction of c recombinant plasmid

[0062] The gene sequence of GyrA was inserted into the pET28a plasmid to construct pET28a-YFP-GyrA; the gene sequence of GyrB was inserted into the pET28a plasmid to construct: pET28a-GyrB-mCherry. The gene sequence of MfpA was inserted into the pQE80L plasmid to construct: pQE80L-EGFP-MfpA4-7;

[0063] d Expression and purification of recombinant proteins

[0064] The recombinant plasmids pET28a-YFP-GyrA and pET28a-GyrB-mCherry were transformed into E. coli BL21(DE3) cells, and pQE80L-EGFP-MfpA4-7 were transformed into E. coli M15(pREP4);

[0065] E. coli were grown in LB medium containing 100 mg / L kanamycin in a shaker at 37 °C. The cells were cultured until the OD600 value reached about 0.6, and 0.5 mM IPTG was added to induce the expression of the recombinant protein. Subsequently, the culture temperature was lowered to 16 °C and incubated overnight to promote the correct folding and accumulation of the protein;

[0066] The bacteria carrying the recombinant protein were resuspended in buffer A (10 mM sodium phosphate pH 7.6, 150 mM sodium acetate, 0.1 mM magnesium acetate, 0.5 mM DTT, 2.5% glycerol and 10 mM imidazole) and lysed using a Frech Press cell disruptor (JNBIO, China), the lysate was clarified by centrifugation at 12,000 g for 30 min at 4 °C, and the supernatant was then incubated with Ni-NTA 6FF agarose beads (Easybio, catalog number BE6947) equilibrated with buffer A for 2 h at 4 °C, after which the beads were washed with 15 column volumes (CV) of buffer A containing 20 mM imidazole to remove unbound proteins, and subsequently eluted with buffer A containing 300 mM imidazole to release the target protein;

[0067] The eluted proteins were further purified and buffer exchanged by AKTA Purifier 10 chromatography system (GE AKTA Purifier 10, Germany), and component analysis was performed according to the molecular weight exclusion method using Superdex 200Increase 10 / 300GL (Cytiva, catalog number 28990944) or Superdex 75Increase 10 / 300GL (Cytiva, catalog number 29148721) columns, which were run in buffer A without imidazole to collect pure, non-aggregated proteins for subsequent applications, and proteins were concentrated using Amicon Ultra-15 centrifugal filters (30 kDa molecular weight cutoff, Millipore, catalog number UFC903024);

[0068] 1.1.5 MfpA4-7 protein fragment promotes the fibrillation of DNA gyrase condensates

[0069] In the field of biology, the formation of solid or gel-like phases is often closely related to pathological conditions, such as amyloid fibrils in degenerative diseases and cancer. The appearance of abnormal phases not only interferes with normal physiological processes in cells, but may also directly lead to loss of cell function and even cell death. MfpA4-7 promotes the solidification of molecular aggregates of DNA gyrase and inhibits bacterial growth.

[0070] A MfpA4-7 fragment can effectively interfere with the liquid-solid phase transition of DNA gyrase, causing its aggregates to become fibrillated.

[0071] a1 recombinant protein complex mixture

[0072] The purified recombinant proteins were mixed, specifically the mixture contained 0.25 pmol of linearized pUC19 plasmid DNA, 50 pmol of DNA gyrase [composed of 50 pmol of GyrA and GyrB in equal amounts], and 50 pmol of MfpA4-7;

[0073] Microscopic observation of a2 aggregate-forming ability

[0074] The purified recombinant protein mixture was placed in the Grace Bio-Labs CoverWell TMPhase separation was allowed to occur in an imaging chamber (Sigma, catalog number GBL635051). Samples were incubated at 4°C for specific time points before imaging. Samples were visualized using a Leica TCS SP8 STED confocal microscope equipped with a photomultiplier tube (PMT) detector and a 100× oil immersion objective. Fluorophores were excited and detected using the following wavelengths: 488 nm for EGFP, 514 nm for YFP, and 550 nm for mCherry and Cy3. Fluorescence signals were collected using a 6-channel Spectra X LED light source and a Sedat Quad filter set. Fluorescence recovery after photobleaching (FRAP) experiments were performed using a Leica TCS SP8 STED confocal laser scanning microscope equipped with a Plan-Apochromat 100× / 1.4 oil immersion objective. A circular area of ​​approximately 2 μm in diameter was photobleached using a 514 nm argon-ion laser at 20% power (as Figure 3 shown);

[0075] To examine the morphological features of protein / peptide aggregates, transmission electron microscopy (TEM) was used. The mixture was diluted 100 times, and the diluted sample was then smeared on a carbon-coated Formvar grid (Beijing Zhongjing Technology, catalog number BZ11022) and incubated at room temperature for 1 min. To ensure optimal visual effects, the sample was rinsed twice with sterile, autoclaved distilled water to remove any excess or unbound material, followed by staining with 1% (w / v) uranyl acetate solution for 1 min to enhance contrast and completely dried;

[0076] For imaging, the prepared grids were placed in a Hitachi HT7800 transmission electron microscope (Japan) and observed at different magnifications. Images were captured using the HT7800 system software and the microscope was operated at an accelerating voltage of 80 kV to obtain detailed views of the aggregate morphology (e.g. Figure 4 ), using electron microscopy to show the fibrous structure formed by DNA gyrase under specific interaction conditions;

[0077] 3. Therapeutic effect of MfpA4-7

[0078] a) Zebrafish embryo infection model

[0079] The effect of MfpA4-7-mediated DNA gyrase condensate solidification on host bacterial load was evaluated by zebrafish model. The experiment was carried out according to the standards of China Zebrafish Resource Center for feeding and management of zebrafish. AB wild-type zebrafish were selected as experimental subjects. At the 1- to 4-cell stage of zebrafish embryos, the EGFP-expressing M.marinum strain, the M.marinum strain mixed with PBS or 0.5 mg / mL MfpA4-7 were injected, and each embryo was inoculated with 200-300 CFUs. The embryos were incubated in embryo culture medium at 28.5°C. From 1 day after fertilization, 0.003% 1-phenylethanol-2-thiourea (PTU) was added to inhibit pigment production. After 72 hours of infection, the embryos were microscopically imaged using Z-axis stack scanning technology, and the fluorescence signals were quantified and analyzed using ImageJ software.

[0080] Figure 5 The evaluation showed that the MfpA4-7 treatment group significantly reduced the host's bacterial load, indicating its potential application value in anti-infection treatment;

[0081] b) Mycobacterium infection mouse model

[0082] Pathogen-free female C57BL / 6 mice (6-8 weeks old) were provided by Sigenetic (Beijing). After a 5-7 day adaptation period, the mice were randomly divided into multiple groups, with three replicates in each group at each time point. The mice were anesthetized by intraperitoneal injection of 250 mg / kg tribromoethanol. After anesthesia, the mice were inoculated intranasally with the Mycobacterium strain IMMI-114 (~6×10 6 CFU in 25 μL PBS) or a mixture of IMMI-114 and 0.5 mg / mL MfpA4-7 protein, the inoculum was dripped into the left nostril of each mouse. At 24 and 48 hours after infection, the mice were killed and the intact lung tissue was collected. The lung tissue was placed in a 100 μm cell sieve and thoroughly homogenized with PBS. The homogenized lung tissue was diluted proportionally and inoculated on 7H10 agar plates and incubated at 37°C for about 3 days to evaluate the bacterial load in the lung. The lung tissue was removed and fixed with 4% paraformaldehyde, the tissue was embedded in paraffin, stained with hematoxylin-eosin according to standard procedures, and examined using a Leica SCN400 device (Wetzlar, Germany);

[0083] Experimental observation: After the mice in the treatment group were treated with MfpA4-7, the pathogen load in the lungs was significantly reduced ( Figure 6 Left);

[0084] Pathological analysis:

[0085] Figure 6The inhibitory effect of MfpA4-7 on mouse lung infection was demonstrated. It was observed that MfpA4-7 significantly reduced the pathological damage in the mouse lungs, further verifying its therapeutic effect in anti-mycobacterial infection. In the mycobacterium-infected mouse model, MfpA4-7 showed a significant inhibitory effect on the pathogen load.

[0086] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of those skilled in the art without departing from the spirit of the present invention.

Claims

1. A novel anti-tuberculosis drug targeting the fibrillation of mycobacterial DNA gyrase aggregates, characterized in that: Condensates containing Mycobacterium tuberculosis DNA gyrase - a fibrosis inducer, such as MfpA.

2. The novel anti-tuberculosis drug targeting mycobacterial DNA gyrase aggregate fibrosis according to claim 1, characterized in that: Also included is the MfpA4-7 protein fragment, which is used to promote the fibrillization of DNA gyrase condensates.

3. The novel anti-tuberculosis drug targeting mycobacterial DNA gyrase aggregate fibrosis according to claim 2, characterized in that: The drug works by interfering with the DNA replication and repair mechanisms of Mycobacterium tuberculosis.

4. The novel anti-tuberculosis drug targeting mycobacterial DNA gyrase aggregate fibrosis according to claim 1, characterized in that: The development steps are as follows: S1: Isolation of Mycobacterium tuberculosis DNA gyrase by biochemical methods and study of its coacervation-fibrillation properties; S2: Synthesize MfpA and MfpA4-7 protein fragments and test their effects on DNA gyrase condensation-fibrillization under in vitro conditions; S3: Design and synthesize a series of small molecule compounds to synergize the effects of MfpA and MfpA4-7 protein fragments and evaluate their anti-tuberculosis activity.

Images