Method for rapidly detecting mycobacterium tuberculosis
Through the molecular diagnostic method based on CRISPR-Cas13a, combined with NASBA and CRISPR-Cas13a parasection reactions, rapid and specific detection of Mycobacterium tuberculosis was achieved, solving the problems of high false negative tests, low sensitivity and long time in the prior art, and significantly improving the accuracy and efficiency of the detection.
Patent Information
- Application Number
- PCT/CN2024/134194
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-24
- Filing Date
- 2024-11-25
- Publication Date
- 2025-05-30
AI Technical Summary
In the prior art, the defects such as high false negatives of Mycobacterium tuberculosis (MTB), low sensitivity and long time consumption of pathogenic Mycobacterium.
Using a molecular diagnostic method based on CRISPR-Cas13a, the rapid and specific detection of Mycobacterium tuberculosis was achieved through nucleic acid-dependent amplification (NASBA) and CRISPR-Cas13a parasection reactions. This method is called CRISPR-Live-MTB, which can effectively detect single-stranded RNA of MTB within 2 hours and significantly reduce the detection limit.
CRISPR-Live-MTB significantly reduces the detection limit and can accurately detect MTB RNA at extremely low template concentrations (2.4copies vs. 0.2aM), greatly improving the accuracy of detection, reducing the risk of false negatives, and achieving high sensitivity and specificity of instant detection.
Smart Images

Figure PCTCN2024134194-FTAPPB-I100001 
Figure PCTCN2024134194-FTAPPB-I100002 
Figure PCTCN2024134194-FTAPPB-I100003
Abstract
Description
Rapid Mycobacterium Detection Methods
[0001] This application claims the benefit of Chinese patent application No. 2023115888043 filed on November 24, 2023. This application incorporates the entirety of the aforementioned Chinese patent application. Technical Field
[0002] The invention belongs to the field of biological detection, and particularly relates to a method for rapidly detecting mycobacteria. Background Art
[0003] Tuberculosis (TB), caused by Mycobacterium tuberculosis (MTB), is an important public health problem. Clinical practice has shown that effective diagnosis of TB plays an important role in the prevention and treatment of TB. Traditional TB diagnostic methods include etiological, immunological methods and nucleic acid detection. Microbial culture is generally considered to be the gold standard for diagnosing the cause of TB. Although it is convenient to detect live Mycobacterium tuberculosis, the culture method may require multiple clinical visits for up to 8 weeks4, resulting in delays in TB treatment. The tuberculin skin test and interferon gamma release test are important auxiliary diagnostic methods for TB, which rely on MTB antigens or lymphocyte responses to antigens, respectively. However, the results of these immunological tests may be complicated by the patient's immune status, for example after vaccination with BCG or co-infection with human immunodeficiency virus (HIV).
[0004] Recently, the World Health Organization has emphasized nucleic acid amplification tests (NAATs), including the PCR-based Xpert MTB / RIF technology, for the diagnosis of tuberculosis. A disadvantage of the Xpert MTB / RIF test is that the economic cost of the accompanying components (GeneXpert system) has hindered its widespread use in low-income countries or regions, which actually have a higher risk of MTB infection. NAATs based on isothermal amplification, such as loop-mediated isothermal amplification (LAMP) and nuclear acid sequence-based amplification (NASBA), have been developed to alleviate the demand for infrastructure. However, these NAATs have limited ability to distinguish between dead and live MTB bacteria.
[0005] To overcome these shortcomings, rapid and low-cost methods have been developed to specifically detect viable MTB. These new diagnostic approaches include modified propidium monoazide (PMA) treatment that allows selective PCR amplification of viable MTB DNA, fluorescent chemical probes that can be activated in response to MTB proteins, inducible expression of specific MTB proteins, and bioaerosol capture techniques.
[0006] Recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) (CRISPR-Cas) can be used as a rapid nucleic acid detection technology. CRISPR diagnostics rely on the side-cutting activity of Cas nucleases, which can induce the cleavage of single-stranded oligonucleotide reporter molecules to produce fluorescent or immunogenic signals. Several studies have described the detection of MTB DNA based on CRISPR-Cas12. These diagnostic methods can be implemented through fluorescent signals and lateral flow, thereby realizing point-of-care testing (POCT) of MTB. Interestingly, CRISPR diagnostics can also be used to detect cell-free circulating MTB DNA in human serum even in the presence of human immunodeficiency virus (HIV) co-infection. In addition, CRISPR-Cas13a has been used to identify drug-resistant mutations in MTB with single-nucleotide accuracy. Despite significant progress in CRISPR-based MTB diagnostics, distinguishing between dead and live MTB remains challenging. Summary of the Invention
[0007] The present invention addresses the technical problems of existing techniques for detecting MTB (Mycobacterium tuberculosis), such as high false negative rates, low sensitivity for pathogenic mycobacteria, and time-consuming testing. The present invention provides a method for rapid detection of Mycobacteria. This method can rapidly, accurately, and with high sensitivity detect MTB RNA in biological samples, distinguishing MTB from NTM, specific mycobacteria, and nonspecific mycobacteria, providing a more optimal option for immediate detection of MTB.
[0008] The present invention describes a molecular diagnostic method based on CRISPR-Cas13a, which can be used as a diagnostic platform to specifically detect MTB ssRNA instead of genomic double-stranded DNA. It can quickly and specifically detect live MTB. The method is referred to as CRISPR-Live-MTB in the present invention and comprises two consecutive reactions: nucleic acid-dependent amplification (NASBA) and CRISPR-Cas13a side-cutting reaction. Experiments have shown that CRISPR-Live-MTB can effectively detect MTB single-stranded RNA (ssRNA) within 2 hours, with higher specificity than double-stranded DNA (dsDNA) detection. Importantly, CRISPR-Live-MTB exhibits a limit of detection (LOD) of as low as 2.4 copies relative to MTB ssRNA, which is 1000 times lower than the method using only NASBA (2,400 copies), greatly reducing the possibility of missed detection. At this time, the template concentration of CRISPR-Live-MTB only needs 0.2aM, while a single NASBA requires 0.2fM. CRISPR-Live-MTB significantly improves the accuracy of MTB detection and reduces the risk of false negatives. Furthermore, CRISPR-Live-MTB incorporates lateral flow, enabling point-of-care (POCT) detection with 95% sensitivity and 100% specificity. The inventors also measured the signal-to-noise ratio of RNA relative to DNA. This demonstrates that the CRISPR-Live-MTB of the present invention can be used as a rapid, sensitive, and specific method for detecting live MTB.
[0009] The present invention solves the above technical problems through the following technical solutions.
[0010] A first aspect of the present invention provides a primer pair for detecting Mycobacterium tuberculosis, the primer pair comprising an upstream primer and a downstream primer;
[0011] The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO: 1 or 2, and the downstream primer comprises a nucleotide sequence as shown in any one of SEQ ID NO: 3-6.
[0012] In some embodiments of the present invention, the upstream primer and the downstream primer are selected from the following combinations:
[0013] (1) The upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 6;
[0014] (2) the upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 4;
[0015] (3) the upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 4;
[0016] (4) the upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 6;
[0017] (5) the upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 3;
[0018] (6) the upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 5;
[0019] (7) The upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 5;
[0020] (8) The upstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises or is the nucleotide sequence shown in SEQ ID NO: 3.
[0021] In some embodiments of the present invention, the 5' end of the upstream primer further includes a T7 promoter sequence, and the T7 promoter sequence is, for example, as shown in SEQ ID NO: 24.
[0022] The second aspect of the present invention provides a nucleic acid detection kit for nucleic acid-dependent amplification, wherein the nucleic acid detection kit comprises the primer pair as described in the first aspect.
[0023] In some embodiments of the present invention, the nucleic acid detection kit further comprises reverse transcriptase, RNase inhibitor, and RNA polymerase.
[0024] In some preferred embodiments of the present invention, the nucleic acid detection kit further comprises an RNA template.
[0025] In some preferred embodiments of the present invention, the RNA polymerase is T7 RNA polymerase.
[0026] The third aspect of the present invention provides a reaction system for nucleic acid-dependent amplification, which comprises the primer pair as described in the first aspect.
[0027] In some embodiments of the present invention, the working concentration of the primer pair is 0.05-1 μM, preferably 0.25-1 μM.
[0028] In some embodiments of the present invention, the reaction system further comprises reverse transcriptase, RNase inhibitor, and RNA polymerase.
[0029] The fourth aspect of the present invention provides an amplification method for nucleic acid-dependent amplification, which comprises adding an RNA template to the reaction system as described in the third aspect to carry out an amplification reaction.
[0030] In some embodiments of the present invention, the RNA template is a 16S rRNA template.
[0031] In some embodiments of the present invention, the working concentration of the RNA template is at least 0.2 aM.
[0032] In some embodiments of the present invention, the working concentration of the RNA template is 1 to 1000 times lower than the working concentration specified in the instructions of the NASBA kit, such as NECB-24.
[0033] In some embodiments of the present invention, the temperature of the amplification reaction is 41-42°C.
[0034] A fifth aspect of the present invention provides a crRNA for detecting Mycobacterium, wherein the crRNA comprises a spacer sequence of a nucleotide sequence as shown in any one of SEQ ID NOs: 9-21.
[0035] In some embodiments of the present invention, the spacer sequence is a 28 bp nucleotide sequence located at the 3' side of the nucleotide sequence shown in any one of SEQ ID NOs: 9-21.
[0036] In some specific embodiments of the present invention, the crRNA comprises a spacer sequence of a nucleotide sequence as shown in SEQ ID NO:15.
[0037] A sixth aspect of the present invention provides a crRNA for detecting Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare or Mycobacterium kansasii, wherein the crRNA comprises a spacer sequence of a nucleotide sequence as shown in any one of SEQ ID NOs: 9-14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.
[0038] In some embodiments of the present invention, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' side of the nucleotide sequence.
[0039] The seventh aspect of the present invention provides a CRISPR detection kit, which includes the crRNA as described in the fifth aspect or the sixth aspect.
[0040] In some embodiments of the present invention, the CRISPR detection kit further comprises a Cas protein, such as LwaCas13a.
[0041] In some preferred embodiments of the present invention, the CRISPR detection kit further comprises an ssRNA fluorescent probe, and the ssRNA fluorescent probe, for example, comprises a nucleotide sequence as shown in SEQ ID NO:7.
[0042] The eighth aspect of the present invention provides a reaction system for CRISPR detection, wherein the reaction system includes the crRNA as described in the fifth aspect or the sixth aspect.
[0043] In some embodiments of the present invention, the working concentration of the crRNA is 0.1-2.5 ng / μL, preferably 0.5-2.5 ng / μL.
[0044] In some embodiments of the present invention, the reaction system further comprises a Cas protein, such as LwaCas13a.
[0045] In some embodiments of the present invention, the working concentration of the Cas protein is 45-50 nM.
[0046] In some embodiments of the present invention, the reaction system further comprises an ssRNA fluorescent probe, and the ssRNA fluorescent probe, for example, comprises a nucleotide sequence as shown in SEQ ID NO: 7.
[0047] In some embodiments of the present invention, the working concentration of the ssRNA fluorescent probe is 0.25-0.5 μM.
[0048] The ninth aspect of the present invention provides a method for CRISPR detection, comprising the step of adding a sample to be tested to the reaction system as described in the eighth aspect for reaction.
[0049] In some embodiments of the present invention, the reaction temperature is 35-37°C.
[0050] In some embodiments of the present invention, the CRISPR detection is for non-diagnostic purposes, such as laboratory testing of environmental samples or plant samples.
[0051] In some embodiments of the present invention, the CRISPR assay is an in vitro assay.
[0052] The tenth aspect of the present invention provides a method for detecting Mycobacterium tuberculosis, the method comprising the steps of sequentially performing RNA nucleic acid-dependent amplification and CRISPR detection based on Cas13a on the sample to be tested; the RNA nucleic acid-dependent amplification comprises using the primer pair as described in the first aspect, the nucleic acid detection kit as described in the second aspect, or the reaction system as described in the third aspect to perform RNA amplification.
[0053] In some embodiments of the present invention, the CRISPR detection comprises detection using the crRNA as described in the fifth aspect or the sixth aspect, the CRISPR detection kit as described in the seventh aspect, or the reaction system as described in the eighth aspect.
[0054] In some embodiments of the present invention, the Mycobacterium tuberculosis is a living Mycobacterium tuberculosis.
[0055] In some embodiments of the invention, the method is for non-diagnostic purposes.
[0056] In some preferred embodiments of the present invention, the reaction temperature for RNA amplification is 41-42°C.
[0057] In some preferred embodiments of the present invention, the RNA amplification further includes a heat activation step; the heat activation preferably includes heat activation of nucleic acids and nuclease inhibitors, and the temperature of the heat activation is preferably 65-67°C.
[0058] In some embodiments of the present invention, the reaction temperature of the detection is 35-37°C.
[0059] The eleventh aspect of the present invention provides a primer pair as described in the first aspect, the nucleic acid detection kit as described in the second aspect, the reaction system as described in the third aspect, the crRNA as described in the fifth aspect or the sixth aspect, the CRISPR detection kit as described in the seventh aspect, or the reaction system as described in the eighth aspect for detecting Mycobacterium pathogens or preparing reagents or devices for detecting Mycobacterium pathogens.
[0060] In some embodiments of the present invention, the Mycobacterium pathogen is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium kansasii.
[0061] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0062] The reagents and raw materials used in the present invention are commercially available.
[0063] The positive progress effect of the present invention is:
[0064] The CRISPR-Live-MTB assay of the present invention significantly reduces the limit of detection compared to existing NASBA assays. For example, the LOD of the NASBA reaction is 2,400 copies (corresponding to a 0.2 fM template concentration), while the LOD of the CRISPR-Live-MTB assay (1 hour NASBA + 1 hour CRISPR reaction) is only 2.4 copies (corresponding to a 0.2 aM template concentration). This indicates that CRISPR-Live-MTB can significantly reduce template concentration, greatly improving the accuracy of MTB detection and reducing the risk of false negatives.
[0065] In addition, CRISPR-Live-MTB can also achieve point-of-care testing (POCT) with 95% sensitivity and 100% specificity in a short period of time, effectively monitoring the effectiveness of drug treatment and disease progression, which is helpful for patients in areas with inconvenient transportation and face-to-face consultations. BRIEF DESCRIPTION OF THE DRAWINGS
[0066] Figure 1 is a schematic diagram of the CRISPR-Live-MTB method of the present invention. In the figure: a is the CRISPR-Live-MTB method, which designs a CRISPR RNA (crRNA) targeting the 16S rRNA gene to detect MTB RNA. Conventional RNA extraction methods can be used as RNA input. Signal readout can be a fluorescent signal or a colorimetric band on a lateral flow test strip. RT represents reverse transcription, and T7 is the gray area. b is the traditional culture method.
[0067] Figure 2 compares the specificity of NASBA and the NASBA-based CRISPR-Live-MTB method for detecting MTB RNA. ab shows the specificity of NASBA for detecting MTB RNA and DNA: a is CRISPR-Live-MTB; b is the input concentration of RNA and DNA templates for the two reactions, ranging from 107 to 108 copies. The NASBA method was used for a 2-hour reaction; the CRISPR-Live-MTB method used a 1-hour NASBA reaction followed by a 1-hour CRISPR reaction; c is the LOD determined by the NASBA method (n = 2 biological replicates; mean ± SD); d is the LOD determined by the CRISPR-Live-MTB method (n = 3 technical replicates; mean ± SD). The cut-off value for a positive signal was set to be higher than the mean ± 3 standard deviations of the blank control.
[0068] Figure 3 shows the interspecies reactivity of MTB-specific and universal crRNA. a is a schematic diagram of the detection of mycobacteria using species-specific or universal crRNA; b is the result of the reaction of MTB-specific crRNA (taking MTB-crRNA5 as an example) and mycobacterium universal crRNA with Cas13a. c is the LOD for the detection of mycobacteria measured using universal crRNA and MTB RNA template. The data of three technical replicates are expressed as mean ± standard deviation. The cut-off value of the positive signal is set equal to the mean ± 3 standard deviations of the blank control group.
[0069] Figures 4A-4C are lateral flow CRISPR-Live-MTB for detecting MTB and NTM. Figure 4A is a schematic diagram of the design of lateral flow CRISPR-Live-MTB; the left side of Figure 4B shows the results of MTB-specific detection using MTB-crRNA5, where the left side is an image of the lateral flow test strip and the right side is the band density quantification of the test strip; the right side of Figure 4B shows the results of mycobacteria detection using universal crRNA, where the left side is an image of the lateral flow test strip and the right side is the band density quantification of the test strip; the left side of Figure 4C shows the LOD of MTB RNA detection using MTB-crRNA5; where the left side is an image of the lateral flow test strip and the right side is the band density quantification of the test strip; the right side of Figure 4C shows the LOD of MTB RNA detection using universal crRNA, where the left side is an image of the lateral flow test strip and the right side is the band density quantification of the test strip. Data from three technical replicates are presented as mean ± standard deviation. The cut-off value for positive signals was set equal to the mean ± 3 standard deviations of the blank control group.
[0070] Figures 5 and 6 are schematic diagrams of using lateral flow CRISPR-Live-MTB to detect live MTB in clinical samples; the left figure of Figure 5 is a schematic diagram of CRISPR-Live-MTB without RNA extraction, RT is room temperature, and LFD is lateral flow detection; the right figure of Figure 5 is the result of CRISPR-Live-MTB detection using lateral flow test strips. The control band (C) is shown at the bottom and the detection band (T) is shown at the top. Imaging was performed 3 minutes after adding the sample. Figure 6 is the quantification of the band density in (b). The data of three technical replicates are expressed as mean ± standard deviation. The cut-off value of the positive signal is set equal to the mean ± 3 standard deviations of the blank control group. PPA (positive predictive agreement) is positive predictive agreement, and NPA (negative predictive agreement) is negative predictive agreement.
[0071] Figures 7-8 are schematic diagrams of the design of crRNA and NASBA primers for detecting live MTB; Figure 7 is a sequence alignment of 16S rRNA from MTB and six non-MTB mycobacteria (NTM), and shows the binding sites of NASBA primers and Cas13a crRNA; the lower figure of Figure 8 is the screening of crRNA for NASBA-coupled MTB ssRNA detection. 1nM ssRNA template, MTB-NASBA-FWD-1 and MTB-NASBA-REV-2 primers were used; the upper figure of Figure 8 is the screening of NASBA primer combinations for Cas13a cleavage-coupled MTB ssRNA detection; 1nM ssRNA template and MTB-crRNA5 were used; in Figure 8, the data of three technical replicates are expressed as mean ± standard deviation. Background fluorescence has been removed for each group.
[0072] Figures 9-10 show the kinetics of fluorescence signal output from NASBA and CRISPR-Live-MTB. Figure 9 shows the LOD determination for NASBA (a) and CRISPR-Live-MTB (b), corresponding to channels c and d in Figure 2. The lower panel of Figure 10 shows a NASBA-coupled Cas13a reaction without RNA amplification. The upper panel of Figure 10 shows the 60-min endpoint fluorescence signal in channel c. Data from three technical replicates are presented as mean ± SD.
[0073] Figures 11-12 are schematic diagrams of species-specific detection of MTB and NTM using the CRISPR-Live-MTB platform; Figure 11 is a schematic diagram of evaluating species-specific crRNA; Figure 12 is a schematic diagram of evaluating interspecies cross-reactivity of species-specific crRNA; synthetic mycobacterial RNA was used as a template; abbreviations are as follows: M.tb represents M. tuberculosis H37Rv, M.ab represents M. abscessus, M.av represents M. avium, M.fo represents M. fortuitum, M.go represents M. gordonae, M.in represents M. intracellulare, M.ka represents M. kansasii, E. coli represents Escherichia coli, A.ba represents A. baumannii, K.pn represents K. pneumoniae, P.ae represents P. aeruginosa, and S.au represents Staphylococcus aureus. Data are shown as mean ± SD (n = 3 technical replicates). DETAILED DESCRIPTION
[0074] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0075] Example 1
[0076] 1. Materials and Methods
[0077] (1) Strains and clinical samples
[0078] Mycobacterium tuberculosis H37Rv (ATCC27294) was stored in the Second Affiliated Hospital of Fujian Medical University. M. tuberculosis was cultured in Middlebrook 7H9 liquid medium at 37°C.
[0079] The collected clinical samples did not contain any personal information and the samples were used only for molecular diagnostic purposes.
[0080] (2) Sample processing and RNA preparation
[0081] The sample was treated using the N-acetyl-L-cysteine (NALC)-NaOH method. Approximately 5 mL of sputum was inactivated by thorough mixing with the same volume of N-acetyl-L-cysteine (NALC)-NaOH solution and allowed to stand at room temperature for 15 minutes. The resulting precipitate was rinsed once with sterile 0.9% NaCl solution and resuspended in 1.5 mL of sterile 0.9% NaCl solution. 500 μL of treated sputum was transferred to a new sterile, nuclease-free 1.5 mL test tube. After centrifugation at 10,000 g for 5 minutes, the precipitate was resuspended in 50 μL of lysis buffer (10 mM sodium citrate, pH 8.0) and vortexed. The bacteria in the resuspended precipitate were lysed using a water bath sonicator (Shanghai Shengyan Ultrasonic Instrument Co., Ltd.) at 300 W for 15 minutes at room temperature, followed by centrifugation at 10,000 g for 5 minutes. The supernatant obtained was used as a template for subsequent experiments.
[0082] (3) Expression and purification of LwCas13a protein
[0083] The Cas13a (LwCas13a) protein purification from Leptotrichia wadei was performed with only minor modifications compared to the method described by Gootenberg JS, Abudayyeh OO, Lee JW, et al. Nucleic acid detection with CRISPR-Cas13a / C2c2 Science. 2017Apr28; 356(6336): 438-442. The codon-optimized LwCas13a encoding gene (SEQ ID NO: 23) was cloned into the bacterial expression vector pET28a. A 6×His tag (SEQ ID NO: 23 positions 3478-3495) was added to the N-terminus of LwCas13a, and its expression was controlled by the T7 promoter (SEQ ID NO: 24). The expression vector of LwCas13a was transformed into Escherichia coli BL21 (DE3). Fresh clones were selected and cultured in Luria-Bertani (LB) medium supplemented with 50 μg / mL kanamycin, shaking at 37°C overnight. The culture (10 mL) was inoculated into 2 L LB medium containing 50 μg / mL kanamycin, and cultured at 37°C, 220 rpm, and shaking. 600When the pH reaches 0.6-0.8, add isopropyl-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. Incubate at 16°C with shaking overnight to induce protein expression. Harvest cells by centrifugation at 5,200g for 15 minutes at 4°C and store at -80°C.
[0084] For protein purification, cells were resuspended in lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 1 mM DTT, pH 8.0) and sonicated on ice for 10 min using the following conditions: amplitude 100, 5 s on, 5 s off cycles. The resulting fragments were removed by centrifugation at 10,000 g for 1 h at 4°C, and the supernatant was filtered through a Stericup 0.22 μm filter (EMD Millipore). The supernatant was affinity purified using a Ni-NTA column (Qiagen). Further purification was performed using fast protein liquid chromatography (FPLC) using a Superdex 200 filter column (GE Healthcare Life Sciences). The purified protein was analyzed by SDS-PAGE and the solution was exchanged into storage buffer (50 mM Tris-HCl, pH 7.5, 600 mM NaCl, 5% (v / v) glycerol, 2 mM dithiothreitol (DTT)) and stored at -80°C.
[0085] (4) NASBA primer design and crRNA preparation
[0086] As shown in Figure 7, the 16S rRNA sequence of MTB H37Rv (ATCC27294) and the sequences of six other reference strains were obtained from the NCBI database (shown in the figure: MTB H37Rv (ATCC27294): SEQ ID NO:25; M. abscessus (ATCC19977): SEQ ID NO:26; M. avium (ATCC25291): SEQ ID NO:27; M. fortuitum (ATCC6841): SEQ ID NO:28; M. gordonae (ATCC14470): SEQ ID NO:29; M. intracellulare (ATCC13950): SEQ ID NO:30; M. kansasii (ATCC12478): SEQ ID NO:31; and the sequence below: SEQ ID NO:32). The sequences were aligned using MEGAX to identify conserved and variable regions. NASBA primers were designed targeting the conserved nucleotide regions of the 16S rRNA gene. The T7 promoter sequence was attached to the 5' end of the NASBA upstream primer. The primer sequences are shown in Table 1 and were synthesized by GeneWeiZhi.
[0087] The DNA template for crRNA was synthesized using Jin Weizhi's primers, including the connected T7 promoter sequence. The crRNA template was annealed to form a short T7 primer (T7-3G), and then crRNA was transcribed using the HiScribe T7 Quick High Yield RNA Synthesis Kit at 37°C overnight. According to the instructions, crRNA was purified using RNAiso Plus (Takara, 9108). The purified crRNA was stored at -80°C.
[0088] Table 1 Primers used in the examples
[0089] The underlined part is the target binding sequence; the bold part is the T7 promoter sequence.
[0090] T7 promoter sequence (SEQ ID NO: 24):
[0091] TAATACGACTCACTATAGGG
[0092] (5) RT-PCR
[0093] 2 μL of RNA sample was reverse transcribed into cDNA using the ReScript RT reagent Kit (Takara). PCR primers are listed in Table 1. A 10 μL reaction system contained 0.5 μL of reverse-transcribed cDNA product, 5 μL of PowerUp SYBR Green Master Mix (Applied Biosystems), and 0.5 μL of each upstream and downstream primer (all stock solutions at 10 μM). The reaction was mixed at 4°C and incubated in a QuantStudio 6Flex System thermocycler (Applied Biosystems). RT-PCR reaction conditions were as follows: 50°C for 2 minutes, 95°C for 2 minutes, denaturation at 95°C for 15 seconds, and then 1 minute. Fluorescence signal was collected during the 60°C annealing / extension step of each cycle.
[0094] (6) NASBA RNA-specific isothermal amplification
[0095] RNA-specific isothermal amplification was performed using a commercial NASBA kit (NECB-24, Life Sciences) according to the manufacturer's instructions. Briefly, each 20 μL reaction contained 6.7 μL of reaction buffer (Life Sciences, NECB-24), 3.3 μL of Nucleotide Mix (Life Sciences, NECN-24), 0.5 μL of nuclease-free water, 0.4 μL of 12.5 μM NASBA primers, 0.1 μL of Murine RNase inhibitor (Vazyme, R301-01), and 4 μL of RNA (negative control: water). The above components were mixed at 4°C and incubated at 65°C for 2 minutes, followed by 41°C for 10 minutes. Afterwards, 5 μL of enzyme mix (Life Sciences, NEC-1-24) was added to each reaction, and the reaction mixture was incubated at 41°C for 1 to 2 hours. Fluorescent NASBA was performed by adding 50 nM RNA probe (as shown in Table 1) to the 20 mL reaction system. The RNA probe was labeled with 6-carboxyfluorescein (FAM) phosphoramidite at the 5' end and 4-[4-(dimethylamino)phenylazo]benzoic acid N-succinimidyl ester (DABCYL) at the 3' end. The fluorescence signal of NASBA was detected using a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices) with an excitation wavelength of 485 nm and an emission wavelength of 520 nm.
[0096] (7) LwCas13a reaction
[0097] LwCas13a detection analysis was performed as described above. A 20 μL reaction system contained 50 nM purified LwCas13a, 0.25 μM FAM-BQ1-labeled ssRNA probe (Genescript), 10 ng crRNA (as shown in Table 2), 6 mM MgCl2, 20 mM Tris-HCl, pH 7.4, 0.1 μL mouse RNase inhibitor (Vazyme, R301-01) and 3 μL NASBA product. The reactants were allowed to stand at 37 ° C for 1 hour, and the fluorescence signal was collected by SpectraMax iD3 Multi-Mode Microplate Reader with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. Fluorescence kinetics was measured every 5 min. For lateral flow-based detection, commercially available lateral flow test strips (Milenia HybriDetect 1, TwistDx) were used for the reaction according to the instructions. The FAM-BQ1-labeled ssRNA probe was replaced with a FAM-biotin-labeled ssRNA probe, and the final concentration was adjusted to 1 μM in 20 μL LwCas13a reaction solution. LwCas13a was reacted at 37 ° C for 1 hour, and then 20 μL of the product was transferred to 100 μL Hybridetect assay buffer and spotted on the lateral flow test strip. The band intensity of the test strip can be read directly by naked eye or imaged by camera for further density analysis.
[0098] Table 2 crRNA used in the examples
[0099] The underlined portion is the spacer sequence.
[0100] The LwCas13a construct sequence used in the example (SEQ ID NO: 22):
[0101] The codon-optimized LwCas13a sequence used in the examples (SEQ ID NO: 23):
[0102] 2. Results
[0103] As shown in Figure 1, in the NASBA reaction, MTB rRNA is first reverse transcribed into complementary DNA (cDNA), and then the rRNA in the RNA-DNA dimer is degraded by RNase H. Double-stranded DNA (dsDNA) is synthesized using cDNA as a template. Through the T7 transcription reaction, the newly synthesized dsDNA will produce an RNA product. Importantly, in this process, due to the lack of a T7 promoter, MTB genomic DNA is no longer used as a template for RNA production. Therefore, the NASBA reaction of the present invention makes RNA-dependent amplification of MTB possible. The product of the NASBA reaction is used for the Cas13a reaction to induce the side cutting of the ssRNA reporter molecule for subsequent fluorescence analysis or lateral flow analysis.
[0104] As shown in Figures 2 and 8, comparative analysis shows that MTB-crRNA5 produces the strongest fluorescent signal. Unless otherwise specified, subsequent experiments in the examples are based on MTB-crRNA5.
[0105] In addition, NASBA amplification plays an important role in the output of fluorescent signals. The inventors designed two upstream primers and two downstream primers and their combinations to quantify the amplification efficiency through the fluorescent signal of the reaction between Cas13a and MTB-crRNA5. The results showed that the combination of MTB-NASBA-FWD-1 and MTB-NASBA-REV-4 had the highest efficiency.
[0106] The examples compared the sensitivity and specificity of detecting MTB RNA relative to DNA. The fixed reaction time was 2 hours, with the NASBA reaction consisting of a continuous 2-hour reaction and the CRISPR-Live-MTB reaction consisting of a 1-hour NASBA reaction followed by a 1-hour CRISPR reaction. The results showed that both NASBA and CRISPR-Live-MTB exhibited higher fluorescence intensities using ssRNA as templates compared to DNA, with CRISPR-Live-MTB exhibiting a higher fluorescence signal intensity.
[0107] The inventors then compared the limit of detection (LOD) of the fluorescent NASBA reaction in CRISPR-Live-MTB. As shown in Figures 9-10, the results showed that the LOD of the 2-hour NASBA reaction was 2,400 copies (corresponding to a 0.2 fM template concentration), while the LOD of the CRISPR-Live-MTB (1-hour NASBA + 1-hour CRISPR reaction) was only 2.4 copies (corresponding to a 0.2 aM template concentration), demonstrating the importance of the CRISPR reaction in CRISPR-Live-MTB.
[0108] As shown in Figure 3, the screening of crRNA shows that MTB-crRNA5 has higher specificity for MTB than NTM and non-mycobacterial bacteria. In addition, as shown in Figures 11-12, the inventors have also designed a universal crRNA for Mycobacteria based on the conserved genomic sequences of MTB and NTM, which has a wide range of activity in all mycobacteria detected, including MTB and NTM, while retaining the specificity of relatively unrelated bacteria. The LOD of universal crRNA when using MTB RNA as a template was determined to be 2.4 copies (corresponding to 0.2aM template concentration). The single-digit LOD values of MTB-crRNA5 and mycobacterium universal crRNA show that CRISPR-Live-MTB of the present invention is a highly sensitive diagnostic platform.
[0109] To explore the application of CRISPR-Live-MTB in point-of-care testing, a lateral flow-based signal readout method was designed. In this case, the reporter molecule of the fluorescent matrix was replaced by a FAM-biotin-labeled ssRNA, allowing the cleavage signal to be displayed on a commercially available lateral flow test strip. As shown in Figures 4A-4C, the control line is displayed based on the interaction between immobilized streptavidin and flow biotin. In the presence of MTB RNA, the ssRNA is cleaved, releasing free FAM molecules, which can be captured by gold nanoparticle-conjugated anti-FAM antibodies, resulting in the display of the test line.
[0110] The results showed that the LOD of MTB-crRNA5 and the universal crRNA of Mycobacteria were consistent with the fluorescence reaction, both of which were 2.4 copies (corresponding to a 0.2aM template concentration). These results demonstrate that lateral flow CRISPR-Live-MTB is fast, specific, and sensitive for detecting live MTB.
[0111] To more rapidly detect MTB RNA, the inventors sought to integrate an extraction-free RNA preparation method into CRISPR-Live-MTB. Therefore, the clinical samples were inactivated for 15 minutes and then sonicated for 15 minutes using the NALC-NaOH method to release RNA. The resulting RNA samples were then subjected to CRISPR-Live-MTB testing, and the results were analyzed using lateral flow test strips and a densitometer.
[0112] As shown in Figures 5 and 6, the test results showed that among the 60 samples, 40 (S1-S40) were confirmed to contain live MTB by culture method, and the other 20 (S41-S60) samples did not contain live MTB. Using CRISPR-Live-MTB for detection, the control group used the positive signal average threshold plus three times the standard deviation (mean+3SD). 38 of the 40 samples confirmed positive by culture were confirmed to contain live MTB, and the other 2 were S18 and S39, showing a sensitivity of approximately 95.0%. The 20 negative samples (S41-S60) were all negative by CRISPR-Live-MTB, showing a specificity of 100.0%. Overall, CRISPR-Live-MTB can obtain a positive detection rate of 100.0% and a negative detection rate of 90.9%.
[0113] Although the above describes specific embodiments of the present invention, it should be understood by those skilled in the art that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.
Claims
1. A primer pair for detecting Mycobacterium tuberculosis, characterized in that: The primer pair comprises an upstream primer and a downstream primer; The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO: 1 or 2, and the downstream primer comprises a nucleotide sequence as shown in any one of SEQ ID NO: 3-6.
2. The primer pair according to claim 1, characterized in that The upstream primer and the downstream primer are selected from the following combinations: (1) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 6; (2) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4; (3) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4; (4) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 6; (5) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3; (6) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5; (7) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5; (8) the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3; Preferably, the 5' end of the upstream primer further includes a T7 promoter sequence; the T7 promoter sequence is, for example, as shown in SEQ ID NO:
24.
3. A nucleic acid detection kit for nucleic acid-dependent amplification, characterized in that: The nucleic acid detection kit comprises the primer pair as claimed in claim 1 or 2; Preferably, the nucleic acid detection kit further comprises reverse transcriptase, RNase inhibitor, and RNA polymerase; More preferably, the RNA polymerase is T7 RNA polymerase; and / or, the nucleic acid detection kit further comprises an RNA template.
4. A reaction system for nucleic acid-dependent amplification, characterized in that: The reaction system comprises the primer pair as claimed in claim 1 or 2; Preferably: The working concentration of the primer pair is 0.05-1 μM, preferably 0.25-1 μM; and / or, the reaction system further comprises reverse transcriptase, RNase inhibitor, and RNA polymerase.
5. A method for nucleic acid-dependent amplification, characterized in that: The amplification method comprises adding an RNA template to the reaction system as claimed in claim 4 to carry out an amplification reaction; Preferably, the RNA template is a 16S rRNA template; and / or, the working concentration of the RNA template is at least 0.2aM, or 1 to 1000 times lower than the working concentration in the instructions of the NASBA kit, such as NECB-24; and / or, the temperature of the amplification reaction is 41-42°C.
6. A crRNA for detecting Mycobacterium, characterized in that The crRNA comprises a spacer sequence of a nucleotide sequence as shown in any one of SEQ ID NOs: 9-21; Preferably, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' end of the nucleotide sequence shown in any one of SEQ ID NOs: 9-21; and / or, the crRNA comprises a spacer sequence of the nucleotide sequence shown in SEQ ID NO:
15.
7. A crRNA for detecting Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare or Mycobacterium kansasii, characterized in that The crRNA comprises a spacer sequence of a nucleotide sequence as shown in any one of SEQ ID NOs: 9-14, as shown in SEQ ID NO: 16, as shown in SEQ ID NO: 17, as shown in SEQ ID NO: 18, as shown in SEQ ID NO: 19, as shown in SEQ ID NO: 20 or as shown in SEQ ID NO: 21; Preferably, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' end of the nucleotide sequence.
8. A CRISPR detection kit, characterized in that: The CRISPR detection kit comprises the crRNA as claimed in claim 6 or 7; Preferably, the CRISPR detection kit further comprises a Cas protein, such as LwaCas13a; More preferably, the CRISPR detection kit further comprises a ssRNA fluorescent probe, and the ssRNA fluorescent probe, for example, comprises a nucleotide sequence as shown in SEQ ID NO:
7.
9. A reaction system for CRISPR detection, characterized in that: The reaction system comprises the crRNA as claimed in claim 6 or 7; Preferably, the working concentration of the crRNA is 0.1-2.5 ng / μL, preferably 0.5-2.5 ng / μL; and / or, the reaction system also includes a Cas protein, such as LwaCas13a; and / or, the working concentration of the Cas protein is 45-50 nM; and / or, the reaction system also includes a ssRNA fluorescent probe, and the ssRNA fluorescent probe, for example, comprises a nucleotide sequence as shown in SEQ ID NO: 7; and / or, the working concentration of the ssRNA fluorescent probe is 0.25-0.5 μM.
10. A method for CRISPR detection, characterized in that: The method comprises the steps of adding the sample to be tested into the reaction system as claimed in claim 9 to carry out a reaction; Preferably, the reaction temperature is 35-37°C; and / or, the CRISPR detection is a detection for non-diagnostic purposes.
11. A method for detecting Mycobacterium tuberculosis, characterized in that: The method comprises the steps of sequentially performing RNA nucleic acid-dependent amplification and Cas13a-based CRISPR detection on the sample to be tested; the RNA nucleic acid-dependent amplification comprises performing RNA amplification using the primer pair according to claim 1 or 2, the nucleic acid detection kit according to claim 3, or the reaction system according to claim 4; Preferably, the CRISPR detection comprises detection using the crRNA according to claim 6 or 7, the CRISPR detection kit according to claim 8, or the reaction system according to claim 9; and / or, the Mycobacterium tuberculosis is a living Mycobacterium tuberculosis; and / or, the method is for non-diagnostic purposes; and / or, the method is in vitro; More preferably, the reaction temperature of the RNA amplification is 41-42°C; and / or, a heat activation step is further included before the RNA amplification; the temperature of the heat activation is preferably 65-67°C; and / or, the reaction temperature of the CRISPR detection is 35-37°C.
12. Use of the primer pair according to claim 1 or 2, the nucleic acid detection kit according to claim 3, the reaction system according to claim 4, the crRNA according to claim 6 or 7, the CRISPR detection kit according to claim 8 or the reaction system according to claim 9 in detecting mycobacterium pathogens or preparing reagents or devices for detecting mycobacterium pathogens; Preferably, the mycobacterium pathogen is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare and Mycobacterium kansasii.
Citation Information
Patent Citations
Method for rapidly detecting mycobacteria
CN120041587A
Rapid identification method and kit of novel mycobacterium strain
CN102634575A
Compositions, methods, and kits for detecting and identifying mycobacteria
CN103562405A
Mycobacterium tuberculosis nucleic acid detection kit for CRISPR detection by RNA isothermal amplification
CN113943823A
Detection method of tuberculosis
CN115896316A