Application of simultaneous disruption of HBB competition and HBG epigenetic silencing in the treatment of β-hemoglobinopathies

Abstract

This invention discloses the application of simultaneously disrupting HBB competition and HBG epigenetic silencing in the treatment of β-hemoglobinopathies. This invention is the first to discover that disrupting the interaction between HBB and LCR while simultaneously relieving epigenetic silencing on HBG can completely reverse the γ-to-β-globin expression conversion. This discovery has important clinical application prospects in the field of gene therapy for β-hemoglobinopathies.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of simultaneously disrupting HBB competition and HBG epigenetic silencing in the treatment of β-hemoglobinopathies. Background Technology

[0002] During human development, along with the migration of hematopoietic sites, the main type of hemoglobin in red blood cells changes from fetal hemoglobin (HbF, α2γ2) to adult hemoglobin (HbA, α2β2). This transcriptional change from γ-globin (HBG) to β-globin (HBB) is called γ-to-β-globin expression conversion. β-hemoglobinopathies caused by HBB mutations (mainly including β-thalassemia and sickle cell anemia) are the world's most recognized single-gene inherited diseases, placing a huge burden on public health. Activating HbF in adulthood can alleviate the clinical symptoms of β-hemoglobinopathies and has become a potential treatment for the disease. Therefore, extensive research has been conducted on the epigenetic silencing of HBG, mainly mediated by BCL11A, in the γ-to-β-globin expression conversion. Previous studies have achieved partial reversal of the γ-to-β-globin expression conversion, theoretically increasing HbF levels by up to approximately 60%.

[0003] However, whether the γ-to-β-globin expression transition can be completely reversed remains unknown. Although gene competition and autonomous silencing have been observed in the γ-to-β-globin expression transition, the regulatory mechanism remains unclear. The locus control region (LCR), acting as a super-enhancer, enhances globin gene expression by forming chromatin loops, thus bringing the LCR into physical proximity with the globin gene. Chromatin conformational changes occur during the globin gene expression transition, and the LCR can only interact with one globin gene promoter at a time. The competitive binding of the LCR between γ- and β-globin genes determines the expression pattern of globin genes. Much evidence suggests that enhanced interaction between HBG and the LCR weakens the interaction between HBB and the LCR, accompanied by a decrease in β-globin expression.

[0004] This invention achieves, for the first time, a complete reversal of the γ-to-β-globin expression transition by disrupting the interaction between HBB and LCR and simultaneously relieving epigenetic silencing on HBG. This discovery provides important insights into the γ-to-β-globin expression transition, offers new methods for manipulating this process, and provides novel therapeutic strategies for β-hemoglobinopathies. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide the application of simultaneously disrupting HBB competition and HBG epigenetic silencing in the treatment of β-hemoglobinopathies.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the invention provides the use of an agent that simultaneously disrupts HBB competition and HBG epigenetic silencing in the preparation of a medicament for the treatment of β-hemoglobinopathies;

[0008] The simultaneous disruption of HBB competition and HBG apparent silencing is achieved by disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

[0009] Furthermore, the simultaneous disruption of HBB competition and HBG epigenetic silencing is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

[0010] Furthermore, the types of mutations include deletion, substitution, insertion, inversion, duplication, and / or translocation mutations;

[0011] Preferably, the deletion mutation includes the removal of one or more bases from the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0012] Preferably, the substitution mutation includes replacing one or more bases of the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter with other bases;

[0013] Preferably, the insertion mutation includes inserting one or more bases at any position in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0014] Preferably, the inversion mutation includes the reversal of one or more base positions in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0015] Preferably, the repeating mutation includes the repetition of one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0016] Preferably, the translocation mutation includes the movement of one or more bases from the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter from one position to another.

[0017] Furthermore, the deletion mutation is any one of the following: mutation of the CACCC element on the HBB promoter to a deletion of all elements of CAC, CC, CACC, C, ACCC, CCC, CACCCc, CAaCCC, CACtCC, CACacattggCC, CACTC, CACT, or CACCC; and mutation of the TGACCA element on the HBG promoter to a deletion of all elements of TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, TGAAtCCA, TGAcaaggctattgCCA, TGAaCCA, TGaA, or TGACCA.

[0018] Preferably, the substitution mutation is to mutate the CACCC element on the HBB promoter to any one of TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TATTC, TATCT, TACTT, CATTT, or TATTT, and to mutate the TGACCA element on the HBG promoter to any one of TAACCA, TGATCA, TGACTA, or TGATTA.

[0019] Furthermore, the deletion mutation can be achieved using CRISPR-Cas9 gene editing technology. CRISPR / Cas9 is a gene editing technology developed based on bacterial innate immune mechanisms. The simplified CRISPR system consists of two parts: the endonuclease Cas9 and gRNA (Guide RNA, gRNA). Cas9 recognizes and binds to the protospacer adjacent motif (PAM) on the genome, causing DNA double-strand unwinding. At this point, the crRNA portion of the gRNA successfully pairs complementaryly with the upstream sequence of the PAM. Cas9 then activates its endonuclease activity, forming a double-strand DNA break (DBS) at a specific position upstream of the PAM. DBS can activate the cell's DNA damage repair mechanisms, including non-homologous end joining (NHEJ) or homology-directed repair (HDR). NHEJ, or error-prone repair, causes random insertions or deletions at the repair site, resulting in frameshift mutations that prevent gene expression, thus leading to gene knockout. HDR, or precision repair, uses exogenous single-stranded or double-stranded DNA as a template to mediate gene replacement or insertion. This method can precisely insert a DNA sequence into a specific genomic site, thereby completing gene knock-in or replacement.

[0020] Furthermore, the substitution mutation is achieved using gene editing techniques known to those skilled in the art, including but not limited to: single-base gene editing technology and CRISPR-Cas9 gene editing technology. In some embodiments, the substitution mutation is achieved using single-base gene editing technology, which refers to gene editing technology capable of causing a single base change on the genome. Its basic principle is to fuse cytosine deaminase (APOBEC) or adenosine deaminase with an existing Cas9n (D10A) to form a gene editing technology that relies on the CRISPR principle to modify a single base at positions 4-7 away from the PAM end. Currently, single-base gene editing technologies include two types: pyrimidine base conversion technology (C / G to T / A) and purine base conversion technology (A / T to G / C).

[0021] Furthermore, the simultaneous disruption of HBB competition and HBG epigenetic silencing can achieve a complete reversal of the γ-to-β-globin expression conversion.

[0022] In a specific embodiment of the present invention, by mutating the CACCC element on HBB and the TGACCA element on HBG, the competitive inhibition between HBB and HBG and the epigenetic silencing on HBG are simultaneously disrupted, achieving a complete reversal of the γ-to-β-globin expression conversion. Furthermore, the combined editing of the CACCC element on HBB and the TGACCA element on HBG can increase HbF expression to nearly 100% of the overall hemoglobin level, which is significantly higher than the highest theoretically achievable HbF level (60%) in the current field. This method provides a precise and efficient treatment strategy for the clinical treatment of β-hemoglobinopathies.

[0023] In some embodiments, any method capable of disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter is within the scope of protection of this invention, including but not limited to mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter. In other embodiments, any mutation method of the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter is within the scope of protection of this invention. Any mutation method that can achieve the purpose of simultaneously disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter falls within the scope of protection of this invention. It should be noted that this is not limited to the specific mutations exemplified in the embodiments.

[0024] A second aspect of the present invention provides a pharmaceutical composition for treating β-hemoglobinopathies.

[0025] Furthermore, the pharmaceutical composition comprises the reagent described in the first aspect of the present invention;

[0026] Preferably, the reagent achieves complete reversal of the γ-to-β-globin expression conversion by simultaneously disrupting HBB competition and HBG epigenetic silencing.

[0027] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier and / or excipients.

[0028] In some embodiments, the pharmaceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). These substances are used as needed to help stabilize the formulation or to help improve the bioavailability of the active substance, etc. The pharmaceutical composition thus formulated can be administered as needed by any appropriate route of administration known to those skilled in the art.

[0029] In some embodiments, non-limiting examples of the pharmaceutically acceptable carriers and / or excipients include, but are not limited to, preservatives, chemical stabilizers, pH adjusters, surfactants, adjuvants, and ionic strength enhancers. For example, preservatives include, but are not limited to, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, vanillin, glycerin, carbolic acid, and p-chlorophenol; chemical stabilizers include, but are not limited to, gelatin, albumin, citric acid, malic acid, and calcium bicarbonate; pH adjusters include, but are not limited to, phosphate buffers, citrate buffers, and borate buffers; surfactants include, but are not limited to, cationic, anionic, and nonionic surfactants, such as Tween-80; and ionic strength enhancers include, but are not limited to, sodium chloride, potassium chloride, and calcium chloride.

[0030] A third aspect of the present invention provides a pharmaceutical preparation for treating β-hemoglobinopathies.

[0031] Furthermore, the pharmaceutical preparation comprises the pharmaceutical composition described in the second aspect of the present invention.

[0032] In some embodiments, the dosage forms of the pharmaceutical preparation include, but are not limited to: injections, tablets, capsules, pills, suppositories, aerosols, oral liquid preparations, granules, powders, sustained-release preparations, nano-preparations, syrups, tinctures, and lotions.

[0033] In some embodiments, the pharmaceutical formulations of the present invention can be prepared using conventional preparation methods well known to those skilled in the art, such as mixing the various active ingredients, or preparing the formulation by mixing the active ingredients with corresponding excipients according to conventional preparation methods for various dosage forms. The pharmaceutical compositions of the present invention can also be used with other drugs or compounds that can be used for the treatment and / or adjunctive treatment of β-hemoglobinopathies.

[0034] In this invention, there are no particular limitations on the method of administration of the pharmaceutical composition or pharmaceutical preparation. In some embodiments, the method of administration of the pharmaceutical composition or pharmaceutical preparation includes, but is not limited to, injection, infusion, drip infusion, or ingestion. Among them, injection includes, but is not limited to, intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intra-orbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, intracerebral, intraspinal, and intrasternal injection and infusion.

[0035] A fourth aspect of the present invention provides a method for completely reversing the expression conversion of γ-to β-globin in vitro for non-therapeutic purposes.

[0036] Furthermore, the method achieves complete reversal of γ-to-β-globin expression conversion by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0037] Preferably, the mutation is as described in the first aspect of the present invention.

[0038] The fifth aspect of the present invention provides a method for promoting γ-globin expression and inhibiting β-globin expression in vitro for non-therapeutic purposes.

[0039] Furthermore, the method is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0040] Preferably, the mutation is as described in the first aspect of the present invention.

[0041] Furthermore, the present invention provides a method for treating β-hemoglobinopathies, the method being implemented by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter in hematopoietic stem cells of a subject in need, wherein the mutation is as described in the first aspect of the present invention.

[0042] In this invention, the subject can be a mammal or a non-mammal. The mammal is preferably a rodent, even-toed ungulate, perissodactyl, lagomorph, or primate. The primate is preferably a monkey, ape, or human. In a specific embodiment of this invention, the subject is preferably a human.

[0043] In this invention, β-hemoglobinopathy refers to any disease or condition related to β-hemoglobin, including but not limited to: β-thalassemia, sickle cell anemia, sickle cell phenotype, hemoglobin C disease, hemoglobin C phenotype, hemoglobin S / C disease, hemoglobin D disease, hemoglobin E disease, hemoglobin-related conditions with increased oxygen affinity, hemoglobin-related conditions with decreased oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia. Furthermore, β-hemoglobinopathy also includes one or more symptoms associated with β-hemoglobinopathy, including but not limited to: anemia, tissue hypoxia, organ dysfunction, abnormal hematocrit, inefficient erythropoiesis, abnormal reticulocyte (erythrocyte) count, abnormal iron overload, presence of ring sideroblasts, splenomegaly, hepatomegaly, impaired peripheral blood flow, dyspnea, increased hemolysis, jaundice, and anemic pain. (crisis), acute chest syndrome, spleen sequestration, stroke, hand-foot syndrome, and pain such as angina.

[0044] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:

[0045] This invention is the first to discover that disrupting the interaction between HBB and LCR while simultaneously relieving epigenetic silencing on HBG can completely reverse the γ-to-β-globin expression conversion. This finding provides a comprehensive explanation of globin expression conversion and offers a novel treatment strategy for β-hemoglobinopathies, with promising clinical application prospects. Attached Figure Description

[0046] Figure 1To induce HbF expression by disrupting the CACCC element on the HBB promoter, Figure a shows the CRISPR-Cas9 screening in HUDEP2 cells to identify elements that enhance HbF expression. The y-axis represents the log2 (FC) of gRNA. Targeting HBB homologous sequences, proximal CACCC elements on HBB, and distal CACCC elements are highlighted with blue, red, and orange dots, respectively. Figure b shows that mutations in the CACCC element on the HBB promoter lead to high levels of HbF expression in the human population. Editing the CACCC and TGACCA elements in HUDEP2 cells, using PM-gRNA-1... The editing efficiencies of PM-gRNA-2, DM, and GM were 79.1%, 67.4%, 45.4%, and 83.4%, respectively; Figure c: HPLC detection of HbF levels in edited HUDEP2 cells; Figure d: Flow cytometry analysis of the proportion of F cells; Figure e: In CD34+HSPC, the editing efficiencies of PM-gRNA-1, DM, and GM were 77.6%, 12.9%, and 72.7%, respectively, after which the expression of β-globin relative to β-actin was detected; Figure f: 3C analysis results; Figure g: ChIP-qPCR analysis results.

[0047] Figure 2 To disrupt the CACCC element to induce HbF expression, the following diagrams were used: a) Schematic diagram of CRISPR-Cas9 screening in HUDEP2 cells; b) CRISPR screening enriched the top 20 gRNAs in HUDEP2 cells; c) Editing the CACCC and TGACCA elements in HUDEP2 cells, followed by detection of β-globin expression relative to β-actin in the edited HUDEP2 cells; d) Binding of KLF1 to HBB; e) Similar editing was performed in CD34+HSPCs, followed by ChIP-qPCR analysis.

[0048] Figure 3 Disruption of the CACCC element on the HBB promoter and the TGACCA element on HBG can completely reverse the γ-to-β-globin expression conversion. Figure a: Combinatorial editing in HUDEP2 cells, detecting β-globin expression relative to β-actin; Figure b: Detection of β-globin expression relative to β-actin in edited HUDEP2 monoclonal cells; Figure c: HPLC detection of HbF expression in four monoclonal cells; Figure d: ChIP-qPCR results; Figure e: 3C detection results.

[0049] Figure 4To significantly enhance HbF expression by disrupting the CACCC element on HBB and the TGACCA element on HBG, the following figures were used: a) Combinatorial editing in HUDEP2 cells, with HbF levels detected by HPLC; b) Flow cytometry analysis of the proportion of F cells; c) Results of CRISPR screening in GM-Clone13 cells; d) Analysis of KLF1 binding on HBB.

[0050] Figure 5 To achieve complete reversal of γ-to-β-globin expression conversion in β-BAC mice, Figure a shows the establishment of β-BAC mouse strains and corresponding site-edited BAC mouse strains, and Figure b shows the detection of β-globin expression relative to β-actin in mice from embryonic day 10.5 to the neonatal stage.

[0051] Figure 6 To enhance HbF expression in primary erythroid cells by combining and disrupting CACCC and TGACCA elements, the following diagrams were used: a) HbF expression level was detected by HPLC after combining and editing CACCC and TGACCA elements in CD34+ cells derived from normal human peripheral blood and undergoing in vitro erythroid differentiation for 12 days; b) Erythroid differentiation was detected using CD71 and CD235; c) γ-globin expression relative to β-actin was detected after combining and editing CACCC and TGACCA elements in CD34+ cells derived from β-thalassemia patients and undergoing in vitro erythroid differentiation for 12 days; d) Hemoglobin accumulation was measured by combining benzidine with Giemsa staining; e) F cell proportion was detected by flow cytometry.

[0052] Figure 7 To enhance γ-globin expression in human primary erythroid cells by combining and disrupting the CACCC and TGACCA elements, the following figures were obtained: a) Combination editing in CD34+ cells derived from normal human peripheral blood, followed by in vitro erythroid differentiation for 12 days, and detection of β-globin expression relative to β-actin; b) Flow cytometry analysis of the proportion of F cells; c) ChIP-qPCR detection results; d) 3C detection results.

[0053] Figure 8To enhance HbF expression in HSPCs from β-thalassemia patients by combining the disruption of CACCC and TGACCA elements, the following figures were presented: a) Combination editing in CD34+ cells derived from β-thalassemia patients (codon 17(A>T) / codon 41 / 42(–TTCT)), followed by in vitro erythroid differentiation for 12 days, and HbF expression levels were detected by HPLC; b) Expression of γ-globin relative to β-actin was detected in the resulting monoclonal cells; c) Erythroid differentiation was detected by flow cytometry analysis using CD71 and CD235. Detailed Implementation

[0054] Through extensive and in-depth research, the inventors of this invention have discovered for the first time that disrupting the interaction between HBB and LCR while simultaneously relieving epigenetic silencing on HBG can increase HbF expression to nearly 100% of the total hemoglobin level, thus achieving for the first time a complete reversal of the γ-to-β-globin expression conversion.

[0055] In a specific embodiment of this invention, the invention simultaneously disrupts the competitive inhibition between HBB and HBG, as well as epigenetic silencing on HBG, by mutating the CACCC element on HBB and the TGACCA element on HBG, achieving a complete reversal of the γ-to-β-globin expression conversion. This discovery provides a comprehensive explanation of globin expression conversion and expands the understanding of eukaryotic gene expression regulation mechanisms by those skilled in the art. Furthermore, the combined editing of the CACCC element on HBB and the TGACCA element on HBG can increase HbF expression to nearly 100% of the overall hemoglobin level, indicating that this method could be a more suitable strategy for gene therapy of β-hemoglobinopathies.

[0056] To further illustrate this invention, the terms used herein are explained as follows:

[0057] The terms “comprising” or “including” are open-ended descriptions and refer to compositions, methods and one or more corresponding components therein that are essential to the present invention, but are not limited to the listed corresponding components, do not exclude other components, and may include or contain unspecified elements, whether or not they are essential.

[0058] The term "β-hemoglobinopathy" refers to hemolytic anemia caused by mutations in the β-globin gene. β-hemoglobinopathy is mainly divided into two types: one is thalassemia caused by reduced or absent β-globin synthesis, called β-thalassemia; the other is hemolytic anemia caused by mutations in the β-globin structure, called sickle cell anemia. β-hemoglobinopathy is the most prevalent single-gene inherited disease, with approximately 7% of the world's population being carriers of the β-globin-causing gene. Although its genetic molecular mechanisms have been elucidated, currently, apart from allogeneic bone marrow transplantation, there is a lack of curative treatment strategies.

[0059] The term "β-thalassemia" refers to a hereditary disease caused by mutations in the β-globin subunit, resulting in abnormalities in adult hemoglobin (HbA). It is one of the most common types of thalassemia and the most prevalent single-gene inherited disease worldwide, with an average of 1.5 people per 100 carrying the thalassemia gene. Its molecular mechanism involves defects in the globin gene encoding hemoglobin, leading to impaired globin chain synthesis, causing red blood cell destruction and resulting in hemolytic anemia. Currently, the treatment of moderate to severe thalassemia faces significant challenges. With the advent of gene editing technology, gene therapy for thalassemia has become a hot research topic in this field.

[0060] The term "sickle cell anemia" refers to a hereditary hemoglobinopathic disorder caused by the replacement of valine with glutamic acid at the sixth amino acid position of the β-globin chain, forming sickle-shaped hemoglobin that replaces normal hemoglobin. This is caused by a mutation in the β-globin-encoding gene (HBB), producing abnormal or inactive products that interfere with the normal physiological function of red blood cells. Clinical manifestations include chronic hemolytic anemia, susceptibility to infection, and recurrent painful crises leading to chronic local ischemia and subsequent organ and tissue damage. Reactivation of γ-globin in sickle cell anemia and thalassemia is one of the effective treatments for these β-hemoglobinopathies.

[0061] The term "HBB" refers to the β-globin gene; the term "HBG" refers to the γ-globin gene; and the term "HbF" refers to fetal hemoglobin. Hemoglobin composed of α-globin and γ-globin is called HbF. Around birth, as the hematopoietic site migrates from the fetal liver to the bone marrow, the α-globin gene cluster continues to express the α-globin gene, while the expression of the γ-globin gene in the β-globin gene cluster gradually decreases, and the expression of the β-globin gene gradually increases. After birth, adult hemoglobin (HbA), composed of α-globin and β-globin, accounts for more than 95% of total hemoglobin, while HbF accounts for less than 1%.

[0062] The term "reversing the γ-to-β-globin expression transition" refers to reversing the expression transition from γ-globin to β-globin. During human development, the β-like subunit of hemoglobin undergoes two transitions: from ε-globin in the embryonic stage to γ-globin in the fetal stage, and finally to β-globin after birth. The genes encoding these transitions are called ε-globin (embryonic stage), γ-globin (newborn), and β-globin (adult), respectively, and are located at the β-globin locus on chromosome 11. The process of γ-globin to β-globin conversion in red blood cells after birth is called globin switching. The γ-to-β-globin expression transition is precisely regulated during individual development, and manipulating this process can be used as a treatment for β-hemoglobinopathies. Many genetic factors have been found to epigenetically silence the expression of the γ-globin gene in adulthood. However, whether the γ-to-β-globin expression transition can be completely reversed remains unknown.

[0063] The present invention will be further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or according to the manufacturer's recommendations.

[0064] Example 1: Disrupting HBB competition can induce γ-globin expression.

[0065] I. Experimental Methods

[0066] 1. CRISPR screening experiments to screen for regulatory sequences that can enhance γ-globin expression.

[0067] 1.1 Construction of CRISPR screening experimental libraries

[0068] To screen for regulatory sequences that can enhance γ-globin expression downstream of the HBG gene, gRNAs were designed for this region using the CHOPCHOP tool (http: / / chopchop.cbu.uib.no / ). The target sequence was chr11:5204054-5248601, the reference genome was hg38 / GRCh38, the using algorithm was CRISPR / Cas9, and the for algorithm was knock-out. A total of 3784 gRNAs were designed, and the results were exported as two txt files: hbb_gRNA_1 and hbb_gRNA_2. These two txt files were then sent to Nanjing GenScript Biotech Co., Ltd. for gRNA library synthesis and construction. The library construction process was as follows: the first 20 nt sequences of the 3784 synthesized gRNAs were cloned into the LentiGuide-Puro vector, and transformation colonies with sufficient coverage were selected, followed by plasmid extraction. After plasmid extraction, NGS sequencing was performed on the gRNA corresponding sequences on the plasmid. Analysis of the sequencing data showed that the library coverage was 100%, the maximum sequencing depth was 399, the average sequencing depth was 92.08, the average sequencing depth of the top 10% of reads in ascending order was 33, the average sequencing depth of the top 90% was 164, and the Skewness (90% / 10% average sequencing depth) was 4.97. This information indicates that the CRISPR screening experimental library was successfully constructed.

[0069] 1.2 Packaging of Lentiviral Viruses in CRISPR Screening Experiments

[0070] One day before virus packaging, 293T cells were seeded in 100mm culture dishes. Transfection was performed when the cells reached approximately 70% confluence. A three-plasmid packaging system was used for lentivirus packaging. The lentivirus packaging and transfection procedure for each 100mm culture dish of 293T cells was as follows: 10μL of VigoFect transfection reagent was added to 400μL of physiological saline, gently mixed, and allowed to stand for 5 min. Then, 10μg of CRISPR selection library plasmid, 5μg of PLP1, 8μg of PLP2, and 4μg of PLPVSVG were added to 400μL of physiological saline, and gently mixed. Next, the mixture of VigoFect transfection reagent and physiological saline was added dropwise to the plasmid solution, gently mixed, and incubated at room temperature for 15 min. Finally, the mixture was added dropwise to the 100mm culture dishes, gently shaken to mix thoroughly, and then incubated in an incubator. Eight hours after transfection, the 293T cell culture medium was discarded, and 10 mL of DMEM complete medium with added pyruvate was added for further culture.

[0071] Culture supernatants were collected at 36 h and 72 h, and the culture media collected at these two time points were thoroughly mixed. The mixture was then centrifuged at 3000 rpm for 15 min at 4 °C, and cell debris was discarded. The supernatant was filtered through a 0.45 μm PVDF membrane into a new 50 mL centrifuge tube. The viral supernatant from the 50 mL centrifuge tube was transferred to an ultracentrifuge tube, centrifuged at 50000 g at 4 °C for 4 h, the supernatant was carefully discarded, and the viral particles were resuspended in 1 mL of HUDEP2 proliferation medium. The resuspended virus particles were then aliquoted and stored at -80 °C.

[0072] 1.3 Determine the amount of lentivirus to add when MOI = 0.3

[0073] To ensure that each HUDEP2 cell is infected with an average of 0.3 lentiviral particles in the subsequent CRISPR screening and infection experiments, the amount of lentiviral addition needed to infect HUDEP2 cells at MOI=0.3 needs to be determined.

[0074] First, in a 12-well cell culture plate, 3 × 10⁶ cells per well were cultured. 6 HUDEP2 cells were seeded into plates with 1 mL of HUDEP2 proliferation medium per well, and 1 μL of 8 mg / mL polybrene (final concentration 8 μg / mL) was added. Then, 0, 0.5, 1, 2, and 4 μL of CRISPR selection library lentivirus were added to each well, and the cells were centrifuged at 1000g for 2 h at 37°C to complete lentiviral infection. The culture supernatant was discarded, and the cells were resuspended in fresh HUDEP2 proliferation medium and cultured in new plates. After 12 h of infection, each well of infected HUDEP2 cells was divided into two aliquots and placed in two separate wells. One well was treated with 1 μg / mL puromycine, and the other well was left untreated. After three more days of culture, the cells in both wells were counted, and the ratio of the number of cells in the treated group to the untreated group was calculated. A viral load of 0.3 was selected as the viral load for subsequent CRISPR selection experiments, and in this experiment, the viral load was determined to be 1 μL.

[0075] 1.4 CRISPR Screening Experiment: Lentiviral Infection and Proliferation

[0076] The HUDEP2 cells used in this CRISPR selection experiment were Cas9-stable HUDEP2 cells carrying the blasticidine resistance gene. Before infecting HUDEP2 cells with lentivirus in the CRISPR selection experiment, blasticidine was added to the proliferation medium at a final concentration of 10 μg / mL. After culturing for 4 days, the blasticidine was removed and cultured for another day.

[0077] Then take 12×106 9 × 10⁶ HUDEP2 cells (the average number of HUDEP2 cells corresponding to each library gRNA should be 713 HUDEP2 cells). 6 Cells were seeded into four wells of a 12-well plate, with 1 mL of proliferation medium added to each well. Polybrene was added to a final concentration of 8 μg / mL, and the mixture was stirred. Then, 1 μL of CRISPR lentivirus for selection was added to each well. The plates were centrifuged at 1000g for 2 h at 37°C to complete lentivirus infection. The culture medium was then discarded, and the cells were resuspended in fresh proliferation medium and placed in new 100 mm culture dishes for further culture. The cell density was strictly controlled at 5 × 10⁻⁶ cells / well. 5 The cells were kept to a minimum of 1 cell / mL and cultured for 6 days.

[0078] Sorting of cells with high 1.5HbF expression

[0079] Collect 1×10⁻⁶ cells before cell sorting. 7 One HUDEP2 cell was used for subsequent genome extraction and labeled as sortbefore, serving as a control for subsequent CRISPR screening experiments.

[0080] The remaining HUDEP2 cells were then fixed and cross-linked with glutaraldehyde, permeabilized with Triton X-100, and stained with HbF-APC intracellularly (per 2.5 × 10⁻⁶ cells). 5 Each cell was treated with 10 μL of antibody. HUDEP2 cells expressing high levels of HbF were then sorted using a SONY MA900 fully automated flow cytometer. HbF-positive cells, comprising approximately 2.03% of the total cell count, were collected, along with HbF-negative cells, comprising approximately 50.58%.

[0081] 1.6 Extraction of genomes from positive cells and construction of sequencing libraries

[0082] The previously saved sort-before group, along with the HbF-positive and HbF-negative cell groups sorted by flow cytometry, were used for genome extraction. Since typical CRISPR screening experiments require 300X coverage, and 1×10⁻⁶ coverage is insufficient... 6 Each cell contains approximately 6.6 μg of genomic DNA; therefore, for a gRNA library of around 4000 lines, achieving a 300X coverage requires 1.2 × 10⁻⁶ cells / cells. 6 One cell, or 7.2 μg of genomic DNA.

[0083] The extracted genomic DNA from each group was subjected to PCR amplification of gRNA sequences to complete sequencing and library construction. Library construction consisted of two PCR amplification steps, and the specific library construction process was as follows: The first round of PCR was performed in a 50 μL system using 2.5 μg of genomic DNA as a template. Primers were designed targeting the regions containing the gRNA sequences. The forward primer was AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG, and the reverse primer was CT TTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC. The PCR conditions were: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 30 s, 53℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 20 cycles, with a final extension at 72℃ for 2 min.

[0084] The PCR products were then purified using magnetic beads. The purification process was as follows: The purified magnetic bead solution was removed from the 4°C freezer 30 minutes in advance and allowed to reach room temperature. The magnetic bead solution was vortexed to mix thoroughly. Then, 0.7 times the volume (35 μL) of magnetic beads was added to the PCR product, and the mixture was thoroughly mixed and incubated at room temperature for 10 minutes to allow DNA to bind to the magnetic beads. The PCR product was then placed on a magnetic rack and allowed to stand for 5 minutes until the solution became clear. The supernatant was then transferred to a new centrifuge tube. Next, 0.2 times the volume (10 μL) of magnetic beads was added, and the mixture was thoroughly mixed. After incubating at room temperature for 10 minutes, the product was placed on a magnetic rack for 5 minutes, and the supernatant was discarded. The magnetic beads were then washed twice with 200 μL of freshly prepared 80% ethanol. After discarding the supernatant, the magnetic beads were dried and dissolved in 20 μL of nuclease-free water for 2 minutes. The product was then placed on a magnetic rack, and the supernatant was transferred to a new nuclease-free PCR tube.

[0085] The purified PCR product was used as a template for the second round of PCR. NGS adapter primers were used to complete the PCR primers and add indexes. The TruSeq P5 primer was AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGAC, and the TruSeq P7 primer was CAAGCAGAAGAC GGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTC, where XXXXXX is the barcode sequence. PCR conditions were the same as the first round of PCR. After PCR, the second round of PCR products were purified using magnetic beads, following the same purification method as the previous step, with 1.2 times the volume (60 μL) of magnetic beads. The purified product was dissolved in TE buffer and sent to the company for next-generation sequencing.

[0086] 1.7 Analysis of sequencing data from CRISPR screening experiments

[0087] The tool used for CRISPR screening experiments is CRISPR-SURF. Detailed operating procedures and instructions can be found at http: / / github.com / pinellolab / CRISPR-SURF.

[0088] Electroporation of 2HUDEP2 cells and CD34+ hematopoietic stem and progenitor cells

[0089] Before electroporation, the density of HUDEP2 cells was controlled to ensure optimal cell growth. Fresh HUDEP2 proliferation medium was added to the wells of the plate beforehand, and the plates were incubated at 37°C, 5% CO2, and saturated humidity. The HUDEP2 cells were counted, and a sample of 2.88 × 10⁶ cells was collected. 6 Centrifuge at 300g for 5 minutes, discard the supernatant, and wash twice with 1mL DPBS. After removing any residual DPBS, add 72μL Buffer T to resuspend the cells, achieving a cell concentration of 4×10⁶ cells / mL. 7 / mL. CD34+ hematopoietic stem and progenitor cells derived from normal human peripheral blood were cultured in a proliferation medium with controlled cell density to ensure optimal cell growth. Before electroporation, the cells were resuspended in 20 μL of solution P3 at a density of 5 × 10⁶ cells / mL. 4 Each cell.

[0090] Preparation of CRISPR-Cas9 RNP for electroporation: Add 0.6 μL of 10× Hifi buffer (100 mM HEPES, 1.5 M NaCl), 0.6 μL of 62 μM (IDT 1081058) Alt-R SpHiFi Cas9Nuclease V3 (approximately 32 pmol), and 1.8 μL of 44 μM sgRNA synthesized by IDT (approximately 80 pmol) to an RNase-free centrifuge tube. Add RNase-free water to a final volume of 6 μL and incubate at room temperature for 15 min. The sequence of sgRNA is mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAG CAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCCGGUGCU*mU*mU*mU. The gRNA target sequence is as follows: PM-gRNA1:ACCCTGTGGAGCCACA CCCT, PM-gRNA2: GGGTGTGGCTCCACAGGGTG, DM-gRNA: CTTGTCAAGG CTATTGGTCA, GM-gRNA: CTTG TCAAGGCTATTGGTCA.

[0091] Preparation of 49-3A-57EP single-base editing tool RNA for electroporation: Add 2 μL of 1 μg / mL (synthesized by Nearshore Proteins) 49-3A-57EP mRNA and 1.8 μL of 44 μM sgRNA (approximately 80 pmol) synthesized by IDT to an RNase-free centrifuge tube and mix. The sgRNA sequence is mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCU*mU*mU*mU. The gRNA target sequences are as follows: BE-A: GCTATTGGTCAAGGCAAG GC, BE-B: CAAGGCTATTGGTCAAGGCA, BE-C: GTGGAGCCACACCCTA GGGT.

[0092] During electroporation of HUDEP2 cells, 6 μL of CRISPR-Cas9 RNP incubation product was mixed thoroughly with 6 μL of resuspended cells, and then... TM Add 3 mL of E2 buffer to the tube and use Neon. TM Pipette inserts 10μL Neon TM Tip, and draw up the RNP and HUDEP2 mixture, insert it into Neon TM Tube, set the electroporation parameters to 1200V, 40ms, 3plus, complete the electroporation, and quickly transfer the electroporation product into freshly incubated HUDEP2 proliferation medium.

[0093] For electroporation of CD34+ hematopoietic stem and progenitor cells, 6 μL of CRISPR-Cas9 RNP incubation product or 49-3A-57EP single-base editing tool RNA was mixed with 20 μL of resuspended cells and added to an electroporation cuvette. Electroporation was performed using the E0-100 program on the Lonza 4D-Nucleofector electroporation system. Finally, the electroporation product was transferred to the pre-incubated fresh CD34+ hematopoietic stem and progenitor cell proliferation medium.

[0094] Measurement and analysis of 3CRISPR editing efficiency

[0095] CRISPR-Cas9-edited HUDEP2 cells were collected, washed once with PBS, and then 100 μL of lysis buffer and 3 μL of proteinase K were added. The cells were digested overnight at 65°C. Afterward, the cells were brought to room temperature, and 2 μL of RNase A was added. Digestion was performed at 37°C for 1 h, followed by extraction with an equal volume of phenol-chloroform-isoamyl alcohol. The cells were centrifuged at 12000 rpm for 10 min at room temperature, and the supernatant was transferred to a new 1.5 mL centrifuge tube. Extraction was performed again, followed by the addition of 1 / 10 volume of 3M sodium acetate and 2.5 volumes of anhydrous ethanol. The mixture was incubated at -80°C for 2 h, then centrifuged at 12000 rpm for 15 min at 4°C. The supernatant was discarded, and the cells were washed three times with 75% ethanol. The DNA precipitate was dried and dissolved in TE buffer.

[0096] The first round of PCR used extracted HUDEP2 cell genomic DNA as a template. Primers were designed to amplify the DNA region near the editing site. To avoid the influence of identical fragments on subsequent next-generation sequencing, an additional 1-3 bases were added to the primers. There were 4 forward and 4 reverse primers. The NGS-P5-HBB F: T CTTTCCCTACACGACGCTCTTCCGATCTAGCCAGTGCCAGAAGAGC, NGS-P5-HBB F1: TCTTTCCCTACACGACGCTCTTCCGATCTTAGCCAGTGCCAGAA GAGC, NGS-P5-HBB F2: TCTTTCCCTACACGACGCTCTTCCGATCTGCAGC CAGTGCCAGAAGAGC, NGS-P5-HBB F3: TCTTTCCCTACACGACGCTCTTC CGATCTCTTAGCCAGTGCCAGAAGAGC, and NGS-P7-HBB R: AGTTCAGACGT GTGCTCTTCCGATCCACCACCAACTTCATCCAC, NGS-P7-HBB R1: AGTTC AGACGTGTGCTCTTCCGATCACACCACCAACTTCATCCAC, NGS-P7-HBB R2: AGTTCAGACGTGTGCTCTTCCGATCGTCACCACCAACTTCATCCAC, NG S-P7-HBB R3: AGTTCAGACGTGGTGCTCTTCCGATCTGTCACCACCAACTTCATCCAC, NGS-P5-HBG F: TCTTTCCTACACGACGCTCTTCCGATCTGGAA TGACTGAATCGGAACA, NGS-P5-HBG F1: TCTTTCCTACACGACGCTCTT CCGATCTAGGAATGACTGAATCGGAACA, NGS-P5-HBG F2: TCTTTCCCTA CACGACGCTCTTCCGATCTTCGGAATGACTGAATCGGAACA, NGS-P5-HBG F3: TCTTTCCCTACACGACGCTCTTCCGATCTCATGGAATGACTGAATCGGA ACA, NGS-P7-HBG R: AGTTCAGACGTGGTGCTCTTCCGATCTGGAACTGCT GAAGGGTG, NGS-P7-HBG R1: AGTTCAGACGTGTGCTCTTCCGATCATGGAACTGCTGAAGGGTG,NGS-P7-HBG R2: AGTTCAGACGTGTGCTCTTCCG ATCGCTGGAACTGCTGAAGGGTG; NGS-P7-HBG R3: AGTTCAGACGTGTG CTCTTCCGATCCACTGGAACTGCTGAAGGGTG. PCR conditions were: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 30 s, 57℃ annealing for 20 s, 72℃ extension for 30 s, for a total of 21 cycles, with a final extension at 72℃ for 2 min. After PCR, the PCR products were purified using magnetic beads. The primers used in the subsequent second round of PCR were purified using the same methods. PCR products near the edited sites were dissolved in TE buffer and sent to the company for next-generation sequencing.

[0097] Next-generation sequencing results were downloaded to a server, and the editing efficiency and the types of Indels or base substitutions produced were analyzed. The analysis software used was CRISPResso2, and the website is https: / / github.com / pinellolab / crispresso2. The analysis yielded the CRISPR-Cas9 editing efficiency and the types of Indels produced in HUDEP2 cells, as well as the percentage of each Indel type. After editing the CACCC element on HBB, the sequences with missing bases include CAC, CC, CACC, C, ACCC, CCC, and the complete deletion of CACCC; the sequences with inserted bases include CACCCc, CAaCCC, CACtCC, and CACacattggCC; and the sequences with substituted bases include CACTC and CACT. After editing the TGACCA element on HBG, the sequences with missing bases include TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, and the complete deletion of TGACCA; and the sequences with inserted bases include TGAAtCCA, TGAcaaggctattgCCA, TGAaCCA, and TGA A. Analysis revealed the single-base editing efficiency and base substitution types of 49-3A-57EP cells in CD34+ hematopoietic stem and progenitor cells. Among them, the base substitution sequences after editing the CACCC element on HBB were TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TA TTC, TATCT, TACTT, CATTT, and TATTT; the base substitution sequence after editing the TGACCA element on HBG was TAACCA.

[0098] 4. Culture of monoclonal cells

[0099] CRISPR-Cas9-edited HUDEP2 cells or CD34+ hematopoietic stem and progenitor cells were proliferated and cultured. Once the cells were in good condition, they were counted. 900 μL of proliferation medium was added to multiple 1.5 mL centrifuge tubes. After remixing the cell culture medium by pipetting, 100 μL of cell culture medium was added to each 900 μL tube, and this tube was labeled -1. After remixing the cell culture medium in this tube, another 100 μL of cell culture medium was added to the next 900 μL tube, and this tube was labeled -2. This process of 10-fold dilution was continued until the number of cells in the last tube was on the same order of magnitude as the number of pre-differentiated single clones.

[0100] Calculate the culture medium volume based on the pre-differentiated number of single clones. For each 96-well plate, calculate 100 wells for each cell culture, adding 150 μL of culture medium per well. Calculate the total volume of proliferation medium needed, measure it, and place it in a 50 mL centrifuge tube. Add a certain volume of diluted last tube of cell culture medium (calculated based on 0.5 cells per well), and mix thoroughly by inverting the tube. Then, pour the mixed cell culture medium into a sterile loading dish and use a multi-channel pipette to add 150 μL of cell culture medium to each well of the 96-well plate.

[0101] The 96-well cell culture plates containing cells were incubated at 37°C, 5% CO2, and saturated humidity. After one week of monoclonal cell culture, the number of cell colonies and the number of cells per colony were observed under a microscope. The presence of monoclonal cells in each well was determined by the formation of one colony per well and a cell count not exceeding 128 per colony. Wells containing monoclonal cells were supplemented with 100 μL of proliferation medium and cultured for another week. The monoclonal cells were then transferred from the 96-well plates to 24-well plates and cultured for approximately 5 days. The monoclonal cells were then transferred from the 24-well plates to 6-well plates to expand the monoclonal cell count. Simultaneously, a portion of the cells was separated for genome extraction and genotyping.

[0102] 5. Extraction, reverse transcription, and quantitative PCR of total RNA from cells

[0103] Five days after HUDEP2 cell induction for erythroid differentiation or 12 days after CD34+ hematopoietic stem and progenitor cells in vitro differentiation, 2×10⁻⁶ cells were harvested. 6 Centrifuge each cell at 300g for 5 minutes, discard the supernatant, and add 1 mL of TRIzol. TMThe reagent (Invitrogen 15596026) was thoroughly mixed by pipetting until no cell pellet was observed and the liquid was homogeneous and non-viscous. The TRIzol-treated HUDEP2 cell lysate was removed from the -80°C freezer and allowed to thaw completely. 200 μL of chloroform was added, and the mixture was vigorously shaken for 30 seconds. After standing at room temperature for 5 minutes, it was centrifuged at 12000g for 15 minutes at 4°C. 500 μL of the upper aqueous phase was transferred to a new 1.5 mL centrifuge tube, and an equal volume of isopropanol was added to precipitate the RNA. The mixture was inverted and mixed thoroughly, then incubated for 10 minutes. It was then centrifuged again at 12000g for 15 minutes at 4°C, and RNA precipitation was observed. The supernatant was discarded, and the cell was washed 2–3 times with 70% ethanol (prepared with DEPC water). The supernatant was discarded again, and the RNA precipitate was air-dried at room temperature. An appropriate amount of RNase-free water was added to dissolve the precipitate, and the concentration and purity of the RNA were determined using a spectrophotometer. The extracted RNA was stored at -80°C.

[0104] The kit used for reverse transcription of total cellular RNA to synthesize the first strand of cDNA was Takara's PrimeScript. TM The 1st Strand cDNA Synthesis Kit (6110A) was used. The specific procedure was as follows: The reverse transcription system was 20 μL, and the amount of RNA used for reverse transcription was 2 μg. First, the 2 μg RNA was diluted to 10.5 μL with RNase-free dH2O. Then, 1 μL of dNTP Mixture (10 mM each), 1 μL of Oligo dT Primer (50 μM), and 2 μL of Random 6mers (50 μM) were added. After mixing, the mixture was incubated at 72°C for 5 min, and then rapidly cooled on ice to open the RNA secondary structure. After incubation on ice for approximately 5 min, 1 μL of PrimeScript RTase (200 U / μL), 4 μL of 5×PrimeScript Buffer, and 0.5 μL of RNase Inhibitor (40 U / μL) were added. After mixing, the reverse transcription program was run at 30°C for 10 min, 42°C for 60 min, and 95°C for 5 min. After reverse transcription, the mixture was stored at -20°C.

[0105] 20 μL of the reverse transcription product of 2 μg total cellular RNA was diluted with 180 μL of dH2O to serve as the template for subsequent real-time quantitative PCR. When preparing the real-time quantitative PCR system, if detecting globin gene expression, add 0.5 μL of diluted template; if detecting the expression of major globin regulatory factors, add 1 μL of diluted template. The PCR reaction volume was 20 μL, containing 10 μL of 2×SYBR Green Mix, 1 μL of forward and reverse primers (10 μM each), and 0.5 μL or 1 μL of cDNA template. At least three replicates were set for each gene per sample. After adding the PCR reaction solution to the 96-well plate, the plate was sealed and loaded onto the instrument. The real-time quantitative PCR instrument used was a BioRad CFX96. The PCR reaction program was: 94℃ pre-denaturation for 1 min; 94℃ for 10 s, 60℃ for 20 s, 72℃ for 30 s, for 40 cycles. A fluorescence signal detection program was added after the 72℃ amplification in each cycle. After 40 PCR cycles, a melting curve program was added as follows: 95℃ for 1 min, 60℃ for 1 min, then the temperature was increased from 60℃ to 95℃ at a rate of 0.5℃ every 10 seconds. Fluorescence signals were detected at each step of the process. Primers used for real-time quantitative PCR were designed using conventional methods.

[0106] 6. HPLC determination of hemoglobin expression

[0107] The chromatographic column used for high performance liquid chromatography (HPLC) determination of hemoglobin was PolyCAT A from PolyLC. TM chromatographic column (3μm, 35×4.6mm, 3.54CT0315). For HPLC determination of hemoglobin, solution A was a 20mM Bis-Tris solution at pH 6.8, and solution B was a 20mM Bis-Tris and 200mM NaCl solution at pH 6.9. HUDEP2 samples were collected 3×10⁻⁶ days after differentiation for hemoglobin determination. 6 Cells were washed with PBS, the supernatant was removed, and the cells were frozen at -80°C. When hemoglobin was to be measured, the HUDEP2 sample was removed, brought to room temperature, and 30 μL of 0.01% SDS was added and the cells were incubated on ice for 10 min for cell lysis. The lysis buffer was then filtered through a Millipore PVDF membrane ultrafiltration-MC centrifuge filter (UFC30HV00). 20 μL of the filtered lysis buffer was added to 80 μL of solution A and incubated on ice for 30 min. The incubation product was then transferred to an HPLC sample tube for analysis. The hemoglobin was measured using a Thermo Fisher Ultimate 3000 HPLC system.

[0108] 7. Flow cytometry analysis to determine the proportion of F cells

[0109] Take 1×10 6 HUDEP2 cells in good proliferative condition were centrifuged at 300g for 5 min, the supernatant was discarded, and the cells were resuspended in 1 mL PBS-0.1% BSA, centrifuged again, and the supernatant was discarded. Then, 1 mL of pre-chilled 0.05% glutaraldehyde solution was added for cross-linking, and the cells were incubated at room temperature for 10 min. After washing three times with 1 mL PBS-0.1% BSA, 0.5 mL of 0.1% Triton X-100 was added for membrane permeabilization. After incubation at room temperature for 3–5 min, 0.5 mL PBS-0.1% BSA was added, and the cells were centrifuged at 300g for 5 min, the supernatant was discarded, and the cells were washed three times again with 1 mL PBS-0.1% BSA. 2 × 10⁻⁶ cells were collected. 5 Each cell was placed in a new 1.5 mL centrifuge tube, and the total volume was increased to 100 μL with PBS-0.1% BSA. 2 μL of HbF-APC (ThermoFisher's MHFH00) or 2 μL of Mouse IgG1-APC (ThermoFisher's MHFH05) was added as an isotype control. After incubation at room temperature in the dark for 15 min, the cells were washed three times with 1 mL of PBS-0.1% BSA and then analyzed by C6 Plus flow cytometry.

[0110] 8. Chromosome conformation capture (3C) technique

[0111] 8.1 Cell fixation

[0112] HUDEP2 counts were performed 5 days after induced erythroid differentiation, and 1×10⁻⁶ was used. 7 Centrifuge cells at 300g for 5 min, wash once with PBS, resuspend cells in 10 mL PBS, add 278 μL of 37% formaldehyde solution (final concentration 1%), shake immediately, and crosslink on a shaker at room temperature for 10 min. Then add 894 μL of 2.5M glycine solution (final concentration 0.2M), mix immediately to terminate the crosslinking reaction, and shake gently on a shaker at room temperature for 5 min, then incubate at 4℃ for 20 min. Centrifuge at 500g for 10 min at 4℃, discard the supernatant, wash once with PBS, centrifuge again, and discard the supernatant.

[0113] 8.2 Cell nucleus extraction and membrane perforation

[0114] Add 1 mL of pre-chilled 3C lysis buffer (10 mM Tris-HCl, 10 Mm NaCl, 0.2% NP-40) containing protease inhibitors to the cell pellet, mix well by pipetting, resuspend the cells, and lyse them on ice for 30 min. Afterwards, centrifuge at 800 g for 5 min at 4°C, wash twice with 1 mL PBS, and then add 1 × 10⁻⁶ cells. 7 After cell membrane perforation, each cell was placed in a 1.5 mL centrifuge tube, the supernatant was discarded, and the tube was stored at -80°C for subsequent 3C operations. After thawing the frozen 3C sample to room temperature, 392 μL of 1×NEB CutS mart Buffer was added to resuspend the cell nuclei. Then, 8 μL of 10% SDS (final concentration 0.2%) was added, mixed thoroughly, and incubated at 62°C for 1 hour at 950 rpm, followed immediately on ice. Then, 40.82 μL of 20% Triton X-100 (final concentration 2%) was added to the sample to neutralize the SDS, mixed thoroughly (avoiding air bubbles), and incubated at 37°C for 1 hour at 950 rpm. 10 μL of the sample was used as the undigested control (UD C).

[0115] 8.3 Enzyme digestion of 3C samples

[0116] After centrifuging the sample at 800g for 5 min at 4°C, the supernatant was discarded, and the cell nuclei were resuspended in 300 μL of 1×NEB CutSmart Buffer. The mixture was thoroughly mixed, and then centrifuged again at 800g for 5 min at 4°C, discarding the supernatant. Next, a 250 μL restriction enzyme digestion system was prepared by adding 220 μL of water, 25 μL of 10×NEB CutSmart Buffer, and 300 U of EcoRI-HF restriction enzyme to the sample. The mixture was thoroughly mixed and incubated at 950 rpm in a 37°C metal bath for at least 20 h. Then, 200 U of EcoRI-HF restriction enzyme was added, and incubation continued for another 3 h. Finally, the sample was incubated at 950 rpm in a 65°C metal bath for 30 min to inactivate the restriction enzyme, and then quickly placed on ice. A 10 μL sample was taken as the control group (DC) after enzyme digestion. Together with the previous UDC group, 40 μL of proteinase K buffer and 5 μL of proteinase K were added. After digestion at 65°C for 2 h, 1 μL of RNase A was added. After digestion at 37°C for 30 min, genomic DNA was extracted by phenol-chloroform extraction and the enzyme digestion efficiency was detected.

[0117] 8.4 3C Sample Connection

[0118] After restoring the digested 3C samples to room temperature, centrifuge at 800g for 5 min at 4°C and discard the supernatant. Resuspend the samples in 200 μL of 1×T4 DNA ligase Buffer, centrifuge again at 800g for 5 min at 4°C, and discard the supernatant. Then add 221 μL of water, 25 μL of 10×T4 DNA ligase Buffer, 2.5 μL of 10 mg / mL BSA, and 2000 U of T4 DNA ligase to the samples, mix thoroughly, and incubate overnight at 4°C using a fan speed.

[0119] 8.5 Decrosslinking and purification of linkage products

[0120] After centrifuging the ligation product at 800g for 5 min at 4°C, discard 200 μL of supernatant and resuspend the cell nuclei in 200 μL of water. Then add 25 μL of 10% SDS and 25 μL of 20 mg / mL proteinase K, incubate at 55°C for 30 min, add 30 μL of 5M NaCl, and incubate overnight at 65°C in a metal bath to decrosslink. After the sample has returned to room temperature, add 2 μL of 10 mg / mL RNase A and incubate at 37°C for 30 min. Then add an equal volume of phenol-chloroform for extraction, centrifuge at 12000g for 10 min at room temperature, transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, and repeat the extraction three times, followed by one chloroform extraction. Add 0.1 volume of 3M sodium acetate and 2.5 volume of anhydrous ethanol to the upper aqueous phase, mix thoroughly, and incubate at -80°C for at least 2 h. The sample was then centrifuged at 12000g for 15 minutes at 4°C. The supernatant was discarded, and the sample was washed three times with 75% ethanol. The precipitate was then dried and dissolved in 100μL of water. The sample could be placed at 37°C for 30 minutes to aid DNA dissolution.

[0121] 8.6 Quantitative PCR to determine the strength of interactions

[0122] βD-BAC was digested with EcoRI-HF, ligated, and the ligation product was recovered and used as a template for amplification primer correction. For real-time quantitative PCR, the amount of purified BAC product per well was 0.04 ng, and the amount of purified 3C product per well was 70 ng. PCR reaction conditions were 95℃ for 30 s; 95℃ for 8 s, 57℃ for 20 s, and 72℃ for 25 s, for a total of 40 cycles. 3C PCR primers were designed using conventional methods.

[0123] 9. Chromatin immunoprecipitation (ChIP)

[0124] 9.1 Cell Fixation

[0125] Five days after HUDEP2-induced erythroid differentiation and 12 days after CD34+ hematopoietic stem and progenitor cells differentiated in vitro, cells were collected for cross-linking and fixation, using the same method as the cell fixation method in the 3C experiment.

[0126] 9.2 Nucleus lysis and sonication

[0127] Add 1 mL of pre-chilled 3C lysis buffer (10 mM Tris-HCl, 10 Mm NaCl, 0.2% NP-40) containing protease inhibitors to the cell pellet, mix well by pipetting, resuspend the cells, and lyse them on ice for 30 min. Afterwards, centrifuge at 800 g for 5 min at 4°C, wash twice with 1 mL PBS, and then lyse the cells at 1.2 × 10⁻⁶ m³ / h. 7 After cell membrane lysis, cells were placed in 1.5 mL centrifuge tubes, the supernatant was discarded, and the cells were stored at -80°C. After thawing the frozen cells to room temperature, they were resuspended in 1 mL of pre-chilled NCP buffer I, placed on ice for 10 min, and centrifuged at 3000 g for 5 min at 4°C. The supernatant was discarded, and the cells were resuspended in 600 μL of ChIP lysis buffer and placed on ice for 30 min to lyse the nuclear membrane. The ChIP samples were then sonicated for 10 cycles using a Bio-Oruptor non-contact sonicator in High mode with 30 s on and 30 s off. 20 μL of the sonicated sample was then added to 30 μL of water, 2 μL of 5 M NaCl, and 20 μg of proteinase K for overnight digestion. After phenol-chloroform extraction, electrophoresis was performed to check that the band size after sonication was between 200 bp and 1 kb.

[0128] 9.3 Immunoprecipitation

[0129] Aliquot the sonicated samples into 1.5 mL centrifuge tubes. Set aside 5 μL of the sample in one tube as the Input group, and allocate the remaining sample in 300 μL tubes as the IgG group and the target antibody group, respectively. Store the Input group at 4°C for later use. Add IP buffer to the IgG group and the target antibody group to bring the volume to 1.2 mL. Perform preclear treatment on the IgG group and the target antibody group by adding the corresponding normal IgG to each group, followed by 20 μL of the corresponding Invitrogen Dynabeads protein A or G (Dynabeads protein A for rabbit-derived antibodies, Dynabeads protein G for mouse, goat, and sheep-derived antibodies). Mix thoroughly and shake slowly at 4°C for 2.5 h to remove non-specifically bound impurities.

[0130] Place the pretreated centrifuge tubes on a magnetic rack and let them stand for 1 minute. Then transfer the supernatant to a new 1.5 mL centrifuge tube. Add the corresponding normal IgG to the IgG group and the corresponding target antibody to the target antibody group. The amount of antibody added should be according to the dosage provided in the antibody instructions. After thorough mixing, shake slowly at 4°C for 3 hours. Then add 30 μL of the corresponding Dynabeads protein A or G, mix thoroughly, and shake slowly at 4°C for at least 12 hours. Place the ChIP sample on a magnetic rack and let it stand for 1 minute. Discard the supernatant and wash the sample with a mixture of low-salt and high-salt wash buffers to remove bound impurity molecules.

[0131] 9.4 Isolation and purification of ChIP DNA

[0132] Add 220 μL of extraction buffer to the ChIP-sampled centrifuge tube, place it in a 25°C metal bath, and shake at 1000 rpm for 30 min. Then, place the centrifuge tube on a magnetic rack and let it stand for 1 min. Transfer the supernatant to a new 1.5 mL centrifuge tube. Next, add 200 μL of extraction buffer to the ChIP-sampled centrifuge tube, place it in a 25°C metal bath, and shake at 1000 rpm for 30 min. Then, place the centrifuge tube on a magnetic rack and let it stand for 1 min. Transfer the supernatant to the same centrifuge tube as the previously recovered supernatant.

[0133] These ChIP samples were digested together with the previously stored Input group samples at 4°C. 1 μL of proteinase K and 4 μL of 5M NaCl were added to every 100 μL of sample, mixed well, and digested overnight at 65°C. Afterwards, each group of samples was brought to room temperature, and 20 μL of RNase A was added, followed by digestion at 37°C for 45 min. Then, an equal volume of phenol-chloroform-isoamyl alcohol was added, and after vortexing for 1 min, the mixture was centrifuged at 12000 rpm for 10 min. The supernatant was transferred to a new 1.5 mL centrifuge tube, and then extracted twice with phenol-chloroform-isoamyl alcohol, followed by one extraction with chloroform to remove residual phenol. Next, 0.1 volume of 3M sodium acetate and 2.5 volume of anhydrous ethanol were added to the supernatant, and the mixture was incubated at -80°C for at least 3 h. After centrifugation at 4°C for 12000 rpm for 15 min, the supernatant was discarded, and the sample was washed three times with 75% ethanol. The supernatant was then discarded, the DNA precipitate was dried, and 100 μL of water was added to dissolve the DNA.

[0134] 9.5 Various solutions used in ChIP experiments

[0135] The 3C lysis buffer, NCP buffer I, ChIP lysis buffer, IP buffer, Wash buffer I, Wash buffer II, Wash buffer III, Wash buffer IV, and Extraction buffer were configured using conventional methods.

[0136] 9.6 Quantitative PCR reaction

[0137] Quantitative PCR was performed on the purified and recovered ChIP products. The Input group, IgG group, and target antibody group were all PCR-tested in the same 96-well PCR plate, with 20 μL per well. The PCR reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 57℃ annealing for 20 s, and 72℃ extension for 30 s, for a total of 40 cycles. The qPCR primers used in the ChIP experiments were designed using conventional methods.

[0138] II. Experimental Results

[0139] To identify the elements regulating γ-globin expression on HBB, a CRISPR-Cas9 screening experiment was performed in HUDEP2 cells (human umbilical cord-derived erythrocyte progenitor cells). The lentiviral library used in the screening experiment included 3761 gRNAs targeting the downstream gene region of HBG (hg38 / GRCh38, chr11:5204054-5248601), of which 24 gRNAs targeted homologous sequences of HBB and HBD. Cells infected with the lentiviral library were sorted according to HbF expression levels, and the gRNA sequences in the cells were sequenced and analyzed. Figure 2 a). HbF with high HbF expression high Among the gRNAs enriched in cells, the top seven are homologous sequences targeting both HBB and HBD (including the HBB promoter in the middle region), followed by the proximal CACCC element of KLF1 on the HBB promoter. Figure 1 a, Figure 1 b). This aligns with previous findings that KLF1 is a major transcription factor activating HBB expression in adulthood and plays a crucial role in the formation of active chromatin centers on the β-globin gene cluster and the establishment of chromatin conformations for the interaction between HBB and LCR. KLF1 has proximal and distal CACCC elements on HBB (which were also enriched in CRISPR screening experiments). Figure 2 b). Mutations in these elements in the population can increase HbF to 1.3-65% of the overall hemoglobin level. Figure 1b). In this embodiment, PM-gRNA-1 and PM-gRNA-2 were designed to target the proximal CACCC element on HBB, DM to target the distal CACCC element on HBB, and GM to target the BCL11A TGACCA element on HBG as a positive control. Electroporation of these gRNAs in HUDEP2 cells increased HbF expression by approximately 11-fold, 7-fold, 5-fold, and 83-fold, respectively. Figure 1 c. Figure 2 c). The level of F cells could also be increased from 3% in the control to 35%, 21%, 15%, and 60%, respectively. Figure 1 d). Subsequently, electroporation of RNP complexes containing these gRNAs in peripheral blood CD34+ hematopoietic stem cells (HSPCs) from normal individuals showed that editing the CACCC element on HBB increased γ-globin expression, but the increase was weaker than that of editing the TGACCA element on HBG. Figure 1 e). Consistent with previous studies, mutations in the CACCC element weaken the binding of KLF1 to HBB. Figure 2 d). To confirm whether mutations in the CACCC element on HBB would alter the interaction between HBB and LCR and subsequent chromatin conformation, this embodiment conducted a 3C experiment. The results showed that editing the CACCC element weakened the interaction between HBB and LCR, while enhancing the interaction between HBG and LCR. Figure 1 f). It was also found that editing the CACCC element increased RNAP binding, H3K4me3, and H3K9Ac active transcriptional epigenetic modification signals on HBG, but the increase was weaker compared to editing the TGACCA element on HBG. Figure 1 g、 Figure 2 e). This indicates that HBG remains in an epigenetic state after the CACCC element mutation.

[0140] Example 2: Simultaneous disruption of HBB competition and HBG epigenetic repression can completely reverse the γ-to-β-globin expression conversion.

[0141] I. Experimental Methods

[0142] 1HUDEP2 Cell electroporation

[0143] Preparations before electroporation and preparation of the CRISPR-Cas9 RNP for electroporation were as described in Example 1. Then, 6 μL of the CRISPR-Cas9 RNP incubation product containing GM-gRNA was mixed thoroughly with 6 μL of resuspended cells, and the mixture was placed in a Neon... TM Add 3 mL of E2 buffer to the tube and use Neon. TM Pipette inserted 10μL Neon TMTip, and draw up the RNP and HUDEP2 mixture, insert it into Neon TM Using a tube, set the electroporation parameters to 1200V, 40ms, and 3+, complete the electroporation, and quickly transfer the electroporation product into freshly incubated HUDEP2 proliferation medium. After two days of culture, perform a second electroporation on these cells using CRISPR-Cas9 RNP incubation products containing PM-gRNA1 or DM-gRNA to simultaneously mutate the CACCC element on HBB and the TGACCA element on HBG.

[0144] Measurement and analysis of CRISPR editing efficiency

[0145] The method for determining CRISPR editing efficiency was the same as described in Example 1. Next-generation sequencing results were downloaded to a server, and the editing efficiency and the types of Indels generated were analyzed. The analysis software used was CRISPResso2, and the website was https: / / github.com / pinellolab / crispresso2. The analysis yielded the CRISPR-Cas9 editing efficiency and the types of Indels generated in HUDEP2 cells, as well as the percentage corresponding to each Indel type. After editing the CACCC element on HBB, the sequences with missing bases include CAC, CC, CACC, C, ACCC, CCC, and the complete deletion of CACCC; the sequences with inserted bases include CACCCc, CAaCCC, CACtCC, and CACacattggCC; and the sequences with substituted bases include CACTC and CACT. After editing the TGACCA element on HBG, the sequences with missing bases include TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, and the complete deletion of TGACCA; and the sequences with inserted bases include TGAAtCCA, TGAcaaggctattgCCA, TGAaCCA, and TGAA.

[0146] 3. Culture of monoclonal cells

[0147] The specific method for culturing monoclonal cells is the same as described in Example 1.

[0148] 4. Extraction, reverse transcription, and quantitative PCR of total RNA from cells

[0149] The specific methods for extracting total RNA from cells, reverse transcription, and quantitative PCR are the same as those described in Example 1.

[0150] 5HPLC determination of hemoglobin expression

[0151] The specific HPLC method for determining hemoglobin expression is the same as described in Example 1.

[0152] 6. Flow cytometry analysis to determine the proportion of F cells

[0153] The specific method for determining the proportion of F cells using flow cytometry is the same as described in Example 1.

[0154] 7. Chromosome conformation capture (3C) technique

[0155] The specific chromatin conformation capture technology detection method is the same as described in Example 1.

[0156] 8. Chromatin immunoprecipitation (ChIP)

[0157] The specific chromatin immunoprecipitation method is the same as described in Example 1.

[0158] II. Experimental Results

[0159] Even after mutating the CACCC element on HBB, HBG remains epigenetically suppressed. Therefore, this invention hypothesizes that relieving this suppression of HBG may further enhance γ-globin expression. HBG silencing in adulthood involves many repressive factors, especially BCL11A, the major repressor of HbF, which can recruit epigenetic repressive factors such as the NuRD complex to epigenetically silence HBG expression. Epigenetic suppression of HBG can be relieved by disrupting the distal TGACCA element of BCL11A. Therefore, in this embodiment, simultaneous editing of the CACCC element on HBB and the TGACCA element on HBG in HUDEP2 cells showed that, compared with editing the TGACCA element alone, combined editing increased γ-globin expression by approximately 1.9-fold (PG) and 1.8-fold (DG). Figure 3 a). HbF levels could be increased from 8.6 mAU*min to 18.2 mAU*min and 16.8 mAU*min ( Figure 4 a). The proportion of F cells also increased similarly. Figure 4 b). In the CRISPR screening experiment described above, performed on HUDEP2 monoclonal cells GM-Clone13 with homozygous edited TGACCA elements, gRNAs targeting the CACCC element on the HBB promoter were also enriched. Figure 4 c). In HUDEP2 monoclonal cells simultaneously edited with CACCC and TGACCA elements, almost exclusive expression of γ-globin was observed, while β-globin expression was almost nonexistent, achieving a complete reversal of the γ-to-β-globin expression conversion. Figure 3 b, c). Furthermore, simultaneous mutation of both elements further increased the modification of H3K4me3 and H3K9Ac on HBG (b, c). Figure 3d) The interaction between HBG and LCR is further enhanced, while the interaction between HBB and LCR is weakened. Figure 3 e), while the binding of KLF1 to HBB is further weakened ( Figure 4 d).

[0160] Example 3: Complete reversal of γ-to-β-globin expression conversion in vivo.

[0161] I. Experimental Methods

[0162] Construction of 1β-BAC mice and gene editing at specific sites

[0163] The BAC vector containing approximately 97kb of human β-globin gene cluster was microinjected into C57 mouse zygotes and transplanted into surrogate mother mice to produce offspring transgenic mice. The integrity, copy number, and globin expression of the transgene in the offspring mice were identified, thus completing the construction of β-BAC mice.

[0164] Subsequently, mice were constructed by site-editing the CACCC element on the HBB gene and the TGACCA element on the HBG gene using CRISPR-Cas9 RNP. 0.6 μL of 62 μM (IDT 1081058) Alt-R SpHiFi Cas9 Nuclease V3 (approximately 32 pmol), 1.8 μL of 44 μM sgRNA synthesized by IDT (approximately 80 pmol) were added to an RNase-free centrifuge tube, and the volume was brought to 60 μL with RNase-free water. After incubation at room temperature for 15 min, the tube was centrifuged, and the supernatant was aliquoted into centrifuge tubes for later use. The sgRNA sequence is mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAG CAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU. The gRNA target sequences are as follows: PM-gRNA1: ACCCTGTGGAGCCACA CCCT, PM-gRNA2: GGGTGTGGCTCCACAGGGTG, DM-gRNA: CTTGTCAAGG CTATTGGTCA, GM-gRNA: CTTGTCAAGGCTATTGGTCA. The prepared RNPs were then microinjected into β-BAC mouse zygotes, and offspring mice were produced by surrogate mothers. Genotyping of the mice yielded GM-BAC mice with a TGACCA element mutation on HBG, and PG-BAC and DG-BAC mice with simultaneous mutations in both the TGACCA element on HBG and the CACCC element on HBB.

[0165] 2. Detection of β-globin expression at different developmental stages in β-BAC mice and site-edited mice.

[0166] Yolk sacs of β-BAC, GM-BAC, PG-BAC, and DG-BAC mice at embryonic day 10.5, livers at fetal days 12.5, 14.5, and 16.5, and spleens of newborn mice were collected. Ter119-positive erythroid terminally differentiated cells in these tissues and organs were enriched using anti-Ter119 magnetic beads (procedure was performed according to Miltenyi's product manual, catalog number 130-049-901). RNA was extracted and reverse transcribed. The expression of β-globin genes was detected by quantitative real-time PCR. The qPCR primers used were designed using conventional methods.

[0167] II. Experimental Results

[0168] To confirm the effect of simultaneous mutations of the CACCC and TGACCA elements in vivo on globin expression conversion, this example established a single-copy transgenic mouse β-BAC carrying a ~97kb human β-globin gene cluster. From this mouse, mice with TGACCA element mutations (GM-BAC), as well as mice with simultaneous mutations of both TGACCA and CACCC elements (PG-BAC and DG-BAC) were established. Figure 5 a). This invention examined the expression of β-globin genes in these hemicolectic mice from embryonic day 10.5 to newborn. It was found that wild-type β-BAC mice exhibited normal γ-to-β-globin expression conversion, while GM-BAC mice showed delayed γ-to-β-globin expression conversion, with γ-globin expression still suppressed at birth. However, in PG-BAC and DG-BAC mice, γ-globin was exclusively expressed from embryonic day 12.5 to birth, while β-globin was almost not expressed. This indicates that simultaneous mutation of the CACCC element on HBB and the TGACCA element on HBG achieves complete reversal of the γ-to-β-globin expression conversion in mice. Figure 5 b).

[0169] Example 4: Enhanced HbF expression in human primary erythroid cells by combining CACCC and TGACCA elements.

[0170] I. Experimental Methods

[0171] Electroporation of 1CD34+ hematopoietic stem and progenitor cells

[0172] Before electroporation, the density of CD34+ hematopoietic stem and progenitor cells derived from peripheral blood of healthy individuals or from β-thalassemia patients (codon 17(A>T) / codon 41 / 42(–TTCT)) was controlled to ensure optimal cell growth. Fresh proliferation medium was added to the wells of the plates beforehand, and the plates were incubated at 37°C, 5% CO2, and saturated humidity to provide favorable culture conditions for electroporation. Cells were counted, and 5 × 10⁵ cells were resuspended in 20 μL of solution P3 before electroporation. 4 Each cell.

[0173] The preparation of CRISPR-Cas9 RNP for electroporation was as described in Example 1. Then, 6 μL of CRISPR-Cas9 RNP incubation product containing GM-gRNA was mixed thoroughly with 20 μL of resuspended cells and added to an electroporation cuvette. Electroporation was performed using the E0-100 program on the Lonza 4D-Nucleofector electroporation system. Finally, the electroporation product was transferred to freshly incubated CD34+ hematopoietic stem / progenitor cell proliferation medium to complete the electroporation, and the electroporation product was quickly transferred to freshly incubated proliferation medium. After two days of culture, these cells were subjected to a second electroporation using CRISPR-Cas9 RNP incubation product containing PM-gRNA1 or DM-gRNA to simultaneously mutate the CACCC element on HBB and the TGACCA element on HBG.

[0174] Measurement and analysis of CRISPR editing efficiency

[0175] The specific methods for measuring and analyzing CRISPR editing efficiency are the same as those described in Example 1.

[0176] 3. Culture of monoclonal cells

[0177] The specific culture method is the same as described in Example 1. The 96-well cell culture plate containing cells was placed at 37°C, 5% CO2 and saturated humidity. The wells containing monoclonal cells were replaced with erythroid in vitro differentiation medium after 7 days of in vitro proliferation. Cells were harvested at the end of differentiation and genotyping and globin expression were detected.

[0178] 4. Extraction, reverse transcription, and quantitative PCR of total RNA from cells

[0179] 2×10⁻⁶ CD34+ hematopoietic stem cells were collected 12 days after erythroid differentiation induced by CD34+ hematopoietic stem cells. 6 The total RNA of each cell was extracted, reverse transcribed, and quantitatively PCR detected using the specific methods described in Example 1.

[0180] 5HPLC determination of hemoglobin expression

[0181] The specific HPLC method for determining hemoglobin expression is the same as described in Example 1.

[0182] 6. Flow cytometry analysis to determine the proportion of F cells

[0183] The specific method for determining the proportion of F cells using flow cytometry is the same as described in Example 1.

[0184] 7. Chromosome conformation capture (3C) technique

[0185] The specific chromatin conformation capture technique is the same as described in Example 1.

[0186] 8. Chromatin immunoprecipitation (ChIP)

[0187] The specific method for chromatin immunoprecipitation is the same as described in Example 1.

[0188] 9-Benzidine-Gymsa staining

[0189] CD34+ hematopoietic stem and progenitor cells differentiated into erythroid cells in vitro for 12 days were spread on a glass slide, fixed with methanol for 4 minutes, stained with benzidine staining solution for 2 minutes, stained with hydrogen peroxide solution for 1 minute and 30 seconds, washed with deionized water for 30 seconds, stained with Giemsa staining solution for 10 minutes, rinsed with PBS, air-dried at room temperature, and observed and photographed under a microscope.

[0190] II. Experimental Results

[0191] Boosting HbF expression can reduce hemoglobin polymerization, thereby alleviating the disease manifestations of β-hemoglobinopathies. To verify whether CACCC and TGACCA elements can boost HbF expression in human primary erythroid cells, this study edited the target site in CD34+ HSPCs derived from mobilized peripheral blood from healthy individuals and performed in vitro erythroid differentiation. It was found that compared to editing the TGACCA element alone, combined editing of CACCC and TGACCA elements increased γ-globin expression by 1.5-fold (PG) or 1.2-fold (DG). Figure 7 a). HbF levels can be increased from 79.3 mAU*min to 120.2 mAU*min and 91.2 mAU*min, respectively. Figure 6 a). The proportion of F cells also increased in the same way. Furthermore, editing in the HSPC does not affect erythroid segregation ( Figure 7 b). Consistent with the results obtained in HUDEP2 cells, combined mutation of these two elements increased the epigenetic modification signal of H3K9Ac on HBG, enhanced the interaction between HBG and LCR, and weakened the interaction between HBB and LCR. Figure 7 c, d). The invention was then validated in CD34+ cells from β-thalassemia patients, revealing that combined editing of these two elements enhanced γ-globin expression and the proportion of F cells (c, d). Figure 6 c, d, e and Figure 8 a). In CD34+ monoclonal cells, combined editing of these two elements increased γ-globin expression by 1.5-fold compared to editing the TGACCA element alone. Figure 8 b). Furthermore, editing in CD34+ cells derived from β-thalassemia patients does not affect erythroid differentiation ( Figure 8 c). Therefore, combining the editing of CACCC and TGACCA elements in artificial blood stem cells can enhance HbF expression.

[0192] In summary, this invention disrupts the interaction between HBB and LCR by mutating the CACCC element on HBB and relieving the epigenetic inhibition of HBG by mutating the TGACCA element on HBG, thereby increasing HbF expression to nearly 100% of the total hemoglobin level. This is the first time that the complete reversal of the γ-to-β-globin expression conversion has been achieved, providing a new treatment strategy and direction for β-hemoglobinopathies.

Claims

1. The application of reagents that simultaneously disrupt HBB competition and HBG epigenetic silencing in the preparation of drugs for the treatment of β-hemoglobinopathies; The simultaneous disruption of HBB competition and HBG apparent silencing is achieved by disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter. The simultaneous disruption of HBB competition and HBG epigenetic silencing is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter. The types of mutations include deletion, substitution, insertion, inversion, duplication, and / or translocation mutations; The deletion mutation includes the removal of one or more bases from the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; The substitution mutation includes replacing one or more bases of the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter with other bases; The insertion mutation includes the insertion of one or more bases at any position in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; The inversion mutation includes the reversal of one or more base positions in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; The repeat mutations include the repetition of one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; The translocation mutation includes the movement of one or more bases from one position to another in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter. The reagent includes gRNA; The gRNA is any one of BE-A+BE-C, BE-B+BE-C, PM-gRNA1+GM-gRNA, PM-gRNA2+GM-gRNA, and DM-gRNA+GM-gRNA; The BE-A sequence is: GCTATTGGTCAAGGCAAGGC; The BE-B sequence is: CAAGGCTATTGGTCAAGGCA; The BE-C sequence is: GTGGAGCCACACCCTAGGGT; The PM-gRNA1 sequence is: ACCCTGTGGAGCCACACCCT; The PM-gRNA2 sequence is: GGGTGTGGCTCCACAGGGTG; The DM-gRNA sequence is: CTTGTCAAGGCTATTGGTCA; The GM-gRNA sequence is: CTTGTCAAGGCTATTGGTCA.

2. The application according to claim 1, characterized in that, The deletion mutation refers to any one of the following: mutation of the CACCC element on the HBB promoter to a deletion of all elements of CAC, CC, CACC, C, ACCC, CCC, CACCCc, CAaCCC, CACtCC, CACacattggCC, CACTC, CACT, or CACCC; and mutation of the TGACCA element on the HBG promoter to a deletion of all elements of TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, TGAtCCA, TGAcaaggctattgCCA, TGAaCCA, TGaA, or TGACCA.

3. The application according to claim 1, characterized in that, The substitution mutation is to mutate the CACCC element on the HBB promoter to any one of TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TATTC, TATCT, TACTT, CATTT, or TATTT, and to mutate the TGACCA element on the HBG promoter to any one of TAACCA, TGATCA, TGACTA, or TGATTA.

4. The application according to claim 1, characterized in that, The technology used for the substitution mutation is selected from either single-base gene editing technology or CRISPR-Cas9 gene editing technology.

5. The application according to claim 1, characterized in that, The simultaneous disruption of HBB competition and HBG epigenetic silencing can achieve a complete reversal of the γ-to-β-globin expression conversion.

6. A pharmaceutical composition for treating β-hemoglobinopathies, characterized in that, The pharmaceutical composition comprises the reagent according to any one of claims 1-5; The reagent achieves complete reversal of the γ-to-β-globin expression conversion by simultaneously disrupting HBB competition and HBG epigenetic silencing.

7. The pharmaceutical composition according to claim 6, characterized in that, The pharmaceutical composition also includes a pharmaceutically acceptable carrier and / or excipients.

8. A pharmaceutical preparation for treating β-hemoglobinopathies, characterized in that, The pharmaceutical preparation comprises the pharmaceutical composition of claim 6 or 7.

9. A method for completely reversing the in vitro, non-therapeutic conversion of γ-to-β-globin expression, characterized in that, The method involves mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter to achieve a complete reversal of γ-to-β-globin expression conversion. The mutation is as described in any one of claims 1-3.

10. A method for promoting γ-globin expression and inhibiting β-globin expression in vitro without therapeutic intent, characterized in that, The method is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; The mutation is as described in any one of claims 1-3.

Images