Application of ITIH1 and galunisertib in preparation of medicine for treating hepatocellular carcinoma

Abstract

The invention discloses application of combination of ITIH1 and galunisertib in preparation of a medicine for treating hepatocellular carcinoma, and belongs to the technical field of biological medicine. The invention provides an application of combination of ITIH1 and galunisertib in preparation of a medicine for treating hepatocellular carcinoma. The medicine comprises a mixture of ITIH1 and galunisertib, or a mixture of a reagent for improving the expression quantity of ITIH1 and galunisertib. The reagent comprises a small molecule compound, an antibody drug, a protein, a nucleic acid molecule, a polypeptide, a lipid, a carbohydrate or a composition thereof. The invention finds a new function of ITIH1, that is, ITIH1 can be used as a tumor inhibition factor in the progress process of HCC; the invention finds that the combination of ITIH1 and galunisertib has a potential treatment effect on the progress of HCC; the result provides a potential new target and a new strategy for subsequent HCC clinical targeted therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of ITIH1 and galunisertib in preparing a medicine for treating hepatocellular carcinoma. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide. It is the sixth most commonly diagnosed malignancy and the fourth leading cause of cancer-related death. Despite tremendous efforts over the past few decades to develop treatment strategies, including surgical resection, liver transplantation, new therapeutic drugs, and combined treatments, the 5-year survival rate remains unsatisfactory.

[0003] Therefore, elucidating the molecular mechanisms of HCC and identifying new therapeutic options are crucial for HCC treatment. Summary of the invention

[0004] In view of this, the main purpose of the present invention is to provide an application of ITIH1 and galunisertib in the preparation of a drug for treating hepatocellular carcinoma. By determining the regulatory effect of ITIH1 expression on HCC, the ITIH1 gene or protein is combined with galunisertib for the prevention and treatment of HCC.

[0005] To achieve the above object, the present invention provides the use of ITIH1 in combination with galunisertib in the preparation of a drug for treating hepatocellular carcinoma.

[0006] Furthermore, the drug includes a mixture of ITIH1 and galunisertib, or a mixture of an agent that increases the expression level of ITIH1 and galunisertib.

[0007] Furthermore, the reagent includes small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or combinations thereof.

[0008] Furthermore, ITIH1 affects the metastasis of hepatocellular carcinoma by competitively binding to the ITGB1 / ITGA5 complex and inhibiting the integrin / FAK signaling pathway.

[0009] Furthermore, the expression level of ITIH1 is co-regulated by TGF-β stimulation and m6A modification.

[0010] The present invention also provides a drug, which comprises a mixture of a substance targeting ITIH1 protein and galunisertib, or a mixture of a substance targeting ITIH1 gene and galunisertib; the drug is indicated for hepatocellular carcinoma.

[0011] The present invention also provides a drug, which comprises a mixture of ITIH1 protein and galunisertib, or a mixture of ITIH1 gene and galunisertib, or a mixture of ITIH1 gene-related biological materials and galunisertib; the drug is indicated for hepatocellular carcinoma.

[0012] The beneficial effects of the present invention include at least:

[0013] The present invention discovered a new function of ITIH1, namely, ITIH1 can act as a tumor suppressor during the progression of HCC; the present invention found that the combination of ITIH1 and galunisertib has a potential therapeutic effect on the progression of HCC; this result provides a potential new target and new strategy for the subsequent clinical targeted treatment of HCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1The results of down-regulating ITIH1 by TGF-β stimulation in the embodiments of the present invention; wherein, (A) the results of co-immunoprecipitation (co-IP) of METTL3 and SMAD2 / 3. (B) The results of co-immunoprecipitation of Flag-SMAD3 and HA-METTL3 in 293T cells. (C) The results of co-immunoprecipitation of Flag-SMAD3 and HA-METTL3 in 293T cells with or without TGF-β stimulation for 12 hours. (D) The results of co-immunoprecipitation of Flag-SMAD3 and HA-METTL3 in 293T cells with or without TGF-β stimulation for 12 hours and galunisertib treatment for 12 hours. (E) The results of endogenous co-immunoprecipitation of SMAD3 and METTL3 with or without TGF-β stimulation for 12 hours. (F) Representative images of METTL3-EYFP aggregates in cells transfected with si-SMAD3 or treated with TGF-β for 12 hours. (G) Intersection of two RNA-seq datasets, 97H-Con vs.97H-shSMAD3 and 97H-Con vs.97H-shMETTL3. (H) Time-dependent relative changes in ITIH1 mRNA expression in HLF and 97H cells under TGF-β stimulation. (I) Relative luciferase activity of HLF cells transfected with pGL4.17 plasmid containing the ITIH1 promoter region after 12 hours of TGF-β stimulation. (J) Relative changes in ITIH1 mRNA expression in HLF cells when SMAD2 or SMAD3 was knocked down or overexpressed. (K) Relative changes in ITIH1 mRNA expression in plasmid-transfected HLF and 97H cells. (L) Representative results of IHC (immunohistochemistry) staining of ITIH1 in paraffin-embedded hepatocellular carcinoma (HCC) samples from Tongji Hospital. The right panel shows the statistical results of their expression in non-tumor tissues (N) and tumor tissues (T). The following graphs show the correlation between ITIH1 and METTL3 / SMAD3 expression determined from IHC results. Data are presented as mean ± SD in bar graphs. ns: no significant difference, : P < 0.05, : P < 0.01, : P < 0.001. M3, METTL3; Gal, galunisertib.

[0015] Figure 2 : The correlation between METTL3, SMAD3 and ITIH1 in the present invention, wherein (A) the levels of activated and total SMAD2 / SMAD3 were determined by WB in HLF cells and 97H cells after transfection with METTL3 and ALKBH5 and stimulation with TGF-β for 12 hours. (B) In 97H-Con and 97H-shSMAD3 cells, Figure 1Relative mRNA expression levels in G. (C) In 97H-Con and 97H-shMETTL3 cells, Figure 1 Relative mRNA expression levels of genes in G. (D) Correlation between ITIH1 and METTL3 expression and between ITIH1 and SMAD3 expression predicted by GEPIA analysis. (E) (F) Representative results of IHC (immunohistochemistry) staining of SMAD3 / METTL3 in paraffin-embedded hepatocellular carcinoma (HCC) specimens from Tongji Hospital. Their expression statistics in non-tumor tissues (N) and tumor tissues (T) are shown in the right panel.

[0016] Figure 3 The results of METTL3 regulating ITIH1 expression in an m6A-dependent manner in the examples of the present invention; wherein, (A) the relative expression level of ITIH1 mRNA when METTL3 is knocked out or overexpressed. (B) the relative expression level of ITIH1 after cells are transfected with plasmids of METTL3-wt (wild type) and METTL3-mut (catalytic site mutation). (C) the relative luciferase activity of cells stimulated by TGF-β or galunisertib after co-transfection of psiCHECK2 and METTL3 plasmids containing ITIH1 mRNA sequences. (D) the relative expression level of ITIH1 mRNA (two panels on the left) and the ITIH1 protein level (rightmost panel) of 293T cells stimulated by TGF-β or galunisertib after transfection of different concentrations of METTL3-wt or METTL3-mut. (E) schematic diagram of ITIH1 truncation mutants. (F) Protein levels of cells co-transfected with HA-METTL3 and Flag-ITIH1-FL (full length) / M5 in a concentration-dependent manner. (G) Relative luciferase activity of cells transfected with psiCHECK2 containing ITIH1-wt or ITIH1-M5 and overexpressing METTL3-WT. (H) Results of RNA pulldown using ITIH1-wt or ITIH1-M5. (I) MeRIP results in cells co-transfected with ITIH1-M5 and METTL3-Mut. Data are presented as mean ± SD in bar graphs. ns: no significant difference, : P < 0.05, : P < 0.01, : P < 0.001. Gal, galunisertib.

[0017] Figure 4 The predicted m6A sites in ITIH1. (A) The m6A sites in ITIH1 mRNA predicted by SRAMP. (B) The possible m6A sites in ITIH1 mRNA are indicated.

[0018] Figure 5WB validation of m6A sites in ITIH1. (A) Protein levels of cells co-transfected with HA-METTL3 and Flag-ITIH1-M1 / M2 / M3 / M4 in a concentration-dependent manner. (B) Protein levels of cells co-transfected with HA-METTL3 and ITIH1 truncation mutant plasmids in a concentration-dependent manner.

[0019] Figure 6 YTHDF2 promotes ITIH1 mRNA degradation in an m6A-dependent manner. (A) The remaining ITIH1 mRNA level in 97H-shMETTL3 cells after treatment with TGF-β, galunisertib, and actinomycin D for the indicated time. (B) The remaining ITIH1 mRNA level in 97H-oeMETTL3 cells after treatment with TGF-β, galunisertib, and actinomycin D for the indicated time. (C) The relative expression level of ITIH1 mRNA in 97H cells treated with YTHDF1 or YTHDF2 siRNA. (D) The results of RNA pulldown using ITIH1-wt or ITIH1-M5. (E) The relative changes in ITIH1 levels in 97H-shMETTL3 cells treated with TGF-β or galunisertib were determined by RIP (RNA immunoprecipitation) using anti-YTHDF2 antibody. (F) Schematic diagram of YTHDF2-wt (wild type) and YTHDF2-mut (mutant). (G) Relative levels of YTHDF2 and ITIH1 mRNA in 97H cells after co-transfection of YTHDF2-mut and ITIH1-M5. (H) Protein levels of YTHDF2 and ITIH1 in 97H cells after co-transfection of YTHDF2-mut and ITIH1-M5. Data are presented as mean ± SD in bar graphs. ns: no significant difference, :P<0.05, :P<0.01, :P<0.001. Gal, galunisertib.

[0020] Figure 7Correlation between YTHDF2 / METTL3 expression and YTHDF2 / ITIH1 expression. Among them, (A) Correlation between METTL3 and YTHDF2 expression from GEPIA. (B) Correlation between ITIH1 and YTHDF2 expression from GEPIA. (C) Disease-free survival (DFS) and overall survival (OS) of patients with low or high METTL3 expression levels from GEPIA. (D) Disease-free survival (DFS) and overall survival (OS) of patients with low or high YTHDF2 expression levels from GEPIA. DFS usually refers to disease-free survival, which refers to the time from the end of treatment to disease recurrence in patients; OS refers to overall survival, which is the time from diagnosis or start of treatment to death of patients. GEPIA is an online database used to analyze the correlation between gene expression levels and clinical outcomes.

[0021] Figure 8 The results of ITIH1 inhibiting HCC development in vitro and in vivo. Among them, (A) Statistical results of Transwell migration and invasion assays in Hep3B-shITIH1, HLF-oeITIH1 and 97H-oeITIH1 cells. (B) Statistical results of wound healing assays in designated stable cell lines. (C) Results of orthotopic transplantation models and tail vein injection models established in nude mice using 97H-luc-ITIH1 or vector cells. The following charts show the statistical results. Representative images of H&E staining of lung metastasis. (D) Livers were collected for weighing and IHC (immunohistochemistry) staining in the HTVi model. (E) The proportion of PD-1+ cells in CD8+ T cells was detected by flow cytometry. (F) Representative images of HCC organoids treated with PBS or r-ITIH1 for 10 days, and quantification of organoid diameter. (G) Schematic diagram of generating PDX (patient-derived tumor xenograft) models. Patient-derived tumor material was xenografted and passaged in NCG (severely immunodeficient mice). (H) PDX models with or without r-ITIH1 administration in NCG mice. Tumor volume and tumor weight were determined in the liver after 25 days of intervention. (I) Tumor volume and tumor weight were calculated after each administration. (J) H&E and hepatocyte staining were performed in tumors. Data are presented as mean ± SD in bar graphs. ns: not significant difference,: P < 0.05,: P < 0.01,: P < 0.001.

[0022] Fig. 9The role of ITIH1 in vitro and in vivo. (A) ITIH1 protein levels in HCC cell lines were detected by WB. (B) ITIH1 levels were verified in Hep3B-shITIH1, HLF-oeITIH1 and 97H-oeITIH1 cells. (C, D) Wound healing assay results and Transwell assay results in the specified cell lines.

[0023] Fig.10 The effect of ITIH1 on the immune microenvironment of HCC and the purification of ITIH1 recombinant protein. (A) The proportion of various immune cell subsets in the control group and the ITIH1 overexpression group tumors were measured by flow cytometry. (B) The proportion of CD8 T+ cells in the control group and the ITIH1 overexpression group tumors was detected by flow cytometry. (C) Coomassie Brilliant Blue staining of r-ITIH1 (recombinant ITIH1 protein).

[0024] Fig.11 Results of the interaction between ITIH1 and integrin α5β1. (A) Silver staining results after immunoprecipitation (IP). (B) Immunoprecipitation results using HA-ITIH1+Flag-ITGA5 and HA-ITIH1+Flag-ITGB1 in 293T cells. (C) Confocal images of immunofluorescence (IF) staining of ITIH1+ITGB1 and ITIH1+ITGA5 in HLF cells. (D) Schematic diagram of the construction of ITGA5 and ITGB1 truncation mutants. Results of immunoprecipitation using ITIH1 and ITGB1 and ITGA5 truncation mutants. (E) Immunoprecipitation results of ITIH1+ITGB1 and ITGB1+FN1 when FN1 or r-ITIH1 was added in a concentration gradient. (F) Immunoprecipitation results using ITGB1-wt or ITGB1 deletion mutants and FN1 or ITIH1 in 293T cells. Data are presented as mean ± SD in bar graphs. ns: no significant difference,: P < 0.05,: P < 0.01,: P < 0.001.

[0025] Fig.12 Validation of the interaction between ITIH1 and integrin family members. (A) Immunoprecipitation (IP) results using HA-ITIH1 and other specified proteins in 293T cells. (B) Immunoprecipitation results using ITIH1, ITGB1, and ITGA5 in HLF cells. (C) Immunoprecipitation results using ITIH1 and ITGB3 in 293T cells. (D) Immunoprecipitation results of ITIH1+ITGA5 and ITGA5+FN1 when FN1 or r-ITIH1 was added in a concentration gradient.

[0026] Fig.13 The following are relevant experimental results in the embodiments of the present invention, wherein (A) representative IHC (immunohistochemistry) staining results of paraffin-embedded HCC samples from Tongji Hospital. (B) Correlation of pFAK / ITIH1 and pSRC / ITIH1 levels determined by IHC staining. (C) Waterfall plot showing clinical pathological features significantly associated with ITIH1 expression in HCC samples from Tongji Hospital. (D) Multivariate regression analysis, analyzing clinical pathological features significantly associated with the prognosis of HCC samples from Tongji Hospital determined in univariate regression analysis. (E) Overall survival (OS) prognosis of patients according to ITIH1, pFAK and pSRC protein levels. (F) Disease-free survival (DFS) prognosis of patients according to ITIH1, pFAK and pSRC protein levels. (G) Schematic diagram showing the role of ITIH1 in HCC cells. Data are presented as mean ± standard deviation in bar graphs. ns: no significant difference,: P < 0.05,: P < 0.01,: P < 0.001.

[0027] Fig.14 Figure 2 Correlation between ITIH1 and pFAK / pSRC protein levels. (A) WB (Western blot) analysis was performed on HCC patients from Tongji Hospital; the relative expression of ITIH1 was analyzed. (BD) The relative protein levels of ITIH1, pFAK, and pSRC were analyzed in non-tumor tissues and tumor tissues. (EF) Statistical correlation between pFAK / ITIH1 and pSRC / ITIH1 levels.

[0028] Fig.15Illustration of ITIH1 inhibiting the integrin / FAK signaling pathway. Among them, (A) Gene set enrichment analysis showed that genes related to the integrin β1 signaling pathway were significantly enriched in the control HLF cells and HLF cells with ITIH1 overexpression in the PID database. (B) 97H-oeITIH1 and Hep3B-shITIH1 cells were stimulated with FN1 for 2 hours; then, the cells were collected for WB (Western blot) analysis. HLF cells were treated with FN1 and r-ITIH1 alone or in combination in a concentration gradient. After 2 hours of stimulation, the cells were collected for WB analysis. (C) 97H-luc cells were injected orally into the liver of nude mice. Two weeks after the injection, the mice were injected intraperitoneally with galunisertib and injected with r-ITIH1 alone or in combination through the tail vein. Four weeks later, luciferase activity was measured. (D) The livers of nude mice were removed and stained with H&E (hematoxylin-eosin) and IHC (immunohistochemistry). (F, H) The indicated plasmids were injected into C57 mice via the tail vein, and 12 weeks after the injection, the mice were treated as described above. Four weeks later, the mice underwent microCT scanning, and then the livers of C57 mice were weighed, the liver weight / body weight ratio was calculated (G), and the livers were collected for IHC staining (H). Data are presented as mean ± SD in bar graphs. ns: no significant difference,: P < 0.05,: P < 0.01,: P < 0.001. Gal, galunisertib.

[0029] Fig.16 Bioinformatics analysis of ITIH1 overexpressing cells. (A) Heatmap represents RNA-seq data, showing the expression of all differentially expressed genes in ITIH1 overexpressing and control HLF cells. (B) KEGG enrichment analysis of all downregulated genes in the ITIH1 overexpressing group. (C) Gene set enrichment analysis showed that genes related to the integrin signaling pathway were significantly enriched in control HLF cells and ITIH1 overexpressing HLF cells in the Reactome database.

[0030] Fig.17 Figure 3 shows the changes in signaling pathways caused by ITIH1 and the in vivo effects of ITIH1. (A) HLF-oeITIH1 and ALEX-shITIH1 cells were stimulated with FN1 for 2 hours. Then, the cells were collected for WB analysis. (B) HLF cells were transfected with ITIH1 and then treated with TGF-β and Gal alone or in combination. Then, the cells were analyzed by Western blotting. (C) Before being sacrificed, the cells were collected. Fig.15 Blood from C57 mice was collected and analyzed as described in F. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the fact that ordinary technicians in the field can implement it. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0033] The solution proposed by the present invention is specifically described below through specific embodiments:

[0034] 1. Experimental methods

[0035] 1.1、Western Blot

[0036] 1.1.1 Cell protein extraction

[0037] 1). Take out the cells to be collected from the cell culture incubator, wash the cells twice with pre-cooled PBS, remove the PBS as much as possible, add RIPA lysis buffer, and lyse on ice for 30 minutes;

[0038] 2). Scrape the cells from the culture dish with a cell scraper and centrifuge at 12000 rpm at 4°C for 15 min;

[0039] 3). Take the supernatant and proceed to the next experiment, or store it at -80℃.

[0040] 1.1.2 Protein quantification

[0041] Protein quantification was performed using the BCA method, and the kit was purchased from Thermo Fisher (Cat. No. 23225).

[0042] 1). Prepare protein standard protein: dilute the protein standard (2mg / ml) in the kit with distilled water, and prepare the protein standard according to the following concentration gradient: 1000ng / ul, 750ng / ul, 500ng / ul, 250ng / ul, 125ng / ul, 62.5ng / ul, 31.25ng / ul, 0ng / ul, and store in a refrigerator at 4℃;

[0043] 2). Dilute the protein sample to be tested 10 times with double distilled water (protein 12ul, double distilled water 108ul);

[0044] 3). Add 50ul of gradient protein standard and protein sample;

[0045] 4). Take out Solution A and Solution B from the BCA kit, mix them evenly in a ratio of 50:1, add 200ul to each well of a 96-well plate, and incubate at 37°C for 30 minutes;

[0046] 5). Measure the absorbance value of each protein;

[0047] 6). Calculate the concentration of each protein sample using the Excel formula;

[0048] 7). Set the concentration of each protein to 2ug / ul, calculate the required protein volume, aspirate the protein stock solution, add 4x loading buffer and RIPA lysis buffer, mix well, boil in boiling water for 10min, cool on ice, and proceed to the next experiment, or store at -80℃.

[0049] 1.1.3 Gel preparation, electrophoresis and membrane transfer

[0050] Glue Making

[0051] a. The SDS-PAGE gel preparation kit was purchased from Wuhan Boster Company (Cat. No. AR0138). Concentrating gel and separating gel were prepared according to the instructions.

[0052]

[0053] Loading electrophoresis

[0054] 1). Add an appropriate amount of electrophoresis solution into the electrophoresis tank and carefully pull out the comb from the concentrated gel;

[0055] 2). After designing the sample loading order, use a 10ul pipette to add sample protein into the loading wells. The loading volume of each well should be consistent, and the protein marker loading well should be set.

[0056] 3). Turn on the power supply and start electrophoresis at 80V constant voltage. When the protein marker band is separated, adjust the voltage to 100V. Stop electrophoresis when the protein is completely separated or reaches the bottom of the separation gel (indicated by bromophenol blue).

[0057] Transfer

[0058] 1). Cut the PVDF membrane into appropriate size and soak it in formaldehyde for 3-5 minutes to activate it;

[0059] 2). Turn off the power, pour out the electrophoresis solution, wash the gel plate with tap water, take out the gel and put it in the transfer solution for later use;

[0060] 3). Take out the transfer clip, with the black negative electrode facing down, place the sponge and filter paper, gently place the gel on the filter paper, then wash the activated PVDF membrane in the transfer solution, stick it on the gel, and then add the filter paper and sponge. There should be no bubbles between the layers. Close the transfer clip, insert it into the transfer tank, and add an appropriate amount of transfer solution;

[0061] 4). Place an ice pack frozen at -80℃ in the transfer tank, turn on the power, and transfer the membrane at a constant current of 200mA for 2 hours.

[0062] 1.1.4 Antibody incubation and result detection

[0063] 1). Blocking: Take out the PVDF membrane, block it with skim milk, and block it on a shaker for 1 hour at room temperature;

[0064] 2). Incubate with primary antibody: Wash the blocked PVDF membrane once with TBST, add the prepared primary antibody dilution solution and incubate at 4°C overnight;

[0065] 3). Incubate with secondary antibody: Wash the PVDF membrane incubated with primary antibody overnight with TBST for 3 times, 10 min each time, add secondary antibody diluent, and incubate at 37°C for 1 h;

[0066] 4) Result detection: Wash the PVDF membrane incubated with secondary antibody overnight with TBST for 3 times, 10 minutes each time. Prepare an appropriate amount of developer for color development, and use a laboratory exposure instrument to collect images.

[0067] 1.2 Co-immunoprecipitation

[0068] 1). Transfect 293T cells or target cells with plasmid, culture for 24-48 hours, discard the culture medium, wash twice with cold PBS, and discard PBS as much as possible;

[0069] 2). Add 0.5 ml of IP lysis buffer containing protease inhibitors (phosphatase inhibitors if necessary), shake well, and lyse on ice for 30 minutes;

[0070] 3). Scrape off all the cells with a cell scraper, put them into a clean 1.5ml EP tube, and disrupt them by ultrasonication (be careful not to use too high a power), and centrifuge at 12000rpm and 4℃ for 15min;

[0071] 4). Transfer the supernatant to another EP tube to obtain the protein supernatant. Take 30ul of protein solution and add an equal volume of 2x loading buffer as input and store at -80℃.

[0072] 5). Take 30ul of proteinA / G beads and wash them twice with 1ml of IP lysis buffer, centrifuge at 3000rpm and 4℃ for 5min, remove the supernatant, add protein supernatant, and place on a shaking table at 4℃ for 2h for nonspecific adsorption.

[0073] 6). Centrifuge at 3000 rpm, 4°C for 5 min, transfer the protein supernatant into a new 1.5 ml EP tube, add specific primary antibody, and place on a shaker at 4°C for 8 h or overnight;

[0074] 7). Take 30ul of proteinA / G beads and wash them twice with 1ml IP lysis buffer, centrifuge at 3000rpm, 4℃ for 5min, remove the supernatant, add the protein supernatant after primary antibody incubation, and place it on a 4℃ shaker for 2h. 8). Centrifuge at 3000rpm, 4℃ for 5min, gently aspirate the liquid, wash the beads 5 times with IP washing buffer, place it on a 4℃ shaker for 10min each time, and centrifuge at 3000rpm, 4℃ for 5min. Discard the supernatant and collect the beads.

[0075] 1.3 Real-time PCR

[0076] 1.3.1 Total RNA extraction

[0077] 1). Take out the cells to be collected RNA from the cell culture incubator, remove the cell culture medium, wash the cells twice with pre-cooled PBS, remove as much PBS as possible, add 1ml Trizol reagent, place on ice for lysis for 10 minutes, use a pipette to blow until the cells are completely detached from the culture dish, transfer the lysate to a 1.5ml EP tube for later use, or store at -80℃.

[0078] 2). Add 200ul chloroform, shake for 15s, and let stand at room temperature for 5min;

[0079] 3). Centrifuge at 12000 rpm, 4°C for 15 min;

[0080] 4). Carefully pipette the upper layer of liquid into a new clean EP tube, add 500ul of isopropanol, blow evenly, let stand at room temperature for 10 minutes, centrifuge at 12000rpm for 10 minutes, and a white precipitate will appear at the bottom;

[0081] 5). Remove the supernatant as much as possible, add 1 ml of 75% anhydrous ethanol, resuspend the precipitate, and centrifuge at 12000 rpm and 4°C for 5 minutes;

[0082] 6). Remove the supernatant as much as possible, dry it in a clean bench for 10 minutes, and dissolve the RNA with 100ul enzyme-free water;

[0083] 7). Measure the RNA concentration and proceed to the next step of the experiment.

[0084] 1.3.2 RNA reverse transcription The reverse transcription kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The operation steps are as follows

[0085] RNA template

[0086] Denatured 8ul system

[0087] Total RNA 1ug

[0088] Random hexamers 1ul

[0089] Enzyme-free water To 8ul

[0090] Reaction steps: heat at 65°C for 5 min, quickly cool on ice, and let stand on ice for 3 min.

[0091] Preparation of first-strand cDNA

[0092] Synthesis reaction solution 20ul system

[0093] 8ul of the mixture from the previous step

[0094] 2xRT Mix 10ul HiScript II Enzyme Mix 2ul

[0095] Reaction steps: 42℃1h, 80℃5min, 16℃ to end

[0096] Real-time fluorescence quantitative PCR

[0097] The real-time fluorescence quantitative PCR kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The operation steps are as follows:

[0098] 1). Primer design

[0099] METTL3-Forword CATTGCCCACTGATGCTGTG

[0100] METTL3-ReverseAGGCTTTCTACCCCATCTTGA

[0101] ITIH1-Forword GAGGCACTCCTTAAAATTCTGGG

[0102] ITIH1-Reverse GCCCTTCCACGATTGTACTCG

[0103] GAPDH-Forword GACAAGCTTCCCGTTCTCAG

[0104] GAPDH-Reverse GAGTCAACGGATTTGGTCGT

[0105] 2).qPCR reaction

[0106]

[0107] According to the above reaction system ratio, three replicate wells were set up. The PCR reaction steps are as follows:

[0108] Pre-denaturation: 95℃15min,

[0109] Cyclic reaction: 95℃15s, 60℃10s, 72℃20s, 40 cycles,

[0110] Melting curve: 65-95℃, 0.5℃ for 5s.

[0111] 3) Result analysis

[0112] The results were analyzed using a PCR instrument from Bio-Rad.

[0113] 1.4 Immunohistochemical staining

[0114] 1.4.1. Histochemical staining

[0115] 1). Incubate tissue slices at 60℃ for 20min;

[0116] 2). Quickly immerse the tissue sections in xylene solution for 3 minutes, then soak in new xylene for 3 minutes, then soak in anhydrous ethanol for 3 minutes twice, 99% ethanol for 3 minutes, 75% ethanol for 3 minutes, and 50% ethanol for 3 minutes;

[0117] 3). Take out the tissue sections and put them into a small glass jar. Wash them 3 times with TBS on a shaker, 3 minutes each time, to prepare for antigen retrieval.

[0118] 4). Place the tissue sections in a boiling box, add EDTA antigen repair solution (the pH of the repair solution should be selected according to the antibody instructions), place the boiling box in a microwave oven, and boil for 20 minutes;

[0119] 5). Take out the boiling box, wait until it cools to room temperature, take out the tissue slices into a small glass jar, wash them 3 times with TBS, 3 minutes each time, to prepare to block endogenous peroxidase;

[0120] 6). Immerse the tissue slices in a 3% hydrogen peroxide solution diluted with methanol, protect from light for 10 minutes, wash twice with TBS, take out the histochemical pen to build a bank (use the histochemical pen to circle the sample on the tissue chip);

[0121] 7). Gently drop the secondary antibody source serum or 5% BSA on the tissue sample and block at 37℃ for 1h;

[0122] 8) Incubate the primary antibody: After preparing the primary antibody according to the antibody instructions, shake off the blocking solution on the tissue section, gently add the primary antibody diluent, put it in a wet box, and incubate it at 4°C overnight;

[0123] 9). Take out the tissue slices, put them into a small glass jar, wash them 3 times with TBS, 3 minutes each time, take them out and add universal mouse and rabbit secondary antibodies, and incubate them at room temperature for 1 hour;

[0124] 10). Take out the tissue slices, put them into a small glass jar, wash them 3 times with TBS, 3 minutes each time, and prepare for color development;

[0125] 11). DAB color development: Mix color development liquid A and liquid B in proportion (prepare immediately before use), add color development liquid, color development for 1-5 minutes, observe the color development, and terminate in time;

[0126] 12). Use hematoxylin nuclear staining for 3 minutes, place in tap water for 10 minutes, put in 1% hydrochloric acid alcohol for 5-10 seconds, take out and wash with tap water, then put in dilute ammonia water for 5-10 seconds, and wash with tap water;

[0127] 13). Soak in 50% ethanol for 3 min, 75% ethanol for 3 min, 95% ethanol for 3 min, anhydrous ethanol for 3 min twice, and xylene for 3 min twice in sequence;

[0128] 14). Slice, seal and take photos under a microscope.

[0129] 1.4.2 Tissue chip immunohistochemistry scoring

[0130] The histochemical section score was the product of the staining intensity score and the percentage of staining-positive cells.

[0131] Staining intensity scoring: negative 0 points, weak 1 point, moderate 2 points, strong 3 points;

[0132] The percentage of positively stained cells was scored as follows: less than 5% was 0 points, 5%-25% was 1 point, 26%-50% was 2 points, 51%-75% was 3 points, and greater than 75% was 4 points.

[0133] The scoring of tissue sections was completed by two people independently, and the grouping of high expression group and low expression group (generally, a total score ≥6 was judged as high expression, and a total score <6 was judged as low expression) was performed based on the statistical results of the two people.

[0134] 1.5. Transfect cells and screen stable cell lines

[0135] 1). Target cell inoculation

[0136] Resuscitate the cells to be transfected, wait until the cells are in good growth condition and have a suitable density, digest and count, and transfer them into a 6-well plate, so that the density is about 50% on the next day;

[0137] 2). Aspirate the original culture medium of the 6-well plate, add an appropriate amount of lentivirus supernatant, mix well and continue to culture for 24 hours;

[0138] 3). After 24 hours of infection, remove the infected fluid (the virus fluid should be properly handled), replace with new cell culture fluid, and culture for 24 hours;

[0139] 4). Aspirate the original culture medium, replace with new cell culture medium, add puromycin (5ug / ml) for screening, observe the cell growth every day, and replace the cell culture medium with puromycin. After continuous screening for 1-2 weeks, a cell line that stably overexpresses METTL3 is obtained.

[0140] 1.5. Fluorescence recovery after photobleaching experiment: A FRAP experiment was performed using a TCS SP8 confocal microscope (Leica) to observe the fluorescence changes of live cells after different treatments (shSMAD3, TGF-β stimulation) of liver cancer cells transfected with EYFP-METTL3 plasmid.

[0141] 1.6. Reporter gene experiments

[0142] 1). The promoter region of ITIH1 (1 kb) was loaded into pGL4.17 (purchased from Promega) stored in our laboratory, and sequencing was used to verify the successful construction of the plasmid.

[0143] 2). It was co-transfected with pRL-TK (purchased from Promega) into the liver cancer cell line (HLF, 97H), and the SBE-luc transfer group was established as a signal pathway activation control.

[0144] 3).Dual-Glo TM The luciferase assay kit detects the fluorescence readings of each well. The activity of the target gene or regulatory sequence is evaluated by quantitative analysis of the fluorescence value.

[0145] 1.7 RNA pull-down assay

[0146] 1). Vector construction: construct a plasmid expressing the MS2 RNA hairpin structure (such as pMS2), and a plasmid expressing the MS2 protein fused with ITIH1 and 3"-UTR sequence.

[0147] 2). Cell transfection: Transfect the above plasmid into HEK-293T cells.

[0148] 3). RNP complex formation: MS2-ITIH1 and 3”-UTR sequence RNP complexes are formed in cells.

[0149] 4). Affinity purification: Use GSH agarose beads to perform affinity purification to capture MS2-ITIH1 and 3”-UTR sequence fusion proteins and their bound RNA.

[0150] 5). Protein detection: Detect proteins bound to the MS2 complex by Western blot analysis

[0151] 1.8 Transwell experiment

[0152] 1). For invasion assay, add 40ul of Matrigel;

[0153] 2). Take cells of appropriate density and logarithmic growth phase, digest them with trypsin, resuspend them in serum-free medium, count the cells, and adjust the cell concentration to 2x105 cells / ml;

[0154] 3). Slowly add 100ul of cell suspension (containing 20,000 cells) to the upper layer of the Tranwell chamber without matrix gel, and slowly add 200ul of cell suspension to the upper layer of the Tranwell chamber with matrix gel;

[0155] 4). Add fresh cell culture medium containing 10% fetal bovine serum to the lower layer of the Tranwell chamber, avoid the formation of bubbles, and place it in a cell culture incubator for 24 hours;

[0156] 5). Aspirate the culture medium from the upper and lower layers of the chamber, and carefully wipe off the cells attached to the wall of the upper chamber with a cotton swab, wiping 2-3 times;

[0157] 6). Add 600ul of 4% paraformaldehyde solution to the lower layer of the Tranwell chamber and fix at room temperature for 20 minutes;

[0158] 7). Aspirate the paraformaldehyde, add 600ul of 0.4% crystal violet staining solution to the lower layer of the Tranwell chamber, stain at room temperature for 10-15 minutes, wash off the excess crystal violet with tap water, wipe dry with a cotton swab, and randomly select at least 2 fields of view to take pictures under a microscope.

[0159] 1.9 Scratch test

[0160] 1). Take cells of appropriate density and logarithmic growth phase, digest them with trypsin, and count them;

[0161] 2). Take 1 million cells, spread them in a 6-well plate, add culture medium and shake well to make the cells grow evenly;

[0162] 3). On the second day, the cell density is about 90%. Use a 10ul pipette tip to draw a "cross" line on the 6-well plate. The "cross" line should be straight and uniform in width.

[0163] 4). Change the serum-free culture medium and wash with PBS once, select the image position mark, then take a picture with a microscope, and record and save the picture of 0h;

[0164] 5). After 24 hours, replace with new serum-free medium, take a photo of the original marked position under a microscope, and record and save the photo for 24 hours;

[0165] 6). Calculate the cell migration distance and count the differences in migration distance.

[0166] 1.10 Plasmid extraction

[0167] The basic steps are as follows:

[0168] 1). Collect the bacterial solution by centrifuge at 12000rpm for 1min, discard the culture medium after centrifugation, and obtain the bacteria (if the bacterial solution needs to be preserved, take 500ul of bacterial solution before centrifugation, add 500ul of 40% glycerol, mix well, and put in a -80℃ refrigerator);

[0169] 2). Add 500ul K1 solution and suspend the bacterial precipitate with a pipette;

[0170] 3). Transfer the bacterial solution to a new clean 2ml EP tube, add 500ul K2 solution, gently invert 6-10 times, and let stand at room temperature for 3min;

[0171] 4). Add 700ul K4 solution, gently invert 6-8 times, and centrifuge at 12000rpm for 5min;

[0172] 5). Take the supernatant, add appropriate amount of isopropanol, and pass the liquid through the column;

[0173] 6). Add 500ul of endotoxin removal buffer, place at room temperature for 2min, and centrifuge at 12000rpm for 30s at room temperature;

[0174] 7). Add 600ulW2, centrifuge at 12000rpm for 30s, repeat once;

[0175] 8). Centrifuge at 12000rpm for 2min to remove the liquid on the adsorption membrane;

[0176] 9). Take a new 1.5ml EP tube, put it into the adsorption column, add 100ul TE, let it stand for 5min, and centrifuge at 12000rpm for 2min;

[0177] 10). Measure the plasmid concentration and set aside.

[0178] 1.11 Subcutaneous tumor formation experiment

[0179] 1). Four-week-old male Balb / c-nu nude mice were purchased from Beijing Huafukang Biological Company and then housed in the SPF animal room of the Animal Center of Tongji Hospital Affiliated to Tongji Medical College of Huazhong University of Science and Technology. All animal handling complied with the relevant regulations of the Ethics Committee;

[0180] 2). Take cells with appropriate density and good growth status, count the cells after digestion, and adjust the cell concentration to 1107 cells / ml;

[0181] 3) After the nude mice were randomly divided into groups according to the needs, 100ul of cell suspension was subcutaneously injected into the armpit or dorsal side of the lower limb of the nude mice using an insulin needle;

[0182] 4). Observe the nude mice 2-3 times a week, and measure the weight of the mice once a week after the subcutaneous tumors are formed;

[0183] 5). Observe the living conditions of the nude mice every 3 days. After the subcutaneous tumor is formed, measure the size of the subcutaneous tumor with a vernier caliper twice a week;

[0184] 6). When the subcutaneous tumor is of appropriate size, the mouse is killed, the subcutaneous tumor is removed, relevant data is recorded, and image data is kept. Part of the tumor tissue is cut and placed in an enzyme-free EP tube, and quickly placed in a -80℃ refrigerator (for extracting tissue RNA and protein), and the remaining tissue is immersed in 4% paraformaldehyde for later use.

[0185] 1.12. Orthotopic tumor implantation experiment

[0186] 1). Purchase 4-week-old male Balb / c-nu nude mice as described above;

[0187] 2). Take cells with appropriate density and good growth status, count the cells after digestion, and adjust the cell concentration to 1107 cells / ml;

[0188] 3) After the nude mice were randomly divided into groups according to the needs, 100ul of cell suspension was subcutaneously injected into the armpit or dorsal side of the lower limb of the nude mice with an insulin needle. After the subcutaneous tumor formed about the size of a soybean, the mice were anesthetized and killed, and the subcutaneous tumor was removed;

[0189] 4). Cut the tumor into 1mm3 small pieces under sterile environment, anesthetize the new nude mice, open the abdomen to expose the liver, implant the small piece of tumor tissue into the mouse liver (with the help of trocar), stop bleeding thoroughly, and suture the skin;

[0190] 6). After 6 weeks, the mice were anesthetized and killed, the liver and lungs were removed, and the intrahepatic metastasis and lung metastasis (gross observation and HE sections) were recorded.

[0191] 1.13 Hydrodynamic Experiment

[0192] 1). Purchase 4-week-old male C56BL / 6J mice;

[0193] 2). Select the combination of pT3-EF1α-myr-AKT-HA and pT3-EF1α-△N90-β-catenin plasmids and pT3-EF1α-ITIH1 to establish a hydrodynamic liver cancer model. The pT3 total plasmid and the Sleeping Beauty transposon plasmid (pCMV-SB) were mixed at a ratio of 25:1.

[0194] 3). C56BL / 6J mice were randomly divided into groups according to the needs, and each C57 mouse was injected with about 2 ml of a total of 20 μg of pT3 mixed plasmids through the tail vein.

[0195] 4). About 6 weeks after modeling, liver samples of mice were collected for analysis.

[0196] 1.14. Graphical and statistical analysis methods

[0197] GraphPad Prism 6 software was used with Student's t-test or one-way ANOVA. A two-sided P value less than 0.05 was considered statistically significant.

[0198] 1.15. ITIH1 protein purification

[0199] 1). Construct the full-length ITIH1 gene into the pinfuse purification expression vector

[0200] 2). Transfect the pinfuse-ITIH1 plasmid into 293T cells, and change to serum-free medium 12 hours after transfection. Collect the culture supernatant 24 hours after the medium change, and use the collected supernatant to purify the protein.

[0201] 3). Use 5-10 times the volume of purified water (5-10mL) to pass through the purification column (Wuhan Huiyan Biotechnology) to clean the medium and wash the 20% ethanol in the purification column.

[0202] 4). Use 5-10 times the volume of equilibrium solution (5-10mL) to pass through the column to ensure that the composition and pH value of the liquid in the purification column are consistent with the sample.

[0203] 5). The sample was centrifuged and filtered (0.45 μm) and then passed through a purification column.

[0204] 6) Use 5-10 times the volume (5-10 mL) of eluent for elution, collect the eluent, and after the elution is completed, use neutralizing solution (add 100 microliters of neutralizing solution to 1 mL of eluent) to adjust the pH of the eluent to neutral.

[0205] 7). After neutralization, the eluate was added to an ultrafiltration column (Millipore, 50 kd) for centrifugation (3500 g / min), washed 5 times with PBS, and finally the residual protein in the ultrafiltration column was blown off with PBS to measure the protein purity.

[0206] Solution preparation:

[0207] Balance solution: 0.02M PBS PH:7.0-7.4 Store at 4°

[0208] 0.2mol / LNa2HPO4.12H2OH(358.14g / mol)

[0209] 0.2mol / LNa2HPO4.2H2O(156.01g / mol)

[0210] 0.2mol / L PB (PH=7.4-7.5)=81mL

[0211] 0.2mol / LNa2HPO4.12H2O+19mL 0.2mol / LNa2HPO4.2H2O

[0212] 2. Results and Analysis

[0213] 2.1. ITIH1 is downregulated by TGF-β stimulation

[0214] Studies have reported that the interaction between SMAD2 / 3 and the m6A "writer" complex promotes the deposition of m6A on a portion of transcripts. The present invention subsequently confirmed the association between SMAD3 and METTL3 (one of the important components of the m6A "writer" complex) in HCC progression ( Figure 1 A, B). TGF-β-induced activation of the SMAD complex further enhances the association between SMAD3 and METTL3 ( Figure 1 C); in contrast, treatment with galunisertib (LY2157299, a selective inhibitor of TGFβR1) resulted in decreased binding ( Figure 1 D). This result was confirmed by endogenous IP experiment ( Figure 1 E). METTL3 and other members of the m6A methyltransferase complex undergo liquid-liquid phase separation, and METTL3 aggregates are closely related to the function of METTL3. The present invention observed that knockdown of SMAD3 weakened the formation of METTL3 aggregates, but TGF-β stimulation promoted this process ( Figure 1F), indicating that SMAD3 may promote the formation of METTL3 aggregates, thereby enhancing the functional regulation of the "writer" complex. In turn, the key proteins that mediate m6A modification (METTL3 and ALKBH5) do not change the activation of the TGF-β signaling pathway ( Figure 2 A). To further explore how SMAD3 and METTL3 regulate HCC progression, the present invention used RNA sequencing (RNA-seq) data of SMAD3 or METTL3 knockdown in 97H cells ( Figure 1 G). These 12 genes co-regulated by SMAD3 and METTL3 were then validated by qRT-PCR in 97H cells ( Figure 2 B, C). ITIH1 is the primary target because it is regulated by both SMAD3 and METLL3. In HLF and 97H cells, the present invention found that ITIH1 mRNA levels decreased over time under TGF-β stimulation ( Figure 1 H). Since SMAD proteins regulate the expression of downstream targets as transcriptional complexes, the present invention also used reporter gene analysis to test whether ITIH1 is transcriptionally regulated by SMAD3. The results showed that TGF-β stimulation did not affect the transcription of ITIH1, indicating that the reduction in ITIH1 expression after SMAD3 knockdown was not related to its transcriptional activity ( Figure 1 I). Therefore, TGF-β may regulate ITIH1 at the post-transcriptional level. In order to explore the role of SMAD proteins, the present invention tested the effect of overexpression of SMAD2 / 3 / 4, and the results showed that SMAD3 is indispensable for the downregulation of ITIH1 caused by TGF-β ( Figure 1 J, K). According to the prediction results of GEPIA (http: / / gepia.cancer-pku.cn / ), the expression of ITIH1 in HCC samples was negatively correlated with the expression of SMAD3 and METTL3 ( Figure 2 D). IHC staining of the three proteins on paraffin-embedded HCC tissues obtained from Tongji Hospital further confirmed the negative correlation between ITIH1 and SMAD3 / METTL3 ( Figure 1 L and Figure 2 E, F).

[0215] These results indicate that TGF-β-SMAD3 may promote the formation of METTL3 aggregates and regulate ITIH1 mRNA levels.

[0216] 2.2. METTL3 regulates ITIH1 expression in an m6A-dependent manner

[0217] To find out how METTL3 regulates ITIH1 expression, the present invention tested the relative mRNA level of ITIH1 when METTL3 was knocked down or overexpressed in 97H cells. The results showed that ITIH1 expression was negatively regulated by METTL3 ( Figure 3 A). Since METTL3 is an important "writer" in the m6A modification process, the present invention used the inactive METTL3-mut to test whether METTL3-mediated ITIH1 regulation depends on m6A. When METTL3-mut was expressed, ITIH1 mRNA levels were not affected ( Figure 3 B). Subsequently, the present invention constructed a psiCHECK2 plasmid containing the ITIH1 sequence. Dual luciferase reporter gene analysis showed that METTL3 may bind to ITIH1 mRNA. This process was enhanced under TGF-β stimulation and weakened under galunisertib inhibition ( Figure 3 C). These data suggest that METTL3 may regulate ITIH1 in an m6A-dependent manner. Furthermore, METTL3 downregulated ITIH1 expression in a dose-dependent manner, and TGF-β enhanced this process. However, when inactive METTL3-mut was expressed, TGF-β stimulation no longer affected ITIH1 expression ( Figure 3 D). Based on SRAMP (http: / / www.cuilab.cn / sramp) analysis, four predicted m6A sites were identified in ITIH1 mRNA (very high confidence). To confirm whether these four sites are responsible for METTL3 regulation, the present invention introduced point mutations at possible m6A sites: ITIH1-M1, ITIH1-M2, ITIH1-M3 and ITIH1-M4. No changes in the levels of ITIH1 mutants were found when co-transfected with increasing doses of METTL3 ( Figure 5 A). Next, the present invention uses the truncation mutant of ITIH1 to confirm that the m6A modification site is located between 2500 bp and 2904 bp ( Figure 3 E and Figure 5 B). However, another m6A site was also found (with high confidence) at 2650 bp (ITIH1-M5) using the same strategy ( Figure 3 F, G, and Figure 4 B). RNA pulldown experiments further support that METTL3 and SMAD3 no longer bind to ITIH1-M5 mRNA ( Figure 3 H). Me-RIP experiments showed that the m6A modification mediated by METTL3 in ITIH1-M5 was much lower than that in ITIH1-wt ( Figure 3I). Together, these data reveal that METTL3 catalyzes mA modification on ITIH1 mRNA, which may be involved in its expression regulation.

[0218] 2.3. YTHDF2 promotes ITIH1 mRNA degradation in an m6A-dependent manner

[0219] Previous studies have shown that m6A modification has been shown to regulate the fate of mRNA. The present invention wanted to know how m6A modification affects ITIH1 mRNA. After blocking mRNA transcription using actinomycin D, the degradation rate of ITIH1 mRNA was reduced when METTL3 was knocked down, while the degradation rate was increased when METTL3 was overexpressed. However, TGF-β stimulation enhanced the degradation of ITIH1, while galunisertib treatment offset this effect ( Figure 6 A, B), indicating that METTL3 regulates the degradation of ITIH1 mRNA. YTHDF2 has been reported to recruit the mRNA degradation system to reduce mRNA stability. When YTHDF2 was knocked down, ITIH1 mRNA levels increased. Another m6A "reader" YTHDF1 had little effect on ITIH1 mRNA ( Figure 6 C). RNA pulldown experiments showed that YTHDF2 bound to ITIH1-wt but not to ITIH1-M5 mRNA ( Figure 6 D). To further confirm the association of YTHDF2 with ITIH1 mRNA, we performed RIP experiments and found that METTL3 knockdown reduced the enrichment of YTHDF2. TGF-β promoted the binding of YTHDF2, while galunisertib treatment abolished this effect ( Figure 6 E). Next, the present invention used YTHDF2-mut (W432A and W486A), which no longer recognizes the m6A modification ( Figure 6 F). Western blot and qPCR analysis showed that YTHDF2-wt but not YTHDF2-mut negatively regulated the expression of ITIH1-wt, while YTHDF2-wt had little effect on the expression of ITIH1-M5 ( Figure 6 GEPIA analysis showed that the expression of YTHDF2 was negatively correlated with the expression of ITIH1 and positively correlated with the expression of METTL3 ( Figure 7 A, B). In addition, the DFS (disease-free survival) and OS (overall survival) of METTL3 and YTHDF2 showed similar trends ( Figure 7 C, D).

[0220] These results suggest that YTHDF2 recognizes METTL3-mediated mA modification of ITIH1 mRNA and regulates its stability.

[0221] 2.4 ITIH1 inhibits HCC development in vitro and in vivo

[0222] To explore the role of ITIH1 in HCC, the present invention examined its expression in different cell lines ( Fig. 9 A). In Hep3B cells expressing high levels of ITIH1, shRNA-mediated knockdown of ITIH1 resulted in increased cell migration and invasion. In contrast, overexpression of ITIH1 in HLF and 97H cells inhibited cell motility ( Figure 8 A and Fig. 9 B, C). Similar effects were also observed in wound healing experiments ( Figure 8 B and Fig. 9 D). To evaluate the tumor suppressive effect of ITIH1 in HCC in vivo, the present invention applied different xenograft models. First, the present invention used an orthotopic model to examine the intrahepatic metastasis of HCC cells 5 weeks after inoculation. Injection of cells overexpressing ITIH1 significantly reduced the ability of HCC cells to form secondary lesions in the liver ( Figure 8 C, Fig. 9 E). In a lung metastasis model, mice were injected with control or ITIH1-overexpressing cells via the tail vein. Six weeks after injection, mice injected with ITIH1-overexpressing cells showed fewer lesions ( Figure 8 C, Fig. 9 E). To evaluate the effect of ITIH1 on HCC development, the present invention used hydrodynamic tail vein injection (HTVi) with AKT / β-catenin plasmid. Mice developed HCC 16 weeks after injection. IHC staining showed that AFP expression was attenuated in the ITIH1 overexpression group, and the liver / body weight ratio of this group was lower than that of the vehicle group ( Figure 8 D). In addition, in this model, the immune cells infiltrating the tumors of mice were analyzed. There were no differences in the populations of macrophages, myeloid-derived suppressor cells (MDSCs), B cells, NK cells, and T cells in the tumor microenvironment between the two groups ( Fig.10 A). Considering the key role of T cells in tumor killing, the present invention further performed flow cytometry analysis on T cell subsets and found that after overexpression of ITIH1, CD8+ T cells in the T cell population were more abundant in tumors ( Fig.10 B). In addition, the proportion of PD-1+CD8+T cells decreased after ITIH1 overexpression, indicating that CD8+T cell exhaustion was reduced ( Figure 8 E). These results indicate that ITIH1 inhibits the development of HCC. Since ITIH1 is a secreted protein located in the extracellular matrix, the present invention then used purified ITIH1 (recombinant ITIH1, r-ITIH1) to evaluate the in vivo tumor suppressor effect ( Fig.10C). In order to study whether r-ITIH1 protein has a therapeutic effect on HCC, the present invention established an organoid model from HCC patients. It was found that r-ITIH1 can significantly inhibit the growth of HCC organoids ( Figure 8 F). In another HCC patient-derived xenograft (PDX) model ( Figure 8 G), r-ITIH1 was injected near the tumor. Notably, r-ITIH1 significantly inhibited the growth of PDX tumors ( Figure 8 HJ).

[0223] Taken together, these data suggest that ITIH1 acts as a tumor suppressor during HCC progression.

[0224] 2.5. Interaction between ITIH1 and integrin α5β1

[0225] Next, the present invention explored the potential mechanism of ITIH1-induced HCC metastasis and development inhibition. Using immunoprecipitation (IP) and mass spectrometry (MS), potential ITIH1 interacting partners ( Fig.11 A). Validation and analysis of integrin family proteins ( Fig.12 A). As a functional complex, integrin is composed of α and β subunits. ITGB1 and ITGA5 are paired subunits that transmit extracellular signals into cells. Co-IP results showed that the binding affinity of ITIH1 to ITGB1 and ITGA5 was higher than that of other integrin family proteins ( Fig.11 B and Fig.12 B). Immunostaining showed that ITIH1 was associated with ITGB1 and ITGA5 on the cell membrane ( Fig.11 C). Further analysis showed that ITIH1 interacts with the extracellular regions of ITGB1 and ITGA5 ( Fig.11 D). It has been reported that FN (fibronectin) is an important ligand of the ITGB1 / ITGA5 complex, and its binding leads to the activation of the integrin / FAK signaling pathway. Subsequently, the present invention confirmed that ITIH1 competitively binds to ITGB1 in a dose-dependent manner, while ITIH1 has no effect on the ITGA5 / FN complex ( Fig.12 C). To further verify this observation, the present invention generated an ITGB1 mutant (ITGB1 M) in which amino acids 130-240 were deleted, resulting in impaired binding to FN but still localization to the cell surface. The ITGB1 mutant did not interact with FN or ITIH1, indicating that FN and ITIH1 interact with ITGB1 through the same protein region ( Fig.11 F).

[0226] Combined with the above evidence, ITIH1 serves as a new ligand for ITGB1 / ITGA5, competing with FN for its binding to ITGB1.

[0227] 2.6. ITIH1 expression is negatively correlated with FAK activation in HCC patients

[0228] IHC analysis showed that the expression of ITIH1 was negatively correlated with the activation status of FAK and SRC in HCC samples ( Fig.13 A, B). To further confirm this correlation, the present invention tested the levels of related proteins in tumor tissues and adjacent non-tumor tissues by WB analysis ( Fig.14 A). The present invention found that the level of ITIH1 protein in tumor tissues was reduced, while the levels of pFAK (Tyr397) and pSRC (Tyr416) ​​were increased in tumor tissues ( Fig.14 BD). In general, the results of WB analysis showed that ITIH1 protein level was negatively correlated with pFAK and pSRC levels in HCC tissues ( Fig.14 E, F). When these findings were combined with specific data from HCC patients, low ITIH1 expression was found to be associated with advanced BCLC stage (P = 0.00125), advanced TNM stage (P = 0.00172), high AFP expression (P = 0.00774), large tumor size (P = 0,0132), and increased vascular invasion (P = 0.0194, Fig.13 C). Univariate regression analysis of clinical pathological characteristics including ITIH1 expression showed that BCLC stage, TNM stage, vascular invasion, portal vein tumor thrombosis (PVTT) and ITIH1 expression were associated with overall survival (OS). After multivariate regression analysis of the above factors, the present invention found that ITIH1 expression was an independent factor associated with overall survival ( Fig.13 D). Consistent with this finding, high ITIH1 protein levels, low pFAK (Tyr397) levels, and low pSRC (Tyr416) ​​levels were associated with better DFS (disease-free survival) and OS ( Fig.13 E, F). Finally, the present invention found that ITIH1, whose expression is co-regulated by TGF-β stimulation and m6A modification, inhibits HCC metastasis by inhibiting the integrin / FAK signaling pathway, and preliminarily verified the effectiveness of recombinant ITIH1 in inhibiting HCC metastasis ( Fig.13 G).

[0229] 2.7 Effect of ITIH1 combined with galunisertib on HCC progression

[0230] Next, the present invention tested whether ITIH1 affects downstream signaling of the integrin pathway. RNA sequencing was performed in HLF cells overexpressing ITIH1 and in control cells ( Fig.16A). Gene set enrichment analysis (KEGG) showed that genes regulated by ITIH1 overexpression were most highly enriched in the focal adhesion pathway ( Fig.16 B). Gene set enrichment analysis (GSEA) results showed that genes induced by integrin / FAK signaling were significantly enriched in ITIH1 overexpressing cells compared with control cells ( Fig.15 A and Fig.16 C). Collectively, these results suggest that ITIH1 expression is negatively correlated with integrin / FAK activation and may inhibit this pathway. To experimentally test this hypothesis, HCC cells were treated with ITIH1 depletion or overexpression in the presence or absence of FN stimulation ( Fig.15 B and Fig.17 A). The results showed that ITIH1 overexpression reduced, while ITIH1 depletion increased, the FN-dependent activation of the FAK signaling pathway, as indicated by phosphorylation of FAK at Tyr397 and SRC at Tyr416; moreover, this effect was enhanced by TGF-β stimulation, while galunisertib treatment abolished the effect of TGF-β ( Fig.17 B). Similarly, r-ITIH1 treatment significantly reduced the activation of the FAK signaling pathway associated with FN stimulation in a dose-dependent manner ( Fig.15 B). This result also confirmed the biological activity of r-ITIH1. Since r-ITIH1 intervention is effective in HCC PDX model, and galunisertib has been used in clinical HCC treatment, the present invention assumes that r-ITIH1 may synergize with galunisertib to inhibit the development of HCC in vivo. First, the present invention injected 97H cells expressing luciferase in situ into immunodeficient mice ( Fig.15 C). Two weeks after injection, the mice were randomly divided into four groups to receive different treatments. Four weeks after treatment, the nude mice were sacrificed, and H&E staining and imaging showed that the tumor volume in the galunisertib+r-ITIH1 group was significantly smaller than that in the other groups. In addition, IHC staining was used to verify the inhibitory effect of each treatment on integrin / FAK signaling ( Fig.15 DE). To further verify the effect of r-ITIH1, the present invention established an HCC model driven by activated AKT and β-catenin in immune intact mice by hydrodynamic tail vein injection ( Fig.15 F). Twelve weeks after the injection, the mice were randomly divided into four groups and received three different treatments per week. In the final week (week 16), they underwent micro-CT scanning ( Fig.15 H). Before sacrifice, blood biochemical analysis was performed and the results showed that these treatments appeared to be well tolerated in the mice and did not cause significant hepatotoxicity ( Fig.17C). Both galunisertib and r-ITIH1 can reduce liver weight ratio ( Fig.15 G). Consistent with the results in nude mice, integrin / FAK signaling was significantly inhibited in each treatment group ( Fig.15 H). In addition, CD8+ T cells were more abundant overall and the proportion of PD-1+CD8+ T cells was lower after combination treatment, indicating that CD8+ T cell exhaustion was reduced after drug combination treatment ( Fig.15 H). These results suggest that r-ITIH1 may synergize with galunisertib to inhibit the development of HCC.

[0231] During cancer development, the TGF-β signaling pathway plays a crucial role at different stages of cancer; m6A mRNA modification also affects tumor progression through various mechanisms including liquid-liquid phase separation. SMAD2 / 3 promotes the binding of the m6A methyltransferase complex to a portion of transcripts involved in early cell fate determination. However, little is known about the relationship between TGF-β and m6A modification in HCC development. First, the present invention confirms their interaction in HCC cells. TGF-β stimulation may promote the liquid-liquid phase separation of METTL3, and SMAD3 is indispensable in this process. Next, the present invention verifies the role of an ECM protein ITIH1, which is regulated by TGF-β stimulation but is not related to the transcriptional function of TGF-β. In this study, ITIH1 was found to be a direct downstream target of TGF-β signaling and m6A modification. Consistent with this finding, TGF-β stimulation did not lead to downregulation of ITIH1 when METTL3-mut but not METTL3-wt was expressed. Next, when the m6A-modified ITIH1 mRNA is transferred to the cytoplasm, it is recognized by the reader YTHDF2 and then degraded. This process may explain why the present invention detected lower ITIH1 expression in HCC tumor tissues. The specific mechanism by which TGF-β promotes LLPS of METTL3 through SMAD3 remains to be further explored.

[0232] During cancer progression, ECM proteins always play a promoting role. However, ECM components with inhibitory effects remain to be explored. In the present study, it was found that when ITIH1 is secreted from cells, it can compete with FN for binding to the ITGB1 / ITGA5 complex and then inhibit the activation of integrin / FAK signaling. Consistent with the findings of the present invention that high ITIH1 expression is associated with good clinical outcomes in HCC patients, ITIH1 overexpression and recombinant ITIH1 treatment inhibited tumor metastasis and development in mice without causing significant toxicity, indicating that ITIH1 has potential therapeutic effects.

[0233] Integrins are key surface receptors that connect intracellular structures and ECM components and transmit important signals. In tumor cells, these paired integrins interact with FN and other ECM proteins to promote cancer progression. In the study, the present invention confirmed the binding between ITIH1 and the extracellular regions of ITGB1 and ITGA5. Integrins are functional complexes composed of α and β subunits. Contrary to the hypothesized association, as a ligand for the ITGB1 / ITGA5 complex, ITIH1 competes with FN for binding to ITGB1 but not ITGA5. The underlying mechanisms of these three molecules need to be further explored.

[0234] According to NCBI RNA-seq data, ITIH1 is a protein expressed only in the liver. In addition to its therapeutic potential, it may also be a diagnostic biomarker for HCC.

[0235] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0236] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

[0237] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. Application of ITIH1 in combination with galunisertib in the preparation of drugs for the treatment of hepatocellular carcinoma.

2. The use according to claim 1, characterized in that: The drug includes a mixture of ITIH1 and galunisertib, or a mixture of an agent that increases the expression level of ITIH1 and galunisertib.

3. The use according to claim 2, characterized in that: The reagents include small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or combinations thereof.

4. The use according to claim 1, characterized in that: ITIH1 affects the metastasis of hepatocellular carcinoma by competitively binding to the ITGB1 / ITGA5 complex and inhibiting the integrin / FAK signaling pathway.

5. The use according to claim 1, characterized in that: The expression level of ITIH1 is jointly regulated by TGF-β stimulation and m6A modification.

6. A drug, characterized in that It includes a mixture of a substance targeting ITIH1 protein and galunisertib, or a mixture of a substance targeting ITIH1 gene and galunisertib; the drug is indicated for hepatocellular carcinoma.

7. A drug, characterized in that It includes a mixture of ITIH1 protein and galunisertib, or a mixture of ITIH1 gene and galunisertib, or a mixture of ITIH1 gene-related biological materials and galunisertib; the drug is indicated for hepatocellular carcinoma.

Images