Tobacco NtTIRa1 gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a tobacco NtTIRa1 gene and application thereof. The invention proves that the NtTIRa1 gene has the function of regulating and controlling the quinclorac resistance for the first time, and the test result shows that the quinclorac resistance of a mutant strain without the function of the NtTIRa1 gene is increased, so that the loss of tobacco production caused by phytotoxicity is eliminated or reduced, a new idea is provided for improving the quinclorac resistance of tobacco, and the application of the NtTIRa1 gene to the field of tobacco production is promoted. And a new means is provided for obtaining excellent tobacco varieties.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to tobacco NtTIRa1 gene and application thereof. Background Art

[0002] Tobacco is an important cash crop. Tobacco leaves are the main organ for harvesting, and leaf yield determines its economic benefits. Therefore, reducing or eliminating yield losses caused by various biotic and abiotic stresses is an effective way to increase tobacco farmers' income and make them rich. At the same time, tobacco leaves are the basic raw material for the leaf rolling industry, and the quality of tobacco leaves determines its industrial availability.

[0003] Quinclorac, mainly used to control barnyard grass in rice fields, is the main herbicide variety in rice fields before and after germination in my country, and the annual application area accounts for about 25% of the rice-growing area. Due to long-term and large-scale use, quinclorac phytotoxicity has occurred on tobacco in tobacco-rice rotation areas such as Hunan, Guangdong, and Jiangxi, causing serious economic losses. The area of ​​phytotoxicity in Hunan Province alone is as high as 667 hectares, and the annual occurrence area in Jiangxi Province is about 45,000 mu. Large-scale phytotoxicity has also occurred in Guangdong tobacco areas. Quinclorac phytotoxicity on tobacco generally occurs from the cluster stage to the vigorous growth stage. The main symptoms are that the leaves become narrower and thicker, and the leaf edges curl toward the back of the leaves. In severe cases, the leaves are linear, causing a significant decrease in tobacco yield or even a total loss. In terms of tobacco leaf quality, the nicotine content of the affected tobacco leaves increases, the reducing sugar content decreases, the internal chemical composition is not coordinated, and the quality is seriously reduced, affecting the industrial availability and safety of tobacco leaves. It can be seen that quinclorac phytotoxicity in tobacco causes serious yield and quality losses, which not only affects the increase in income of tobacco farmers, but also affects the sustainable development of the cigarette industry. The reason for the quinclorac injury to tobacco is that quinclorac was used on the previous rice crop, and the residue in the soil caused the injury to the subsequent tobacco crop.

[0004] Improving tobacco's resistance to quinclorac through genetic engineering is an effective method. Therefore, exploring tobacco resistance genes is of great significance in the field of tobacco breeding that provides quinclorac resistance. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide tobacco NtTIRa1 gene and application thereof.

[0006] The present invention provides the use of tobacco TIRa1 as a target in plant breeding and / or in preparing products that assist plant breeding;

[0007] The amino acid sequence of the tobacco TIRa1 is shown in SEQ ID NO:2.

[0008] Furthermore,

[0009] The plant breeding comprises regulating the resistance of the plants to quinclorac.

[0010] The regulation includes increasing or decreasing.

[0011] The plants include tobacco.

[0012] The present invention provides a plant breeding or assisted breeding product, which includes at least one of the following A) to C:

[0013] A), amplification primers, detection primers and / or targeting primers using the nucleic acid encoding tobacco TIRa1 as a template;

[0014] B) Interference fragment targeting tobacco TIRa1;

[0015] C), gRNA targeting tobacco TIRa1;

[0016] D), an expression cassette containing the interference fragment as described in B), or the gRNA as described in C);

[0017] E), a recombinant vector containing the interference fragment as described in B), or the gRNA as described in C), or the interference fragment as described in D);

[0018] F), transforming or transfecting the host cell with the recombinant vector as described in E);

[0019] G), culturing the mixture obtained by the host cell described in F).

[0020] In the product described in the present invention,

[0021] The nucleotide sequence of the nucleic acid encoding tobacco TIRa1 is shown in SEQ ID NO:1.

[0022] In the present invention, the nucleic acid may be DNA, RNA, cDNA or PNA. In an embodiment of the present invention, the nucleic acid is in the form of RNA or DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. Nucleic acid may include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). Nucleic acid may be linear or circular in topology. Nucleic acid may be obtained directly from natural sources, or may be prepared with the assistance of recombination, enzymatic methods or chemical techniques.

[0023] The present invention provides a gRNA fragment, which is a fragment targeting a target gene and located about 20 bp before a recognition site (PAM site) of a CRISPR / endonuclease system (such as CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas12b, CRISPR / Cas13a and CRISPR / Cas14a) editing system; the recognition site of the CRISPR / endonuclease system editing system is different according to the different endonucleases. Generally, the recognition site includes NGG (C as9) and / or TTN (Cpf1), etc.; in a specific embodiment of the present invention, the CRISPR / Cas9 system is used, and its recognition site is NGG, wherein N represents any one of A, T, C or G bases, and the position of the NGG can be at any position of the 5' end, the middle or the 3' end of the nucleic acid encoding tobacco NtTIRa1, and the present invention is not limited thereto; in the present invention, tobacco NtTIRa1 is used as a target, and gene editing is performed using the CRISPR / Cas9 system, and specifically, the nucleotide sequence of the target segment of the gRNA fragment is shown in SEQ ID NO: 5;

[0024] Furthermore, in the present invention, a tobacco NtTIRa1 variant was obtained after gene editing by the CRISPR / Cas9 system, in which the base A at 16bp of the sequence shown in SEQ ID NO:1 was deleted, resulting in a frameshift mutation, leading to the loss and / or reduction of NtTIRa1 function.

[0025] The present invention provides a recombinant vector, which comprises at least one of the interference fragment, gRNA and / or expression cassette described in the present invention and a vector backbone.

[0026] Furthermore, the vector backbone of the present invention may be derived from plants, animals, bacteria, fungi, bacteriophages, or viruses, which are not limited in the present invention. The viral vector may include tobacco mosaic virus, adenovirus vector, adeno-associated virus (AAV) vector, retrovirus vector, or lentivirus vector.

[0027] In a specific embodiment of the present invention, the recombinant vector is derived from bacteria and / or plants, and the vector derived from bacteria is used for cloning, expressing, preserving or exerting a certain function of the NtTIRa1 gene. In a specific embodiment of the present invention, the vector specifically includes a cloning vector and / or a CRISPR / Cas9 vector.

[0028] The transformation methods include chemical transformation and electrotransformation; the transfection methods include calcium phosphate coprecipitation, artificial liposome method, viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, Agrobacterium-mediated transfection, etc.

[0029] The present invention provides a kit, which comprises the product of the present invention and auxiliary materials.

[0030] Furthermore, the auxiliary materials include: at least one of a DNA extraction reagent, a DNA reverse transcription reagent, a culture medium, an antibiotic and / or a buffer.

[0031] The present invention provides application of the product or the kit in plant breeding or assisted plant breeding.

[0032] The present invention provides a method for plant breeding or assisted plant breeding, which comprises using the product of the present invention or the kit of the present invention to carry out plant breeding.

[0033] The present invention proves for the first time that the NtTIRa1 gene has the function of regulating quinclorac resistance. The test results show that the mutant strain with NtTIRa1 gene function loss has increased quinclorac resistance, thereby eliminating or reducing the losses caused by pesticide damage to tobacco production, providing a new idea for improving tobacco's quinclorac resistance and a new means for obtaining excellent tobacco varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Shows the electrophoresis of the CDS amplification product of NtTIRa1 gene;

[0035] Figure 2 Shown is the PCR detection diagram of CRISPR / Cas9 recombinant plasmid colony;

[0036] Figure 3 A diagram showing the target site mutation types;

[0037] Figure 4 Shows the sequencing peak diagram of the mutation site;

[0038] Figure 5 Leaf width analysis of mutants is shown. DETAILED DESCRIPTION

[0039] The present invention provides tobacco NtTIRa1 gene and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0040]

[0041] Amino acid sequence of the protein encoded by tobacco NtTIRa1 gene: (SEQ ID NO: 2);

[0042] Tobacco variety: K326, a common cultivated tobacco variety, the seeds used were provided by the National Tobacco Gene Research Center. Cultivated in the tobacco growth room of the National Tobacco Gene Research Center, the culture conditions: temperature (27±1)°C, relative humidity (60±5)%, light / dark 16h / 8h.

[0043] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0044] Example 1 Acquisition of tobacco auxin receptor NtTIRa1 gene

[0045] (1) PCR amplification primer design

[0046] Based on the existing tobacco genome sequence, primers for CDS region amplification were designed for the NtTIRa1 gene. The sequences are as follows:

[0047] Upstream primer 21033f: 5′-ccattactttattgggatgcag-3′ (SEQ ID NO: 3);

[0048] Downstream primer 21033r: 5'-ctttcgatcacaaggagacag-3' (SEQ ID NO: 4);

[0049] (2) Preparation of PCR amplification template

[0050] Total RNA was extracted from K326 tobacco leaves using the SuperPure Plant polyRNA Kit. The extracted total RNA was reverse transcribed into cDNA using the II Reverse Transcriptase Kit, and the cDNA was used as a template for PCR amplification.

[0051] (3) PCR amplification

[0052] Referring to the instruction manual of 2×TransTaq High Fidelity (HiFi) PCR SuperMix, the cDNA prepared in step (2) was used as a template, and PCR amplification was performed using the primers designed in step (1). The reaction system was added according to the instruction manual, and the PCR reaction was performed. The PCR reaction conditions were: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 100 s, for 30 cycles; and extension at 72°C for 5 min.

[0053] The PCR amplification products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, there is a clear and single target band at around 1800 bp.

[0054] The target fragment was recovered from gel and sent for sequencing. The sequencing result is shown in SEQ ID NO: 1.

[0055] Example 2 Construction of gene editing vector

[0056] In order to obtain tobacco plants with quinclorac resistance, CRISPR / Cas9 technology was used to construct a gene editing vector and perform gene transformation to obtain tobacco plants with NtTIRa1 gene knockout.

[0057] This example provides a brief introduction to the construction of relevant gene editing vectors as follows:

[0058] (1) Editing target primer design

[0059] For the target site region of the NtTIRa1 gene (specific sequence of the target site: atcccagcttgaaaaaaccg, SEQ ID NO: 5), the editing primer sequences were designed as follows:

[0060] TIRa1-f: 5'-gattgatcccagcttgaaaaaaccg-3' (SEQ ID NO: 6);

[0061] TIRa1-r: 5'-aaaccggttttttcaagctgggatc-3' (SEQ ID NO: 7);

[0062] (2) Primer annealing and vector ligation

[0063] Refer to the instructions of Annealing Buffer for DNA Oligos (5×) kit to obtain double-stranded DNA of the target site by primer annealing; the annealing reaction system is as follows: Annealing Buffer for DNA Oligos (5×), 4μL; upstream and downstream primers (TIRa1-f, TIRa1-r), 4μL each (50μmoL / μL); Nuclease-free water is added to 20μL. The reaction procedure is: 95℃5min, decrease 0.1℃ every 8s, to 25℃.

[0064] The above annealing product (double-stranded DNA of the target site) was connected to the CRISPR / Cas9 vector after BsaⅠ digestion, and the CRISPR / Cas9 expression vector for knocking out the NtTIRa1 gene was screened. The 20μL connection system was designed as follows: annealing product, 6μL; digestion product (CRISPR / Cas9 vector after BsaⅠ digestion), 3μL; 10×T4 DNA Ligase Buffer, 2μL; T4 DNA Ligase, 1μL; sterile water was added to 20μL and connected at 37℃ for 3h.

[0065] The above ligation products were transformed into DH5α E. coli competent cells for replication, and then screened and identified by colony PCR. During identification, primer pair U26-jiance-F (5'-ttaggtttacccgccaata-3', SEQ ID NO: 8) and TIRa1-r were used for positive clone detection. The electrophoresis results were as follows: Figure 2 As shown, lane 1 and lane 4 have specific target bands at around 500 bp, which are positive clones, and the editing plasmids of the positive clones are extracted.

[0066] Example 3 Obtaining a transgenic strain with NtTIRa1 gene knockout

[0067] The edited plasmid extracted in Example 2 was transformed into Agrobacterium, and then into tobacco plants to construct transgenic plants with NtTIRa1 gene knockout. The specific experimental process is as follows.

[0068] (1) Transformation of Agrobacterium

[0069] Thaw the competent cells of Agrobacterium GV3101 on ice, add 6 μL of the editing vector prepared in Example 2, and mix gently; place the mixture in a pre-cooled electroporation cup and place it on ice for 5 minutes. Use absorbent paper to absorb the water droplets on the outer wall of the electroporation cup, put the electroporation cup into the electroporation tank, and perform electroporation transformation. The electroporation conditions are: voltage 2.5kV, capacitance 25μF, resistance 200Ω. After the click is completed, quickly add 800μL of YEB liquid culture medium preheated to 28℃, and shake and recover at 28℃ for 3h in a shaker at 220rpm. The bacterial solution is evenly applied to the YEB solid culture medium containing rifampicin (100μg / mL), streptomycin (50μg / mL) and kanamycin (50μg / mL), and cultured at 28℃ until a single colony is formed. Pick a single colony, expand the culture, and perform PCR identification on the bacterial solution. The identification primers are U26-jiance-F and TIRa1-r. The correct strain is identified as the positive engineered bacteria.

[0070] (2) Transformation of tobacco plants

[0071] The positive engineered bacteria prepared above were cultured to OD 600 = 0.6, centrifuge at 4000rpm for 5min to collect the cells, and then suspend the cells in 20mL of MS liquid medium. Take the leaves of K326 sterile seedlings that have grown for about one month and cut them into 0.5-1cm 2 Square leaf disc. Then place the leaf disc in the bacterial solution and immerse for 10 minutes. Use sterile filter paper to absorb the excess bacterial solution around the leaf disc after immersion, and culture it in the dark on the solid medium of MS+6-BA (2mg / L)+NAA (0.5mg / L) for 3 days. MS solid medium formula: 4.4g / L MS inorganic salt, 30g / L sucrose, 2.5g / L plant gel, pH 5.8-5.9.

[0072] The leaf disc was washed with sterile water containing Cef (400 mg / L), and the excess liquid was absorbed with sterile filter paper. The leaf disc was transferred to MS solid screening medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L) and Kan (50 mg / L), and cultured at 28°C under light.

[0073] When the adventitious buds grew to 0.5 cm, they were transferred to MS solid medium containing Cef (200 mg / L) and Kan (50 mg / L) for rooting.

[0074] After growing for about a month, transplant them into the soil. Take a small amount of leaves, extract genomic DNA, and use PCR method to detect positive transgenic strains. The detection primers are U26-jiance-F and TIRa1-r.

[0075] According to the genome sequence, detection primers spanning the target site of the NtTIRa1 gene were designed to detect the mutation type of the target site. The specific primers are:

[0076] CK-2950-F: 5'-agtttccttgaggagagtaaac-3' (SEQ ID NO: 9);

[0077] CK-2950-R: 5'-ctgcattgtaccaatcctta-3' (SEQ ID NO: 10);

[0078] The PCR amplification product was sent for sequencing, and the mutation type was determined based on the sequencing results. Figure 3 As shown in the figure, in the T0 generation plant AP-31-22-15-5, a nucleotide base deletion mutation was detected at the target site of the NtTIRa1 gene, deleting one base A (specifically, the base A at 16bp of the sequence shown in SEQ ID NO:1 was missing), causing a frameshift mutation in the NtTIRa1 protein, thereby inactivating the NtTIRa1 protein. No mutation was detected at the target site of the NtTIRa1 gene of the wild-type plant. The sequencing peak diagram is shown in Figure 4 As shown, the peak shape of the site where the base deletion occurred is single, indicating that the mutation site is already homozygous, proving that AP-31-22-15-5 is a homozygous mutant strain.

[0079] Example 4 Quinclorac resistance assay

[0080] In order to clarify the resistance level of NtTIRa1 gene knockout mutants to quinclorac, the resistance of wild-type K326 and NtTIRa1 gene mutant plant AP-31-22-15-5 to quinclorac was determined using leaf width as an indicator.

[0081] A pot experiment was performed, and dichloroquinoline was added for treatment to determine the resistance of the mutants in Example 3 to dichloroquinoline. Specifically, the mutant AP-31-22-15-5 and the wild type K326 were used as materials. Each tobacco plant was irrigated with 20 mL of dichloroquinoline solution at the 5-leaf stage, and the final concentration of dichloroquinoline was 0.2 mg / kg. The leaf width was measured after 30 days of treatment. The upper 3 leaves were measured, and the untreated K326 (irrigated with the same volume of clean water) was used as the control. Data statistics were performed, and the results are as follows Figure 5As shown. Under the condition of quinclorac phytotoxicity, compared with the control K326, the widths of the three upper leaves of AP-31-22-15-5 increased by 69.7%, 71.3%, and 69.3%, respectively. Quinclorac had no obvious inhibition on the leaf width of AP-31-22-15-5, and AP-31-22-15-5 showed good resistance ( Figure 5 The control is K326; K326Q is K326 treated with quinclorac; AP-31-22-15-5 is AP-31-22-15-5 not treated with quinclorac; AP-31-22-15-5Q is AP-31-22-15-5 treated with quinclorac, among which 71.0% and 0.2% represent the first leaves of K326 and AP-31-22-15-5, respectively. The decrease in leaf width before and after treatment with quinclorac; 79.50% and 12.0% represent the decrease in leaf width of the second leaf K326 and AP-31-22-15-5 before and after treatment with quinclorac; 81.6% and 12.1% represent the decrease in leaf width of the third leaf K326 and AP-31-22-15-5 before and after treatment with quinclorac).

[0082] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of tobacco TIRa1 as a target in plant breeding and / or in the preparation of products assisting plant breeding; The amino acid sequence of the tobacco TIRa1 is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The plant breeding comprises regulating the resistance of the plants to quinclorac.

3. The use according to claim 2, characterized in that: The regulation includes increasing or decreasing.

4. The use according to any one of claims 1 to 3, characterized in that: The plants include tobacco.

5. A plant breeding or plant breeding assisted product, characterized in that: Including at least one of the following A) to C: A), amplification primers, detection primers and / or targeting primers using the nucleic acid encoding tobacco TIRa1 as a template; B) Interference fragment targeting tobacco TIRa1; C), gRNA targeting tobacco TIRa1; D), an expression cassette containing the interference fragment as described in B), or the gRNA as described in C); E), a recombinant vector containing the interference fragment as described in B), or the gRNA as described in C), or the interference fragment as described in D); F), transforming or transfecting the host cell with the recombinant vector as described in E); G), culturing the mixture obtained by the host cell described in F).

6. The product according to claim 5, characterized in that The target nucleotide sequence of the gRNA is shown in SEQ ID NO:

5.

7. A kit, characterized in that Including the product and auxiliary materials described in claim 5 or 6.

8. The kit according to claim 7, characterized in that The auxiliary materials include: at least one of a DNA extraction reagent, a DNA reverse transcription reagent, a culture medium, an antibiotic and / or a buffer.

9. Use of the product according to claim 5 or 6 or the kit according to claim 7 or 8 in plant breeding or assisted plant breeding.

10. A method for plant breeding or assisted plant breeding, characterized in that The method comprises using the product according to claim 5 or 6 or the kit according to claim 7 or 8 for plant breeding.

Images