A multi-antigen epitope fusion protein of bovine source of type B pasteurella multocida, an outer membrane vesicle vaccine and a preparation method thereof

Abstract

The application discloses a multi-antigen epitope fusion protein of yak-derived B-type Pasteurella multocida, an outer membrane vesicle vaccine and a preparation method thereof, and relates to the technical fields of genetic engineering and immunology. The amino acid sequence of the multi-antigen epitope fusion protein is shown as SEQ ID NO. 2. The multi-antigen epitope fusion protein provided by the application can stimulate yak to produce specific antibodies and protect yak against yak-derived B-type Pasteurella multocida infection. Therefore, the multi-antigen epitope fusion protein provided by the application can be used to prepare a subunit vaccine for preventing yak-derived B-type Pasteurella multocida infection. The application further provides an outer membrane vesicle vaccine of yak-derived B-type Pasteurella multocida, which can effectively activate the humoral immune response of a test yak and produce high levels of specific antibodies, and thus can be applied to preventing yak-derived B-type Pasteurella multocida infection.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and immunology, and particularly relates to a multi-antigen epitope fusion protein of bovine B-type Pasteurella multocida, an outer membrane vesicle vaccine and a preparation method thereof. BACKGROUND

[0002] Pasteurella multocida (Pm) can infect various livestock and wild animals, and there is a host preference and pathogenicity difference between different serotypes of strains. The bovine hemorrhagic septicemia caused by the B-type Pm has a rapid onset and a high mortality rate, which has caused serious harm to the yak breeding industry in China.

[0003] At present, the Pasteurella multocida inactivated vaccine is the main means for preventing and treating bovine hemorrhagic septicemia. The inactivated vaccine is made of the Pasteurella multocida epidemic strain through bacterial culture system amplification, inactivation, emulsification and other processes, which plays an important role in controlling the prevalence of bovine Pasteurella multocida disease in China. However, the traditional inactivated vaccine has the disadvantages of high production cost, large injection dose, slow induction of humoral immune response, short immune duration, poor cellular immune response and the risk of bacterial dissemination due to incomplete inactivation in the production and preparation process.

[0004] Bacterial outer membrane vesicles (OMV) are spherical nanovesicles secreted by gram-negative bacteria, with a diameter of 20-250 nm. The outer membrane proteins, lipoproteins, LPS and other substances contained in the OMV can be recognized by a series of pattern recognition receptors (PRR) and induce natural immune response, and the OMV can be recognized by antigen presenting cells and activate acquired immune response. At present, there are mature Neisseria vaccines abroad, and there are also related researches on OMV vaccines in China, but there is still a blank in the development of outer membrane vesicle vaccines for bovine hemorrhagic septicemia. SUMMARY

[0005] The purpose of the present application is to provide a multi-antigen epitope fusion protein of bovine B-type Pasteurella multocida, an outer membrane vesicle vaccine and a preparation method thereof, so as to solve the problems existing in the prior art. The multi-antigen epitope fusion protein can stimulate the yak to produce specific antibodies and protect the yak against bovine B-type Pasteurella multocida infection, and therefore, the antigen provided by the present application can be made into a subunit vaccine for preventing bovine B-type Pasteurella multocida infection.

[0006] To achieve the above purpose, the present application provides the following solutions.

[0007] The present invention provides a multi-antigen epitope fusion protein of yak-derived Pasteurella multocida type B. The amino acid sequence of the multi-antigen epitope fusion protein is shown in SEQ ID NO.2.

[0008] The present invention also provides a gene encoding the multi-antigen epitope fusion protein.

[0009] Furthermore, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3.

[0010] The present invention also provides a recombinant plasmid comprising the above coding gene.

[0011] The present invention also provides a recombinant host cell, comprising the above-mentioned recombinant plasmid.

[0012] The present invention also provides the use of the above-mentioned encoding gene, recombinant plasmid or recombinant host cell in the preparation of a yak-derived subunit vaccine of type B Pasteurella multocida.

[0013] Furthermore, the subunit vaccine is an outer membrane vesicle vaccine.

[0014] The present invention also provides a method for preparing an outer membrane vesicle vaccine of yak-derived Pasteurella multocida type B, comprising the following steps: fermenting and culturing the above-mentioned recombinant host cells and inducing the expression of multi-antigen epitope fusion proteins, and then isolating and obtaining the cell outer membrane vesicles, namely the outer membrane vesicle vaccine.

[0015] The present invention also provides an outer membrane vesicle vaccine prepared according to the above preparation method.

[0016] Furthermore, the outer membrane vesicle vaccine also includes a vaccine adjuvant.

[0017] The present invention discloses the following technical effects:

[0018] The multi-epitope fusion protein provided by the present invention can stimulate yaks to produce specific antibodies and protect yaks against infection with yak-derived Pasteurella multocida type B. Therefore, the multi-epitope fusion protein provided by the present invention can be made into a subunit vaccine for preventing yak-derived Pasteurella multocida type B infection.

[0019] The present invention also provides an outer membrane vesicle vaccine for yak-derived type B Pasteurella multocida, which can effectively activate the humoral immune response of the tested yaks and produce high levels of specific antibodies, and can thus be used to prevent yak-derived type B Pasteurella multocida infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 Schematic diagram of the construction strategy of the recombinant plasmid pBAD24(CmR)-ClyA-P;

[0022] Figure 2 The results of protein expression identification by Western Blot were shown. Lane M is a marker, lane 1 is a control bacterial solution, and lane 2 is an induced bacterial solution.

[0023] Figure 3 Transmission electron microscopy observation of OMV; the scale bar is 100 nm;

[0024] Figure 4 This is the NTA detection diagram of OMV;

[0025] Figure 5 The figure shows the results of proteinase K detection of recombinant fusion protein expressed on the outside of OMV membrane; among them, lane 1 is the marker, lane 2 is OMV with SDS but no proteinase K, lane 3 is OMV with proteinase K but no SDS, and lane 4 is OMV with both SDS and proteinase K added;

[0026] Figure 6 This is the test result of yak serum antibodies after vaccination. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The instruments used in the present invention are all common commercial products and can be purchased in the market.

[0033] Example 1 Recombinant expression of yak-derived Pasteurella multocida fusion antigen

[0034] The present invention analyzes the ompH, ompA, PlpE, VacJ, and P6 genes of yak-derived Pasteurella type B, and selects sequence fragments with high signal peptide, highly conserved region, and antigen epitope scores. The specific prediction method is as follows: the amino acid sequences encoding ompH, ompA, PlpE, VacJ, and P6 are uploaded to ABCpred (https: / / webs.iiitd.edu.in / raghava / abcpred / index.), the Threshold value is set to 0.8, the epitope length is 16aa, 18aa, 2 0aa; the encoded amino acid sequence was uploaded to BCPred (http: / / ailab-projects2.ist.psu.edu / bcpred / predict.html), with epitope lengths set to 16aa, 18aa, 20aa, and 22aa, and classification specificity set to 90%; the encoded amino acid sequence was uploaded to BepiPred (https: / / services.healthtech.dtu.dk / services / BepiPred-2.0 / ), using flexible length prediction. The scores of the above epitopes are shown in Tables 1-3. Short peptide fragments with high epitope overlap were selected for truncation. After concatenating the fragments using the GGSSG sequence, the ClyA gene was connected to the 5' end of the nucleotide sequence. The ribosome binding site sequence and protective bases were inserted at the 5' end of the fusion gene, and the 6*His protein tag and stop codon were inserted at the 3' end to obtain the encoding gene of the multi-epitope fusion protein.

[0035] Table 1 Antigenic scores of ompH, ompA, PlpE, VacJ, and P6 proteins by ABCpred

[0036]

[0037]

[0038]

[0039] Table 2 Antigenic scores of ompH, ompA, PlpE, VacJ, and P6 proteins by BCPred

[0040]

[0041] Table 3 Antigenic scores of Bepipred for ompH, ompA, PlpE, VacJ, and P6 proteins

[0042]

[0043] ClyA基因编码蛋白的氨基酸序列如SEQ ID NO.1所示,多抗原表位融合蛋白的氨基酸序列如SEQ ID NO.2所示。

[0044] SEQ ID NO.1:

[0045] MTEIVADKTVEVVKNAIETADGALDLYNKYLDQVIPWQTFDETIKELSRFKQEYSQAASVLVGDIKTLLMDSQDKYFEATQTVYEWCGVATQLLAAYILLFDEYNEKKASAQKDILIKVLDDGITKLNEAQKSLLVSSQSFNNASGKLLALDSQLTNDFSEKSSYFQSQVDKIRREAYAGAAAGVVAGPFGLIISYSIAAAVVEGKLIPELKNKLKSVQNFFTTLSNTVKQANKDIDAAKLKLTTEIAAIGEIKTETETTRFYVDYDDLMLSLLKEAAKKMINTCNEYQKRHGKKTLFEVPEV。

[0046] SEQ ID NO.2:

[0047] TANKKSIDEKIAASQKKVEAKVAALQKDAPKLRSADIKKREEEINKLGNSEQEAINKLVTAHDEEVSKYQDDYAKREREETAKLVDSIQNGGSSGNLSKVTPEGTSDNLVWPKIDESVFNHDGSQFGSWPNWDNVRMVERGMNKDQLYNLLGRPHFSEGLYGVREWDYVFNYRENGVHKVCQYKVLFDKNMNAQSFFWYPNGCNGSGGSSGNDFGDVTYKKSNAERRDFVAKNSKAFGKKFIVLPNTQYGDWEGGLDKNYFKGDSQSKLDVRAKGGSSGRAKALDKDALLEQSQDPYITFREAYFQNLEYRVKDGKVSTPKQDLTQDILNGGSSGGSSKKDESAGQMFGGYSVQDLQQRYNTVYFGFDKYNIEGEYVQILDAHAAFLNATPATKVVVEGNTDERGTPEYNIALGGSSG。

[0048] SEQ ID NO.3:

[0049] GAATTC TTAAAGAGGAGAAAGGTCATGACTGAAATCGTTGCAGATAAAACGGTAGAGG

[0050] TAGTTAAAAACGCAATCGAAACCGCAGATGGAGCATTAGATCTTTATAATAAATATCTCG

[0051] ATCAGGTCATCCCCTGGCAGACCTTCGATGAAACCATAAAAGAGTTAAGTCGCTTTAAA

[0052] CAGGAGTATTCACAGGCAGCCTCCGTTTTAGTTGGCGATATTAAAACCTTACTTATGGAT

[0053] AGCCAGGATAAGTATTTTGAAGCAACCCAAACGGTGTATGAATGGTGTGGTGTTGCGAC

[0054] GCAATTGCTCGCAGCATATATTTTGCTATTTGATGAGTACAATGAGAAGAAAGCATCCGC

[0055] CCAGAAAGACATTCTCATTAAGGTACTGGATGACGGCATCACGAAGCTGAATGAAGCGC

[0056] AAAAATCTCTGCTGGTAAGCTCACAAAGTTTCAACAACGCTTCCGGAAAACTGCTGGCG

[0057] TTAGATAGCCAGTTAACCAATGATTTTTCAGAAAAAAGCAGCTATTTCCAGTCACAGGTA

[0058] GATAAAATCAGGAGGGAAGCGTATGCCGGTGCCGCAGCCGGTGTCGTCGCCGGTCCATT

[0059] TGGATTAATCATTTCCTATTCTATTGCTGCGGCCGTAGTTGAAGGGAAACTGATTCCAGAA

[0060] TTGAAGAACAAGTTAAAATCTGTGCAGAATTTCTTTACCACCCTGTCTAACACGGTTAAA

[0061] CAAGCGAATAAAGATATCGATGCCGCCAAATTGAAATTAACCACCGAAATAGCCGCCATC

[0062] GGTGAGATAAAAACGGAAACTGAAACAACCAGATTCTACGTTGATTATGATGATTTAATG

[0063] CTTTCTTTGCTAAAAGAAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAA

[0064] AAGACACGGTAAGAAGACACTCTTTGAGGTACCTGAAGTCGGTGGCAGCAGCGGTACC

[0065] GCAAACAAGAAGAGCATTGATGAAAAAATTGCAGCAAGCCAGAAGAAGGTGGAAGCA

[0066] AAAGTGGCAGCACTGCAGAAAGATGCACCGAAACTGCGTAGTGCGGATATTAAGAAGC

[0067] GCGAAGAAGAAATTAATAAACTGGGTAATAGCGAACAGGAAGCAATCAATAAACTGGTA

[0068] ACCGCGCATGATGAAGAAGTGAGCAAATATCAGGATGATTATGCAAAACGTGAACGTGA

[0069] AGAAACAGCAAAACTGGTGGATAGCATTCAGAATGGTGGTAGTAGCGGTAACCTGAGTA

[0070] AAGTGACACCGGAAGGTACCAGCGATAATCTGGTGTGGCCTAAAATTGATGAAAGCGTG

[0071] TTTAATCATGATGGTAGCCAGTTTGGCAGCTGGCCGAATTGGGATAATGTGCGTATGGTG

[0072] GAACGTGGTATGAAATAAAGATCAGCTGTATAATCTGCTGGGCCGTCCGCATTTTCTGAA

[0073] GGTCTGTATGGTGTTCGTGAATGGGATTATGTTTTTAAATTATCGTGAAACGGCGTGCATA

[0074] AAGTTTGTCAGTATAAAGTTCTGTTTGATAAAAACATGAACGCACAGAGTTTCTTCTGGT

[0075] ATCCGAATGGTTGCAATGGTAGCGGCGGTAGTTCCGGCAATGATTTTGGTGATGTTACCT

[0076] ATAAGAAGTCTAATGCAGAACGCCGTGATTTTGTTGCAAAAAAACTCAAAGCCTTTGGC

[0077] AAGAAGTTTATTGTTCTGCCGAATACACAGTATGGTGATTGGGAAGGTGGTCTGGATAAA

[0078] AATTATTTTAAAGGTGATAGTCAGAGTAAACTGGATGTTCGTGCCAAAGGTGGTAGCTCA

[0079] GGTCGTGCAAAGCCCTGGATAAAGATGCGCTGCTGGAACAGAGCCAGGATCCTGTATAT

[0080] CACATTTCGTGAAGCATATTTTCAGAATCTGGAATATCGTGTTAAAAGATGGTAAAGTTAGT

[0081] ACCCCTAAACAGGATCTGACCCAGGATATTCTGAATGGTGGTAGCAGCGGTGGTAGCAG

[0082] TAAGAAGGATGAAAGCCGGGCCAGATGTTTGGTGGTTAGCGTGCAGGATCTGCAGC

[0083] AGCGTTATAATACCGTTTATTTTGGTTTTGATAAATATAACATCGAAGGCGAATATGTGCA

[0084] GATTCTGGATGCACATGCAGCATTTCTGAATGCAACCCCGGCAACCAAAGTTGTTGTCG

[0085] AAGGTAACACCGATGAACGTGGTACCCCGGAATATAACATTGCACTGGGTGGTAGCTCTGGTCATCATCATCATCATCATTAAaagctt.

[0086] To increase the likelihood of soluble protein expression, the nucleotide sequence encoding the fusion protein was codon-optimized. The optimized nucleotide sequence, shown in SEQ ID NO. 3, consisted of synonymous substitutions of the codons encoding SEQ ID NO. 1 and SEQ ID NO. 2, and the GC content was adjusted. An EcoRI restriction site was inserted at the 5' end of the synthetic fusion protein nucleotide sequence, and a HindIII restriction site was inserted at the 3' end. The optimized sequence was synthesized and authenticated by Beijing Qingke Biotechnology Co., Ltd. The optimized sequence was then ligated into the pBAD24(CmR) vector via double restriction enzyme digestion to generate the recombinant plasmid pBAD24(CmR)-ClyA-P. The pBAD24(CmR) vector was modified from the pBAD24 vector by replacing the gene cassette expressing ampicillin resistance with one expressing chloramphenicol resistance. The pBAD24(CmR) vector was provided by Professor Li Jiakui's laboratory at Huazhong Agricultural University.

[0087] The successfully identified recombinant plasmid was transformed into Escherichia coli Nissle1917 (ΔnlpIΔlpxM) to obtain the recombinant strain. Escherichia coli Nissle1917 (ΔnlpIΔlpxM) was a gift from Professor Yung-fu Chang of Cornell University.

[0088] The recombinant strain was inoculated into the culture medium. Specifically, 100 μL of bacterial solution was inoculated into 100 mL of LB culture medium (containing 50 mg / mL chloramphenicol) at 200 rpm and 37°C overnight. The next day, the overnight bacteria were transferred to 1 L of LB culture medium (containing 50 mg / mL chloramphenicol) at a ratio of 1:100 and cultured at 200 rpm at 37°C until the OD 600When the concentration is 0.6-0.8, add 2g L-arabinose and continue induction for 12 hours. Take 1mL of the bacterial suspension before and after induction and perform the following treatment: centrifuge at 12,000rpm for 2 minutes, discard the supernatant, resuspend the cells in 80μL PBS, add 20μL 5× loading buffer, mix well, and boil for 15 minutes.

[0089] Western blot analysis confirmed protein expression. The following steps were performed: First, perform a 10% SDS-polyacrylamide gel electrophoresis. Meanwhile, prepare the necessary reagents: Transfer buffer: Add transfer powder to 200 mL of anhydrous ethanol, dilute to 1 L with distilled water, and refrigerate at 4°C. TBST: Dilute 20× TBST buffer to 1× TBST. Blocking buffer: Weigh 5 g of skim milk powder and add 100 mL of TBST. Prepare immediately.

[0090] Transfer: Wet transfer was used. The transfer solution was pre-chilled at 4°C. The SDS-PAGE gel was transferred to the transfer solution and soaked. The PVDF membrane was cut to the size of the target protein gel. The transfer conditions were a constant current of 220 mA for 1 hour.

[0091] After transfer, remove the PVDF membrane and block with 5% skim milk powder at room temperature for 2 hours (or overnight at 4°C). Dilute the His-tag protein monoclonal antibody 1:5000 in primary antibody diluent and incubate at room temperature for 1 hour. Then, wash the membrane three times with TBST (10 minutes each) on a shaker at room temperature. Dilute HRP-conjugated goat anti-mouse IgG as a secondary antibody 1:10000 and incubate at room temperature for 1 hour. Discard the secondary antibody and wash the membrane three times with TBST (5 minutes each). Mix Solution A and Solution B from the Ultrasensitive ECL Chemiluminescence Kit in a 1:1 ratio. Remove any remaining TBST from the PVDF membrane with filter paper. Place the membrane in an imaging system, add the luminescent solution, and adjust the instrument parameters for exposure.

[0092] According to the results of Western Blot ( Figure 2 ) It can be seen that the recombinant strain can express the target recombinant protein after induction with L-arabinose. Lane 1 is the marker, lane 2 is the uninduced bacterial solution, and lane 3 is the induced bacterial solution.

[0093] Example 2 Preparation of recombinant E. coli OMV

[0094] Take 1 L of the bacterial suspension induced with L-arabinose from Example 1 and centrifuge at 8,000 rpm to remove the cells and obtain the supernatant. Filter through a 0.45 μm filter and ultrafilter using a 100 kDa ultrafiltration membrane to concentrate to approximately 200 mL. Centrifuge at 150,000 × g for 2 hours, resuspend the pellet, and ultracentrifuge at 150,000 × g for 2 hours. Resuspend in 1 mL of PBS to obtain OMVs. Determine the concentration by BCA assay and store in a -80°C freezer until ready for use.

[0095] Use transmission electron microscopy to observe the morphology of OMVs. Take the collected OMVs, dilute them at different gradients, take 10μL of OMVs and drop them on the copper grid. Let it stand for 10 minutes and then carefully wash off the liquid. Use 2% phosphotungstic acid solution to stain the OMVs. Let it stand for 2 minutes and then remove the staining liquid and observe it under a transmission electron microscope. Figure 3 As shown, a saucer-shaped outer membrane vesicle structure was observed under transmission electron microscopy, and the morphological structure was relatively clear.

[0096] The ZetaView Particle Metrix instrument sample pool was rinsed three times with pure water. After rinsing, the instrument was calibrated using a standard (100 nm PS beads, polystyrene microspheres). The sample to be tested was diluted with PBS buffer and the diluted OMV sample was added to the sample pool to observe the real-time dynamic image of the nanoparticles and collect data. The dilution ratio was 1:4000, and the particle detection concentration was 6.4×10 7 Particles / mL. Figure 4 As shown in Figure 2, the OMVs obtained after separation and purification have two peaks at 236.3 nm and 172.7 nm. The original particle size concentration is calculated to be 2.6×10 11 Particles / mL, of which 50% had a smaller particle size of 201.3 nm. The particle characterization results of OMVs showed that the isolated OMVs had good stability.

[0097] Example 3 Localization Detection of Recombinant Fusion Protein in OMV

[0098] ClyA has the function of anchoring to the cell outer membrane. It is connected in series with the target fusion protein so that the target fusion protein is expressed on the outer membrane of the OMV, thereby exposing the antigenic epitope. The proteinase K method is used to detect the localization of the fusion protein, as follows:

[0099] Three 200 μL EP tubes were filled with 100 μL of OMVs. Proteinase K was added to a final concentration of 0.1 mg / mL with or without 1% SDS. The tubes were incubated at 37°C for 10 min, followed by phenylmethylsulfonyl fluoride (PMSF) at a final concentration of 10 mM. 80 μL of the sample was then aspirated, 20 μL of 5× loading buffer was added, and the mixture was mixed. The tubes were then boiled for 15 min. The samples were analyzed by Western Blot to determine the localization of protein expression. The method was the same as in Example 1.

[0100] According to the Western Blot results ( Figure 5 ) It can be seen that the recombinant protein is expressed in the outer membrane of OMV, where lane 1 is the marker, lane 2 is the OMV with SDS but no proteinase K, lane 3 is the OMV with proteinase K but no SDS, and lane 4 is the OMV with both SDS and proteinase K.

[0101] Example 4 Preparation of recombinant vaccine

[0102] Prepare the vaccine as follows:

[0103] The OMV prepared in Example 2 was mixed with the ISA 61VG adjuvant to prepare the vaccine rOMV@ISA 61VG, wherein the volume ratio of OMV to ISA 61VG was 3:2, and each dose of the vaccine contained 600 μg of OMV.

[0104] The OMV prepared in Example 2 was mixed with the Gel 01 adjuvant to prepare the vaccine rOMV@Gel 01, wherein the volume ratio of OMV to Gel 01 was 10:1, and each dose of the vaccine contained 600 μg of OMV.

[0105] The OMV prepared in Example 2 was mixed with Al(OH)3 adjuvant to prepare the vaccine rOMV@Al(OH)3, wherein the volume ratio of OMV to Al(OH)3 adjuvant was 1:4, and each dose of vaccine contained 600 μg of OMV.

[0106] Example 5

[0107] 1. Evaluation of the immune effect of OMV vaccine on yaks

[0108] Yak calves aged 6 months to 1 year without Pasteurella multocida antibodies were randomly divided into 5 groups of 4 each. The OMVs prepared in Example 2 and the three vaccines prepared in Example 4 were used for immunization. The rOMV@Gel 01 group received a subcutaneous injection of rOMV@Gel 01 prepared in Example 4; the rOMV group received an intramuscular injection of OMVs prepared in Example 2; the rOMV@ISA 61VG group received an intramuscular injection of rOMV@ISA 61VG prepared in Example 4; the rOMV@Al(OH)3 group received an intramuscular injection of rOMV@Al(OH)3 prepared in Example 4; and the control group received an intramuscular injection of PBS. A booster immunization was performed 21 days after the initial immunization. On the 42nd day, 2 million Pasteurella multocida type B were injected subcutaneously. The yaks were observed for 7 days to evaluate the protective effect of the vaccine. If the yaks showed obvious respiratory symptoms or clinical signs of scourge, such as subcutaneous edema, the immunization was considered ineffective.

[0109] As shown in Table 4, within 7 days after the infection, all yaks in the control group were judged to have no immune effect, while all the immune groups had a protective effect, among which the combination of OMV and adjuvant showed a better immune effect.

[0110] Table 4 Evaluation results of immune protection of yaks after OMV vaccine immunization

[0111] Grouping Number of surviving heads Protection rate PBS 0 / 4 0 rOMV 1 / 4 25％ rOMV@Gel01 2 / 4 50％ rOMV@ISA61VG 3 / 4 75％ <![CDATA[rOMV@Al(OH)3]]> 3 / 4 75％

[0112] 2. Yak serum antibody level detection

[0113] After immunization, 5 mL of blood was collected from the jugular vein every 7 days. The blood was allowed to stand until the serum was precipitated, and the supernatant was centrifuged at 4°C and stored at -20°C. The serum antibody levels were measured by ELISA as follows:

[0114] ① Coating: Dilute the OMVs obtained in Example 2 to 20 μg / mL using the coating solution. Add 100 μL per well of the ELISA plate and incubate at 4°C overnight. The next day, discard the solution and add 200 μL of PBST solution to each well. Let stand for 2 minutes, then tap thoroughly. Repeat three times.

[0115] ② Blocking: Add 200 μL of blocking horse serum to each well, incubate at 37°C for 2 h, discard the blocking solution and wash three times with PBST.

[0116] ③ Sample addition: Dilute the serum to be tested at a ratio of 1:500 with PBS and add 100 μL to each well. Set up three replicates for each sample. Incubate at 37°C for 1 hour, then discard the solution in the wells and wash three times with PBST.

[0117] ④ Add enzyme-labeled secondary antibody: Add HRP-labeled goat anti-bovine IgG (1:10000 dilution), incubate at 37℃ for 1 hour, discard the solution and wash 3 times with PBST.

[0118] ⑤ Color development: Add 50 μL of TMB substrate color development solution and incubate at 37°C for 15 min in the dark.

[0119] ⑥Terminate the reaction: add 50 μL of stop solution (2 M sulfuric acid).

[0120] Result determination: Place the ELISA plate in a microplate reader and measure the OD value of each well at 450 nm.

[0121] like Figure 6 As shown, all immunized groups produced antibodies starting from the 7th day after immunization, and the serum IgG level on the 42nd day was significantly higher than that of the control group, and the difference was extremely significant (P < 0.001).

[0122] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A multi-epitope fusion protein of Pasteurella multocida type B from yak, characterized in that: The nucleotide sequence of the gene encoding the multi-antigen epitope fusion protein is shown in SEQ ID NO.

3.

2. A gene encoding the multi-antigen epitope fusion protein according to claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A recombinant plasmid, characterized in that Comprising the coding gene according to claim 2 or 3.

5. A recombinant host cell, characterized in that Comprising the recombinant plasmid according to claim 4.

6. Use of the encoding gene according to claim 2 or 3, the recombinant plasmid according to claim 4 or the recombinant host cell according to claim 5 in the preparation of a subunit vaccine against yak-derived Pasteurella multocida type B.

7. The use according to claim 6, characterized in that The subunit vaccine is an outer membrane vesicle vaccine.

8. A method for preparing an outer membrane vesicle vaccine of yak-derived Pasteurella multocida type B, characterized in that: The following steps are involved: The recombinant host cell according to claim 5 is fermented and cultured to induce the expression of the multi-antigen epitope fusion protein according to claim 1, and then the cell outer membrane vesicles are isolated to obtain the outer membrane vesicle vaccine.

9. An outer membrane vesicle vaccine prepared according to the preparation method according to claim 8.

10. The outer membrane vesicle vaccine according to claim 9, characterized in that The outer membrane vesicle vaccine also includes a vaccine adjuvant.

Images