Candida angustifolia ZB437 and application thereof

Abstract

The invention relates to the technical field of microbial fermentation, and particularly discloses candida angustifolia ZB437 and application thereof. The candida angustifolia ZB437 is preserved in the Guangdong Microbial Culture Collection Center on June 29, 2021, the preservation number is GDMCC No: 61753, and the preservation address is No.59 building, No.100 courtyard, Xianlie Middle Road, Guangzhou. The strain disclosed by the invention is good in salt tolerance, can normally grow in a high-salt environment, and is suitable for a fermentation system of soy sauce mash. After the strain is added in the first middle stage of soy sauce mash fermentation, the aroma of fermented crude oil is remarkably enhanced, the content of various aroma components such as 3-methylthio propanol, HDMF, ethyl acetate and guaiacol in the crude oil can be increased, the aroma of the crude oil is richer, and the sauce aroma is prominent. Therefore, the quality of the soy sauce can be better improved by adding the candida angustifolia ZB437 in the fermentation process.

Description

Technical Field

[0001] The present application relates to the technical field of microbial fermentation, and in particular to a Candida etschuenensis ZB437 and an application thereof, and specifically to a flavor-enhancing and salt-tolerant Candida etschuenensis ZB437 and an application thereof. Background Art

[0002] Soy sauce is a traditional Chinese condiment with a history of more than 3,000 years. It has always been loved by people. With the passage of time, the fermentation process of soy sauce has been continuously developed and improved. With the rapid development of industrialization and intelligence, the quality of soy sauce has also been getting better and better. Color, aroma, taste, and body are four important evaluation indicators of soy sauce. Nowadays, the soy sauce on the market has reached a good level in color, taste, and body, but there is still a lot of room for improvement in the development of soy sauce aroma. With the improvement of consumption levels, the aroma of soy sauce has also become a key issue of concern to consumers, and it is also an important direction for producers to improve the quality of soy sauce. How to improve the aroma by improving the soy sauce production process has become a key research issue in the industry.

[0003] At present, according to literature reports, the methods for improving the aroma of soy sauce mainly include the following ways: 1. The aroma of soy sauce is enhanced by adding additional raw materials during the soy sauce mixing process. For example, patent publication number CN 115530354A discloses a method of adding a variety of mushrooms such as Agrocybe aegerita, Hericium erinaceus, Lentinus edodes, Pleurotus eryngii, etc. to the original soy sauce juice, and finally obtaining a flavor-enhanced soy sauce through heat preservation and sterilization, filtration, and filling. The soy sauce has a unique flavor of mushrooms and enhances the aroma of the soy sauce. However, while this method introduces the aroma of mushrooms, the soluble components therein will also significantly change the taste of the soy sauce, so it is not suitable for mature products. 2. The aroma of soy sauce is improved by enhancing the degree of Maillard reaction during the fermentation of mash. For example, patent publication number CN114343162 discloses a method for improving the aroma of soy sauce, in which sucrose hydrolyzate is added to the fermentation system, and the temperature of the entire fermentation process is controlled at 40-45°C. The Maillard reaction between reducing sugars and amino acids is enhanced during the fermentation process to enhance the comprehensive aroma of soy sauce. However, the aroma enhanced by this method is mainly burnt aroma and sweet aroma, which are relatively weak in volatility and are not obvious enough for the overall aroma enhancement of soy sauce. At the same time, the Maillard reaction has the risks of deepening color, strengthening bitterness, and decreasing amino acid nitrogen. 3. The aroma of fermented crude oil is enhanced by adding salt-tolerant microorganisms during the fermentation of mash. The addition of microbial fermentation was originally used in the Japanese soy sauce process. Now domestic companies are also gradually adding corresponding microorganisms to improve the quality of soy sauce. Among the salt-tolerant microorganisms used to enhance aroma, salt-tolerant yeast is the most commonly used. For example, patent publication number CN 110305803B discloses a Debaryomyces hansenii RRJ-JM-2, which can be used to enhance the content of alcohols and esters such as phenylethanol, isoamyl acetate, ethyl palmitoleate, and phenylethyl acetate in the aroma components of soy sauce. For example, patent publication number CN114507610B discloses a brewer's yeast that produces sauce aroma. Adding the yeast during the fermentation of sauce mash can effectively enhance the aroma of soy sauce, and the strain reproduces quickly and produces ethanol quickly in a high-salt environment.

[0004] Although the above method can enhance the aroma of soy sauce, there are shortcomings: 1. Adding additional raw materials to crude oil will make the raw material processing process more complicated, increase the product label, and bring a special aroma to the crude oil while also bringing uncontrollable ingredients, which will change the taste of the soy sauce and is not suitable for improving the overall flavor of the soy sauce. 2. The Maillard reaction in the fermentation process of the enhanced soy mash requires a higher temperature than normal fermentation, which will cause the color of the crude oil to be darker, and the aroma will be accompanied by a burnt smell, making the aroma less natural, and there are risks such as deepening of color, increasing bitterness, and decreasing amino acid nitrogen. 3. The aroma of soy sauce can be effectively enhanced by adding salt-tolerant flavoring yeast during the fermentation process, but the added yeast often increases the content of one or several types of aroma components, and the enhanced aroma is relatively single and the degree of enhancement is insufficient. Summary of the invention

[0005] The purpose of the present application is to overcome the shortcomings of the above-mentioned prior art and provide a Candida echinoceras ZB437 and its application. The present application obtains a strain of Candida echinoceras with significant flavor enhancement effect by screening from soy sauce mash. Adding it to fermented soy sauce mash for fermentation can significantly increase the content of the main aroma components in soy sauce, thereby significantly improving the aroma of soy sauce on the original basis.

[0006] To achieve the above purpose, the technical solution adopted by this application is:

[0007] The present application provides a Candida etchellsii ZB437, which has been deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 29, 2021, with a preservation number of GDMCC No: 61753, a classification number of Candida etchellsii, and a preservation address of Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0008] As a preferred embodiment of the Candida etschuenensis ZB437 described in the present application, the 26s rDNA sequence of the Candida etschuenensis ZB437 is shown in SEQ ID NO: 1.

[0009] The present application obtains a strain of Candida etschulensis ZB437 with significant flavor enhancement effect by screening from mash. The strain is suitable for growth in malt juice medium. Colonies appear in malt juice agar medium in about 3 days. The colonies are round in morphology, smooth in surface, milky white in color, and opaque.

[0010] The present application applies the screened Candida echinocipitae ZB437 to the soy sauce fermentation process, so that the aroma of the fermented crude oil finally squeezed out is significantly improved, the aroma is more intense, and the quality of the crude oil is comprehensively improved.

[0011] The present application also provides a screening step for the above-mentioned Candida etschie ZB437, comprising:

[0012] The soy sauce mash with good aroma from crude oil is taken for production, and is diluted with sterile physiological saline at different times (10 times, 100 times, 1000 times) and applied to a solid culture medium of malt juice containing 10% sodium chloride, different single colonies are selected from the grown colonies, and the strains of different single colonies are purified 2-3 times by streaking on plates to obtain pure strains respectively; a malt juice liquid culture medium containing 10% sodium chloride is used for expansion culture, and the cultured bacterial liquid is added to the soy sauce crude oil at a ratio of 1% for further fermentation, and the strain with the best aroma enhancement effect is selected through sensory evaluation to obtain Candida echeveria ZB437.

[0013] Preferably, the formula of the solid malt extract culture medium is: 13% malt extract powder, 1.5% agar, 0.1‰ chloramphenicol; the formula of the liquid malt extract culture medium is: 13% malt extract powder, 0.1‰ chloramphenicol.

[0014] The present application also provides the use of the above-mentioned Candida etschulensis ZB437 in the fermentation of preparing condiments.

[0015] As a preferred embodiment of the application described in the present application, the condiment is soy sauce or sauce.

[0016] As a preferred embodiment of the application described in the present application, the soy sauce includes salt-tolerant soy sauce, and the salt concentration in the salt-tolerant soy sauce is 4% to 16%.

[0017] The present application also provides the use of the above-mentioned Candida etschulensis ZB437 in improving the aroma content of fermented soy sauce.

[0018] As a preferred embodiment of the application described in the present application, the aroma components include at least one of 3-methylthiopropanol, furanone HDMF, ethyl acetate and guaiacol.

[0019] In the present application, the screened Candida albicans ZB437 is added to the sauce mash for fermentation. The crude oil obtained after maturity has a significant improvement in aroma. The aroma is richer than that of the control crude oil without adding yeast, and the ester aroma and sauce aroma are enhanced to a certain extent.

[0020] By testing the aroma components of crude oil, it was found that adding Candida echinocarbazine ZB437 can enrich the overall flavor components and significantly increase the content of some important aroma components, among which the content of 3-methylthiopropanol increased by 20 times, the content of furanone HDMF increased by 4 times, the content of ethyl acetate increased by 3.6 times, and the content of guaiacol increased by 6 times. Therefore, adding Candida echinocarbazine ZB437 can further improve the quality of soy sauce crude oil.

[0021] The present application also provides a method for preparing a condiment, using the above-mentioned Candida etschulensis ZB437 as a fermentation bacterium.

[0022] The present application also provides a soy sauce or paste, which is prepared by using the above-mentioned Candida etschulensis ZB437 as a fermentation bacterium.

[0023] Through experiments, it can be known that after fermentation with the addition of the present application's Candida echeveria ZB437, except for an increase in total acid and a decrease in reducing sugar, there are no significant differences in other indicators, indicating that the addition of Candida echeveria ZB437 fermentation does not affect important indicators such as ammonia nitrogen, total nitrogen, and glutamic acid in crude oil, and can be used for fermentation of sauce mash to study its effect on the aroma of crude oil. In addition, the aroma components of the fermented crude oil with the addition of the present application's Candida echeveria ZB437, including alcohols, ketones, esters, phenols, and acids, have all been significantly increased, among which the most obvious increase is in alcohols. Overall, the aroma component content of crude oil increased after the addition of Candida echeveria ZB437 fermentation, making the aroma components more intense and rich.

[0024] Compared with crude oil fermented without yeast, crude oil fermented with Candida escheyenne ZB437 has obvious sensory differences, mainly reflected in aroma, umami, and richness. The aroma of crude oil fermented with Candida escheyenne ZB437 is significantly better than that of crude oil fermented without yeast.

[0025] According to the comprehensive evaluation results, the aroma of crude oil fermented with Candida echeveria ZB437 is more intense and rich, and the aroma is significantly improved compared with crude oil fermented without yeast. In terms of taste, the crude oil fermented with Candida echeveria ZB437 has better umami taste, richer flavor, and longer mouthfeel. Based on the above flavor indicators, the aroma and overall taste of crude oil fermented with Candida echeveria ZB437 are better, so adding Candida echeveria ZB437 fermentation can significantly improve the flavor of crude oil.

[0026] Compared with the prior art, this application has the following beneficial effects:

[0027] The present application provides a strain of Candida echeveria ZB437 and its application. The present application screens a strain of Candida echeveria ZB437 with significant flavor enhancement effect from soy sauce mash. The strain has good salt tolerance and can grow normally in a high-salt environment, and is suitable for the fermentation system of soy sauce mash. After adding the strain in the early and middle stages of soy sauce mash fermentation, it has a significant enhancement effect on the aroma of the fermented crude oil, and can increase the content of various aroma components such as 3-methylmercaptopropanol, HDMF, ethyl acetate, guaiacol, etc. in the crude oil, making the aroma of the crude oil richer and the sauce aroma more prominent. Therefore, adding Candida echeveria ZB437 in the fermentation process can better improve the quality of soy sauce. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a microscopic examination image of strain No. 5 in Example 1;

[0029] Figure 2 This is the salt tolerance diagram of strain No. 5 in Example 1. DETAILED DESCRIPTION

[0030] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0031] In the following examples and comparative examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified, and the components and raw materials used in each parallel experiment are of the same type.

[0032] The culture medium used in the following examples is as follows:

[0033] The formula of malt extract solid medium is: 13% malt extract powder, 1.5% agar, 0.1‰ chloramphenicol;

[0034] The formula of malt extract liquid culture medium is: 13% malt extract powder, 0.1‰ chloramphenicol.

[0035] Example 1: Screening of Candida echinocipitae ZB437

[0036] 1. Target strain screening:

[0037] Take the sauce mash with good aroma in production, dilute it 10 times, 100 times, and 1000 times with sterile physiological saline, and then apply it to the 10% salt malt juice solid culture medium, and culture it in a 30°C incubator for 2-4 days. After the culture is completed, 7 different strains are selected according to the colony morphology and color differences. Then three lines are drawn in a new malt juice solid culture medium, and it is also placed in a 30°C incubator for 2-4 days. After the colony grows, continue to select single colonies and draw three lines in a new malt juice solid culture medium, repeat 1-2 times, and finally obtain pure strains. Observe the morphology of these 7 strains. The growth characteristics and colony morphology of the 7 strains on the culture medium are shown in Table 1.

[0038] Table 1 Comparison of morphology of 7 yeast strains

[0039] Strain No. Colony size Colony morphology 1 Individual size is too large Milky white, round, smooth surface, 2 Smaller Milky white, round, smooth surface 3 Smaller White with a yellowish tint, round in shape, with an uneven surface 4 Individual size is too large White, round, rough surface 5 Smaller individuals Milky white, round, smooth surface 6 Medium White, round, smooth surface 7 Smaller Milky white, round, rough surface

[0040] From the perspective of colony size and morphology, the colonies of these seven strains are all round in shape, but they have certain differences in colony morphology. The colonies of strains 1 and 4 are relatively large, while the colonies of strains 2, 3, 5, and 7 are relatively small. The surface of the colony of strain 4 is obviously rough, which is very different from that of other strains, while the surface morphology of the colonies of strains 1, 2, 5, and 6 is similar, all of which are smooth.

[0041] 2. Screening of strains for aroma enhancement effect:

[0042] The 7 strains were amplified and inoculated into soy sauce crude oil, and the crude oil without yeast was used as the control. All the strains were fermented at 30°C for 10 days. After the fermentation, the aroma of the 7 groups of crude oils was sensory evaluated. The strain with the best aroma enhancement effect was selected based on the evaluation results. The evaluation results are shown in Table 2.

[0043] Table 2 Aroma evaluation results of crude oil fermented with 7 yeast strains

[0044]

[0045] Note: According to the aroma of the 7 groups of crude oils, the crude oils are divided into three categories according to the quality of ester aroma and sauce aroma, where + represents crude oil with medium aroma, ++ represents crude oil with good aroma, and - represents crude oil with poor aroma.

[0046] Table 2 shows that among the 7 screened yeast strains, No. 1 and No. 4 had no effect on improving the aroma of crude oil but instead caused the aroma of crude oil to deteriorate. No. 2, No. 3, No. 6 and No. 7 had a certain effect on improving the aroma of crude oil but the effect was not very significant. No. 5 had a significant effect on improving the aroma of crude oil, and the ester aroma and sauce aroma of its crude oil were better than those of the other 7 groups.

[0047] 3. Microscopic morphology:

[0048] Strain No. 5 was inoculated into malt extract liquid culture medium and cultured on a shaker at 30℃ and 200 rpm for 48 hours. A drop of culture solution was added to a glass slide, covered with a cover slip, and colony morphology was detected using a microscope. The magnification of the microscope eyepiece was 10 times and the magnification of the objective lens was 100 times. The results are shown in Figure 1 .

[0049] like Figure 1 As shown, from the microscopic examination results, the cell morphology of strain No. 5 is oval, and the sizes of each cell are generally similar.

[0050] 4. Salt resistance test:

[0051] Prepare malt extract liquid culture medium with salt content of 4%, 8%, 12%, 16% and 20% respectively, and inoculate 10 6 The number of yeasts was detected at different time points. The results are shown in Table 1. Figure 2 .

[0052] Depend on Figure 2 It can be seen that the selected yeast strain ZB437 has strong salt tolerance and can grow in 4%-16% salt. The number of yeast in this salt range reaches 10 9 / mL, showing strong reproductive ability, while the yeast could not grow normally in a 20% salt system. The salt tolerance of this strain is just suitable for the fermentation system of high-salt dilute mash. It can grow and metabolize normally during the fermentation process of mash, providing a guarantee for the subsequent improvement of soy sauce aroma.

[0053] 5. Gene identification of yeast strain ZB437:

[0054] The culture fluid of the yeast strain ZB437 was cultured in malt extract liquid medium, and the yeast genome was extracted using the Ezup column yeast genomic DNA extraction kit (Shanghai Biotech). After the genome was extracted, it was sent to Biotech Biotechnology (Shanghai) Co., Ltd. for sequencing. The sequencing used universal primers NL1 (GCATATCAATAAGCGGAGGAAAAG) and NL4 (GGTCCGTGTTTCAAGACGG). The 26s rDNA sequencing results of the yeast strain ZB437 are as follows:

[0055] CAAGACGGGTGATAGACCACCATTTAGTAGAGCCTGAGGTCCTCGCGCCC

[0056] GGATGGGAATATTGACTGAAGTTATAATTCCCTAAAAGAGATACATTCTT

[0057] CAGCTTTTTGTCTTCCCCCCAAACACGGCTCTACATTGTTTAGCGGCATATCC

[0058] TTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTT

[0059] CATCTTTCCTTCACAGTACTTGTTCGCTATCGGTCTCTCACAGATATTTAG

[0060] CTTTAGATGGAGCATACCACCCTTTTGAGCTGCATTCCCAAACAACTCGA

[0061] CTCCACGTCAGAATCCTACAATGAGTGAGGTGTCGTACGGGGCTATCACC

[0062] CTCCATGGCGCTCCTTTCCAGAAGACTTAAACACCGATACTCAGGAAACT

[0063] GACTTCAGAATACAATGCCAAAAAGGCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTT (shown in SEQ ID NO: 1).

[0064] The sequencing results were compared by BLAST on the NCBI database. The results showed that the yeast strain ZB437 of the present application had the highest homology with Candida etchellsii. Therefore, the yeast strain ZB437 was Candida etchellsii.

[0065] The above-mentioned strain was preserved and named Candida etchellsii ZB437. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 29, 2021, with the preservation number GDMCC No: 61753, the classification number Candida etchellsii, and the preservation address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0066] Example 2: Effects of Candida echinocipitae ZB437 on conventional physical and chemical parameters of soy sauce

[0067] The screened Candida etschulensis ZB437 was inoculated into fermented mash to study its effect on the fermentation of mash.

[0068] The specific operation is as follows: first, inoculate 0.2% of Candida albicans ZB437 into the malt juice liquid culture medium, shake and culture at 200rpm for 45-50h, then inoculate the bacterial liquid into the soy sauce mash fermented for 25 days, continue fermenting at 30°C, and detect the physical and chemical indicators and aroma components of the fermented crude oil after the fermentation of the soy sauce mash expires.

[0069] The physical and chemical indicators of fermented crude oil are shown in Table 3.

[0070] Table 3 Physical and chemical indicators of fermented crude oil

[0071]

[0072] As shown in Table 3, except for the increase in total acid and the decrease in reducing sugar, there was no significant difference in other indicators of the fermented crude oil after adding Candida echeveria ZB437. The addition of Candida echeveria ZB437 to the fermentation did not affect important indicators such as ammonia nitrogen, total nitrogen, and glutamic acid in the crude oil, and it can be used to study its effect on the aroma of crude oil in sauce and mash fermentation.

[0073] Example 3: Effect of Candida echinocipitae ZB437 on the aroma of soy sauce

[0074] Candida echeveria ZB437 was added to the mash according to the process of Example 2 and continued to ferment. After the expiration, the aroma components of the crude oil were detected using solid phase microextraction and gas chromatography-mass spectrometry. The corresponding detection condition parameters were as follows:

[0075] 1. Headspace-solid phase microextraction (HS-SPME) conditions:

[0076] First, the extraction fiber head of the solid phase microextraction was aged at the injection port of the gas chromatography, the aging temperature was 250℃, and the aging time was 1h. Weigh 5g of sample into the headspace bottle, add 100ul of the internal standard substance 2-methyl-3-heptanone, the concentration was 1.475mg / L, seal and balance, insert it into the SPME extraction head (material: medium polarity 50 / 30um DVB / CAR / PDMS) and extract at 60℃ for 30min. Keep shaking during the extraction process. After the extraction is completed, desorb at the GC injection port (250℃) for 20min. During the sample preparation process, the extraction head is aged at the injection port temperature for 10min between two samples.

[0077] 2. GC-MS measurement conditions

[0078] HP-INNOWAX elastic quartz capillary chromatography column (60m*0.25mm*0.25um) was used, the carrier gas was high-purity helium (1.2mL / min), the electron impact ionization (EI) ion source was used, the electron energy was 70eV, and the ion source temperature was 250°C. The program temperature conditions were: the starting temperature was 40°C, maintained for 5min, increased to 240°C at 5°C / min, maintained for 15min, and the non-divided flow mode was used.

[0079] The test results are shown in Table 4 below:

[0080] Table 4 Aroma component content of fermented crude oil (unit: ppb)

[0081]

[0082] Table 5 Key aroma components of fermented crude oil (unit: ppb)

[0083] Substance name No yeast added Add ZB437 3-Methylthiopropanol 2.86 60.33 2-Methylbutyraldehyde 16.53 7.18 Benzaldehyde 22.12 11.57 HDMF 0.33 1.73 Ethyl acetate 6.46 29.88 Isoamyl acetate 0 6.77 Guaiacol 0.8 5.71 Maltol 1.73 6.98 Acetic acid 28.72 47.34

[0084] As shown in Table 4, there is a certain difference in the aroma component content between the crude oil fermented with Candida echinocarpa ZB437 and the crude oil fermented without yeast. The aroma components of the crude oil fermented with Candida echinocarpa ZB437 have been significantly increased in alcohols, ketones, esters, phenols and acids, among which the most obvious increase is in alcohols, but the content of aldehyde aroma components has decreased. Overall, the aroma component content of the crude oil fermented with Candida echinocarpa ZB437 increases, making the aroma components more intense and rich.

[0085] As shown in Table 5, among some key aroma components of soy sauce, the content of 3-methylmercaptopropanol in crude oil fermented with Candida echeveria ZB437 increased significantly, 20 times higher than that of crude oil fermented without yeast. 3-methylmercaptopropanol has a meaty flavor and is one of the important sources of aroma in soy sauce. Among the aldehydes in crude oil fermented with Candida echeveria ZB437, the contents of 2-methylbutanal and benzaldehyde were lower than those of crude oil fermented without yeast. 2-methylbutanal has a suffocating odor, and after dilution, it has cocoa, coffee, and a slight fruity aroma. Benzaldehyde has an almond aroma, indicating that the addition of Candida echeveria ZB437 to fermentation in soy sauce mash will weaken the aroma of aldehydes in crude oil to a certain extent. The content of HDMF (4-hydroxy-2,5-dimethyl 3(2H)-furanone) in ketone substances has increased significantly. HDMF has a caramel aroma and is a characteristic aroma component in soy sauce. The HDMF content in crude oil fermented with Candida escherii ZB437 increased by 4 times compared with the crude oil in the control group without addition, making the caramel aroma of the crude oil more prominent. Ester aroma is one of the important aroma types in soy sauce, and together with other aromas such as soy sauce aroma, it constitutes the rich aroma of soy sauce.

[0086] Analysis found that the contents of some key esters such as ethyl acetate and isoamyl acetate in the fermented crude oil with the addition of Candida escheyenne ZB437 were significantly increased. These ester substances can give soy sauce fruity and sweet aromas.

[0087] The contents of some phenolic substances such as guaiacol and maltol in the fermented crude oil added with Candida escheyenne ZB437 were significantly increased, among which the content of guaiacol increased by 6 times. Guaiacol has a smoky flavor and is a key aroma component in soy sauce. The content of maltol increased by 3 times. Maltol has a typical caramel flavor. The increase in the content of this type of substance is of great significance to the improvement of the aroma of soy sauce.

[0088] Example 4: Effect of Candida echinocipitae ZB437 on the sensory effects of soy sauce

[0089] The crude oil obtained by fermentation with Candida escheyenne ZB437 and the crude oil obtained by fermentation without yeast were compared in sensory evaluation. 15 people with sensory evaluation experience participated in the sensory evaluation. The evaluation score ranged from 0 to 5 points, and the results were expressed as the average score. The higher the score, the better the flavor.

[0090] The evaluation results are shown in Table 6.

[0091] Table 6 Sensory evaluation results of fermented crude oil

[0092]

[0093]

[0094] As shown in Table 6, there are obvious differences in sensory perception between the crude oil fermented with Candida escheyenne ZB437 and the crude oil fermented without yeast, mainly in terms of aroma, umami and body.

[0095] The aroma of crude oil fermented with Candida echeveria ZB437 is significantly better than that of crude oil fermented without yeast. According to the comprehensive evaluation results, the aroma of crude oil fermented with Candida echeveria ZB437 is more intense and rich, and has been significantly improved compared with crude oil fermented without yeast. In terms of taste, crude oil fermented with Candida echeveria ZB437 has better umami taste, richer flavor, and longer lingering taste.

[0096] Based on the above flavor indicators, the aroma and overall taste of crude oil after fermentation with Candida etschuenensis ZB437 are better. Therefore, adding Candida etschuenensis ZB437 to ferment can significantly improve the flavor of crude oil.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.

Claims

1. A Candida etchiensis ZB437, characterized in that The Candida albicans ZB437 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 29, 2021, with the deposit number GDMCC No: 61753, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The Candida etschurensis ZB437 according to claim 1, characterized in that The 26s rDNA sequence of Candida etschurensis ZB437 is shown in SEQ ID NO:

1.

3. Use of the Candida etschulensis ZB437 according to claim 1 or 2 in the fermentation of preparing condiments.

4. The use according to claim 3, characterized in that The condiment is soy sauce or paste.

5. The use according to claim 1, characterized in that The soy sauce comprises salt-tolerant soy sauce, and the salt concentration of the salt-tolerant soy sauce is 4% to 16%.

6. Use of the Candida etschie ZB437 according to claim 1 or 2 in improving the aroma content of fermented soy sauce.

7. The use according to claim 6, characterized in that The aroma components include at least one of 3-methylthiopropanol, furanone HDMF, ethyl acetate and guaiacol.

8. A method for preparing a condiment, characterized in that: The Candida etschulensis ZB437 as claimed in claim 1 or 2 is used as the fermentation bacteria.

9. A soy sauce or paste, characterized in that: The soy sauce or paste is prepared by using the Candida etschulensis ZB437 as claimed in claim 1 or 2 as a fermentation bacterium.

Images