Nucleotide sequence for improving activity of CAR-T (chimeric antigen receptor T) cells and application of nucleotide sequence

Abstract

The invention relates to the technical field of biomedicine, in particular to a nucleotide sequence for improving CAR-T cell activity and application of the nucleotide sequence. A recombinant vector is provided, the recombinant vector takes a pLenti-EF1A-cas9-Puro vector as a basic vector, an optimized CAR sequence as shown in Seq. No.1 is used for replacing a Cas9 expression sequence in the basic vector, a U6 promoter as shown in Seq. No.2 and shRNA as shown in Seq. No.3 are inserted into the upstream position of WPRE, and the Cas9 expression sequence in the basic vector is replaced with an optimized CAR sequence as shown in Seq. The obtained CAR-T cell containing the recombinant vector has a stronger killing effect on tumor cells, has better activity and is more beneficial to wide application.

Description

Technical Field

[0001] The present application belongs to the field of biomedical technology, and in particular, relates to a nucleotide sequence for improving the activity of CAR-T cells and its application. Background Art

[0002] CAR-T cell therapy has attracted widespread attention for its highly effective anti-tumor activity, but in clinical applications, the activity and persistence of CAR-T cells are still limited by individual differences, tumor microenvironment, and T cells themselves. Improving the activity of CAR-T cells and increasing their proliferation ability and persistence during the killing process are crucial to improving the therapeutic effect.

[0003] IRF4 (interferon regulatory factor 4) is a transcription factor that plays a key role in the development, function and fate of T cells. Studies have found that the expression level of IRF4 is directly related to the activity, proliferation and cytokine secretion of T cells. High expression of IRF4 may cause CAR-T cells to lose function in the tumor microenvironment and affect their anti-tumor ability.

[0004] Therefore, there is an urgent need to provide a nucleotide that effectively interferes with IRF4 to jointly reduce the inhibitory effect of tumor cells during the killing process of CAR-T. Summary of the invention

[0005] The purpose of the present application is to provide a nucleotide sequence for improving the activity of CAR-T cells and its application, aiming to solve the problem that there is no nucleotide in the prior art that effectively interferes with IRF4 and can be used to jointly reduce the inhibitory effect of tumor cells during the killing process of CAR-T.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In the first aspect, the present application provides a recombinant vector, which uses the pLenti-EF1A-cas9-Puro vector as a basic vector, replaces the Cas9 expression sequence in the basic vector with the optimized CAR sequence shown in Seq.No.1, and then inserts the U6 promoter shown in Seq.No.2 and the shRNA shown in Seq.No.3 into the upstream position of WPRE.

[0008] In a second aspect, the present application provides the use of a recombinant vector in improving the activity of CAR-T cells.

[0009] In some embodiments, the application includes the following steps:

[0010] Constructing the above-mentioned recombinant vector;

[0011] The recombinant vector is packaged using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid;

[0012] The lentiviral precipitate containing the recombinant plasmid is mixed and incubated with T cells to obtain CAR-T cells;

[0013] The CAR-T cells are detected.

[0014] In some embodiments, the step of packaging the recombinant plasmid using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid includes: providing an auxiliary plasmid, and mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid;

[0015] Providing 293T cells to be used, and adding the mixed plasmid dropwise into the 293T cells to be used for transfection to obtain a supernatant;

[0016] The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.

[0017] In some embodiments, the auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and PMD2G plasmid is 4:3:2.

[0018] In some embodiments, the step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid further includes: providing a PEI transfection agent, and the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid are evenly mixed, and allowed to stand for 15 to 20 minutes to obtain a mixed plasmid.

[0019] In some embodiments, the 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%.

[0020] In some embodiments, the step of adding the mixed plasmid dropwise to the stand-by 293T cells for transfection to obtain a supernatant includes: adding the mixed plasmid dropwise to the stand-by 293T cells, mixing for 8 to 9 hours, changing the liquid, and then performing transfection for 48 hours to obtain a supernatant.

[0021] In some embodiments, the step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid includes: concentrating the supernatant with a 4-fold lentivirus concentrate at 4°C overnight, and then centrifuging at 4°C and 2000g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.

[0022] In some embodiments, the step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with T cells comprises:

[0023] Peripheral blood mononuclear cells were mixed and incubated with CD3 / CD28 magnetic beads for 30 minutes to remove excess peripheral blood mononuclear cells;

[0024] Resuspend the peripheral blood mononuclear cells bound to the magnetic beads in T cell culture medium to obtain activated T cells;

[0025] The activated T cells are used to infect the lentiviral precipitate containing the recombinant plasmid for 24 to 26 hours, and then washed to obtain CAR-T cells.

[0026] In some embodiments, the step of detecting the CAR-T cells includes performing cell protein detection, cell killing detection, and cell phenotype detection on the CAR-T cells.

[0027] The first aspect of the present application provides a recombinant vector, which uses the pLenti-EF1A-cas9-Puro vector as a basic vector, replaces the Cas9 expression sequence in the basic vector with the optimized CAR sequence as shown in Seq.No.1, and then inserts the U6 promoter as shown in Seq.No.2 and the shRNA as shown in Seq.No.3 into the upstream position of WPRE; wherein, the shRNA mediated by the U6 promoter has the ability to effectively reduce the expression of IRF4 protein; therefore, the obtained CAR-T cells containing the above-mentioned recombinant vector have a stronger killing effect on tumor cells, better activity, and are more conducive to wide application.

[0028] The second aspect of the present application provides an application of the recombinant vector in improving the activity of CAR-T cells; since the provided recombinant vector is the above-mentioned recombinant vector, the shRNA mediated by the U6 promoter in the above-mentioned recombinant vector has the ability to effectively reduce the expression of IRF4 protein; therefore, the provided recombinant vector can effectively improve the activity of CAR-T cells, which is conducive to wide application. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 It is a schematic diagram of the structure of the CAR combined with the interfering RNA vector provided in the examples of the present application.

[0031] Figure 2 It is the CAR expression efficiency of the CAR control group and the CAR interference group provided in the examples of the present application.

[0032] Figure 3 The protein immunoblotting technology provided in the examples of the present application is used to detect the target protein and the internal reference protein.

[0033] Figure 4 The LDH activity of the culture supernatant was detected after the CAR control group and the CAR interference group provided in the examples of the present application were co-cultured with the tumor.

[0034] Figure 5 This is the flow cytometry detection result of the depletion molecule TIM3 and CAR after the CAR control group and the CAR interference group provided in the embodiment of the present application were co-cultured with the tumor.

[0035] Figure 6 This is the flow cytometry result of depletion molecules PD1 and CAR after the CAR control group and CAR interference group provided in the examples of the present application were co-cultured with tumors. DETAILED DESCRIPTION

[0036] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0037] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0038] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0039] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0040] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0041] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.

[0042] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0043] In a first aspect of an embodiment of the present application, a recombinant vector is provided, wherein the recombinant vector is based on the pLenti-EF1A-cas9-Puro vector, the Cas9 expression sequence in the basic vector is replaced by the optimized CAR sequence as shown in Seq.No.1, and the U6 promoter as shown in Seq.No.2 and the shRNA as shown in Seq.No.3 are inserted into the upstream position of WPRE.

[0044] The recombinant vector provided in the first aspect of the embodiment of the present application is based on the pLenti-EF1A-cas9-Puro vector, and the optimized CAR sequence as shown in Seq.No.1 replaces the Cas9 expression sequence in the basic vector, and then the U6 promoter as shown in Seq.No.2 and the shRNA as shown in Seq.No.3 are inserted into the upstream position of WPRE; wherein, the shRNA mediated by the U6 promoter has the ability to effectively reduce the expression of IRF4 protein; therefore, the obtained CAR-T cells containing the above-mentioned recombinant vector have a stronger killing effect on tumor cells, better activity, and are more conducive to wide application.

[0045] In some embodiments, the optimized CAR sequence shown in Seq.No.1 is as follows:

[0046]

[0047] In some embodiments, the U6 promoter sequence shown in Seq.No.2 is as follows:

[0048] gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgac tgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgtttta aaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaac.

[0049] In some embodiments, the shRNA sequence as shown in Seq. No. 3 is as follows: GCCATTCCTCTATTCAAGAATCTCGAGATTCTTGAATAGAGGAATGGC.

[0050] The second aspect of the embodiments of the present application provides the use of a recombinant vector in improving the activity of CAR-T cells.

[0051] The second aspect of the embodiment of the present application provides an application of the recombinant vector in improving the activity of CAR-T cells; since the provided recombinant vector is the above-mentioned recombinant vector, the shRNA mediated by the U6 promoter in the above-mentioned recombinant vector has the ability to effectively reduce the expression of IRF4 protein; therefore, the provided recombinant vector can effectively improve the activity of CAR-T cells, which is conducive to wide application.

[0052] In some embodiments, the application includes the following steps:

[0053] Constructing the above-mentioned recombinant vector;

[0054] The recombinant vector is packaged using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid;

[0055] The lentiviral precipitate containing the recombinant plasmid is mixed and incubated with T cells to obtain CAR-T cells;

[0056] The CAR-T cells are detected.

[0057] In some embodiments, the step of packaging the recombinant plasmid using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid includes: providing an auxiliary plasmid, and mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid;

[0058] Providing 293T cells to be used, and adding the mixed plasmid dropwise into the 293T cells to be used for transfection to obtain a supernatant;

[0059] The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.

[0060] In some embodiments, the auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and PMD2G plasmid is 4:3:2.

[0061] In some embodiments, the step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid further includes: providing a PEI transfection agent, and the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid are evenly mixed, and allowed to stand for 15 to 20 minutes to obtain a mixed plasmid.

[0062] In some embodiments, the 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%.

[0063] In some embodiments, the step of adding the mixed plasmid dropwise to the stand-by 293T cells for transfection to obtain a supernatant includes: adding the mixed plasmid dropwise to the stand-by 293T cells, mixing for 8 to 9 hours, changing the liquid, and then performing transfection for 48 hours to obtain a supernatant.

[0064] In some embodiments, the step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid includes: concentrating the supernatant with a 4-fold lentivirus concentrate at 4°C overnight, and then centrifuging at 4°C and 2000g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.

[0065] In some embodiments, the step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with T cells comprises:

[0066] Peripheral blood mononuclear cells were mixed and incubated with CD3 / CD28 magnetic beads for 30 minutes to remove excess peripheral blood mononuclear cells;

[0067] Resuspend the peripheral blood mononuclear cells bound to the magnetic beads in T cell culture medium to obtain activated T cells;

[0068] The activated T cells are used to infect the lentiviral precipitate containing the recombinant plasmid for 24 to 26 hours, and then washed to obtain CAR-T cells.

[0069] In some embodiments, the step of detecting the CAR-T cells includes performing cell protein detection, cell killing detection, and cell phenotype detection on the CAR-T cells.

[0070] The following describes the invention in conjunction with specific embodiments.

[0071] Example 1

[0072] Experimental procedures

[0073] 1. Vector design: Clone the optimized CAR sequence (sequence 1) into the pLenti-EF1A-cas9-Puro vector, replace the Cas9 expression sequence, and insert the U6 promoter (sequence 2) and shRNA (sequence 3) upstream of WPRE, such as Figure 1 shown.

[0074] 2. Lentivirus preparation: 293T cells were cultured to a confluency of 80-90%, and the cells were replaced with fresh culture medium (DMEM complete culture medium: 10% FBS, 1% double antibody). After 1 hour, the auxiliary plasmids (PMD2G and PSPAX) were mixed with pLenti-EF1A-CAR-2A-Puro and pLenti-EF1A-CAR-2A-Puro-U6-shRNA main plasmids at a ratio of 4:3:2 (main plasmid: PSPAX: PMD2G), and 3 times the mass ratio of PEI was added. After mixing, the mixture was allowed to stand for 15 minutes, and DNA / PEI was added dropwise to the cells. After 8 hours, the medium was changed, and the supernatant was harvested 48 hours after transfection. The supernatant was concentrated overnight at 4°C using 4X lentivirus concentrate, and the virus precipitate was obtained by centrifugation (2000g, 30 minutes, 4°C). It was resuspended in PBS and stored in aliquots at -80°C.

[0075] 3. CAR-T preparation: Peripheral blood mononuclear cells were incubated with CD3 / CD28 magnetic beads (purchased from Life,) for 30 minutes, and the cells were enriched using a magnetic rack, unbound cells were removed, enriched cells were collected, and cells were counted. The cells were resuspended in T cell culture medium (1640 complete culture medium + 200U / ml IL2). After 2 days of co-culture of magnetic beads and cells, the activated T cells were infected with lentivirus at an MOI of about 2. After 24 hours of infection, the virus was washed away and the cells were continued to be cultured; CAR expression efficiency was detected for 48 hours: 5×10 5 The cells were incubated with 1 ug protein L biotin (purchased from Genescript) at room temperature for 30 minutes, washed once with PBS, and then incubated with 1 ul / reaction APC-strep (purchased from Biolegend) at room temperature in the dark for 30 minutes. After washing once, the expression of CAR was detected by the instrument.

[0076] 4. Cell protein detection: T cells infected with lentivirus were collected, and the cells were lysed with protein lysis buffer, placed on ice for 30 minutes, centrifuged at the highest speed, and the supernatant was transferred to a new EP tube. The protein concentration was detected using the BCA method. 5X loading buffer was added to the supernatant, and the cells were placed in a 100°C metal bath for denaturation for 5 minutes, and 20ul of sample was loaded; after PAGE gel sample separation, the protein was transferred to the NC membrane (100V, 90 minutes), blocked with 5% skim milk for 30 minutes, incubated with primary antibody at 4°C overnight, washed with TBST 3 times for 5 minutes each the next day, incubated with secondary antibody, incubated at room temperature for 2 hours, washed with TBST 3 times for 5 minutes each, developed with developer and fixer (purchased from BioRad), and detected with a small molecule imager.

[0077] 6. Cell killing detection: CAR-T and A549-CP cells were harvested and counted respectively. The cells were inoculated at a ratio of 3:1 and 5:1 for T cells and tumor cells respectively. After culturing for 24 and 48 hours respectively, the supernatant of the cell culture fluid was taken and the LDH activity detection kit (purchased from Beyotime) was used for detection according to the instructions of the kit.

[0078] 7. Analysis of cell phenotype by flow cytometry: After co-culture of tumor cells and CAR-T cells for 48 hours, the cells were harvested, stained, and incubated with protein L-Bio (purchased from GeneScript) at room temperature for 30 minutes. After washing once with PBS, CD3 antibody (purchased from BD), PD1 antibody (purchased from BD), TIM3 antibody (purchased from BD), and APC-Strevp (purchased from Biolegend) were used for incubation in the dark. After 30 minutes, the unbound antibodies were washed away, and the cells were resuspended for analysis.

[0079] Results and data

[0080] First, we cloned the shRNA into the pLenti-U6-backbone-EF1a-CAR-P2A-puro vector. Figure 1 As shown in FIG. 1 , the CAR co-expression plasmid containing shRNA was transfected into 293T cells to produce lentiviral particles. After infecting T cells, the expression efficiency of CAR was detected. Figure 2 ; The knockdown efficiency of the target gene was detected by Western blotting (see Figure 3 ), and found that U6 promoter-mediated shRNA has the ability to effectively reduce the expression of IRF4 protein; further, we used IRF4-interfered CAR-T cells to perform killing experiments, such as Figure 4As shown in Figure 2, it was found that the cells in the CAR-T interference group had a stronger killing effect on tumor cells. We performed flow cytometry on ACR-T cells (such as Figure 5 and Figure 6 ) and found that during the killing process, the inhibitory molecules (PD1, TIM3) on the surface of T cells in the CAR-T interference group were significantly reduced, indicating that interfering with the nucleotide sequence of IRF4 can effectively inhibit the exhaustion of CAR-T cells and enhance the effect of killing tumors.

[0081] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A recombinant vector, characterized in that: The recombinant vector is based on the pLenti-EF1A-cas9-Puro vector, and the optimized CAR sequence shown in Seq. No. 1 replaces the Cas9 expression sequence in the basic vector, and then the U6 promoter shown in Seq. No. 2 and the shRNA shown in Seq. No. 3 are inserted into the upstream position of WPRE.

2. Use of the recombinant vector according to claim 1 in improving the activity of CAR-T cells.

3. The use according to claim 2, characterized in that: The application comprises the following steps: Constructing the recombinant vector according to claim 1; The recombinant vector is packaged using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid; The lentiviral precipitate containing the recombinant plasmid is mixed and incubated with T cells to obtain CAR-T cells; The CAR-T cells are detected.

4. The use according to claim 3, characterized in that: The step of using a lentivirus to package the recombinant plasmid to obtain a lentivirus precipitate containing the recombinant plasmid includes: providing an auxiliary plasmid, and mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid; Providing 293T cells to be used, and adding the mixed plasmid dropwise into the 293T cells to be used for transfection to obtain a supernatant; The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.

5. The use according to claim 4, characterized in that: The auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and PMD2G plasmid is 4:3:2; and / or, The step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid also includes: providing a PEI transfection agent, wherein the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid are evenly mixed, and allowed to stand for 15 to 20 minutes to obtain a mixed plasmid.

6. The use according to claim 4, characterized in that: The 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%; and / or, The step of adding the mixed plasmid dropwise to the standby 293T cells for transfection treatment to obtain a supernatant includes: adding the mixed plasmid dropwise to the standby 293T cells for mixing treatment for 8 to 9 hours, changing the solution, and then performing transfection treatment for 48 hours to obtain a supernatant.

7. The use according to claim 4, characterized in that: The step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid comprises: concentrating the supernatant with a 4-fold lentivirus concentrate at 4° C. overnight, and then centrifuging at 4° C. and 2000 g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.

8. The use according to claim 3, characterized in that: The step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with T cells comprises: Peripheral blood mononuclear cells were mixed and incubated with CD3 / CD28 magnetic beads for 30 minutes to remove excess peripheral blood mononuclear cells; Resuspend the peripheral blood mononuclear cells bound to the magnetic beads in T cell culture medium to obtain activated T cells; The activated T cells are used to infect the lentiviral precipitate containing the recombinant plasmid for 24 to 26 hours, and then washed to obtain CAR-T cells.

9. The use according to claim 3, characterized in that: The step of detecting the CAR-T cells includes performing cell protein detection, cell killing detection, and cell phenotype detection on the CAR-T cells.

Images