Preparation method of universal CEA-CART cell preparation

Abstract

The present invention belongs to the field of genetic engineering technology, and in particular to a method for preparing a universal CEA-CART cell preparation. Construction of RFX5 gene CRISPR / Cas9 knockout vector, construction of Tapbp gene CRISPR / Cas9 knockout vector, construction of MICA gene CRISPR / Cas9 knockout vector, construction of universal iPS cells, induction of universal iPS cells into universal T cells, construction of CEA-CAR lentivirus, and construction of universal CEA-CART cells. The present invention improves the ability of T cells to kill tumor cells with high expression of CEA protein and reduces immune rejection. Cells can be stored and taken for use, can be used for the prevention and treatment of tumors and other diseases, and can provide a reference for the development of similar new cells.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a method for preparing a universal CEA-CART cell preparation. Background Art

[0002] Colorectal cancer (CRC) is a common digestive tract malignancy, the third most common malignancy in the world after lung cancer and breast cancer, and the second leading cause of cancer death. In recent years, with the improvement of people's living standards and changes in lifestyle, the incidence of colon cancer is increasing year by year, and the incidence rate in young people has a rising trend. Therefore, actively carrying out tumor prevention and treatment measures is of great significance to reducing the incidence and mortality of colon cancer.

[0003] Although traditional CRC treatments such as surgery, radiotherapy, chemotherapy, and targeted therapy have shown certain efficacy in the initial treatment, problems such as tumor recurrence and drug resistance have become increasingly prominent as the disease progresses, resulting in limited long-term survival rates for patients. According to clinical statistics in the United States, the 5-year survival rate of CRC patients is approximately 64%, while the survival rate of metastatic CRC patients drops sharply to 12%. Therefore, exploring and optimizing CRC treatment strategies to improve patient prognosis is a hot topic in current research.

[0004] Chimeric Antigen Receptor T-Cell Therapy (CAR-T) is a relatively new type of tumor immunotherapy. It extracts T cells from the patient's own immune system, cultured and modified in vitro, and then injected back into the patient's body, so that they can recognize and attack specific cancer cells to achieve the purpose of treatment. In recent years, CAR-T cell therapy has made breakthrough progress in blood tumors. Currently, 6 CAR-T products have been approved for marketing by the US Food and Drug Administration (FDA), but there are still limitations in solid tumors. The preparation process of CAR-T cells is complex and costly, and has serious side effects such as xenogeneic cell immune rejection, cytokine release syndrome (CRS) and neurotoxicity.

[0005] The application of universal CAR-T therapy in the treatment of CRC still faces many challenges, including the lack of ideal target antigens, physical barriers of the tumor microenvironment (TME), and the intrinsic inhibitory mechanism of T cells, which together limit their effective infiltration and killing ability in tumor tissues. Carcinoembryonic antigen (CEA) is a widely expressed tumor-associated antigen (TAA) in CRC, with a tissue-specific expression rate of up to 98.8%, making it a very potential target for universal CAR-T therapy. Preliminary clinical trials have shown that CEA-CAR-T cells show good tolerability and safety in the treatment of liver and lung metastases in patients with CEA-positive CRC.

[0006] In order to achieve the universality of cells, genome editing methods can be used to modify class I and class II MHC transcription activators or other genes. Eliminating the immunogenicity of class I and class II MHC can eliminate or reduce the immunogenicity of gene-edited cells to CD4+ T cells and CD8+ T cells. However, the lack of class I MHC leads to the inability to activate inhibitory KIR receptors on NK cells, which will enhance the activation of NK cells.

[0007] RFX (Regulatory factor X) is a transcription factor complex, which mainly includes subunits such as RFX5, RFXAP and RFX-B. These subunits work together to give RFX the ability to recognize specific DNA sequences. Among them, the RFX5 subunit plays a key core role in the complex. It contains a DNA binding domain and can directly interact with the target DNA sequence. RFXAP and RFX-B subunits stabilize the structure of the complex by interacting with RFX5 and assist it in performing transcriptional regulation functions. This multi-subunit structure enables RFX to more accurately recognize and bind to specific elements in the gene promoter region, thereby achieving fine regulation of gene transcription.

[0008] RFX can specifically recognize and bind to specific DNA sequences and exert its effects in the promoter regions of class I and class II MHC genes. In the promoter region of class II MHC genes, RFX mainly binds to a specific DNA sequence called the "X box". This X box sequence has a specific nucleotide arrangement pattern and is the main binding site for the RFX complex. RFX binds to the X box with high specificity and affinity, and this binding is the basis for RFX to exert its transcriptional regulatory function. By tightly binding to the X box, RFX provides an "anchor point" for the subsequent binding of other transcription factors (such as CIITA and NF-Y), thereby forming a stable transcription initiation complex together to initiate gene transcription. However, RFX5 has a weak inhibitory expression on class I MHC genes.

[0009] Tapasin protein (Tapbp) is a member of the MHC class I transport complex and its function is to bridge the TAP peptide transporter to the MHC class I molecule. If the Tapbp protein is missing, a structurally complete and active MHC class I molecule cannot be formed on the cell membrane surface. MICA (MHC class I - related chain A) is a protein expressed on the surface of stressed cells. When MICA binds to NKG2D on the surface of NK cells, it transmits activation signals to NK cells. MICA deficiency reduces NK cell activation. Summary of the invention

[0010] The purpose of the present invention is to provide a method for preparing a universal CEA-CART cell preparation. The prepared universal CEA-CART cell preparation lacks MHC class I and class II surface antigens and will not activate allogeneic T cells, thereby greatly reducing the killing of allogeneic T cells to the universal CEA-CART cell preparation. In addition, the universal CEA-CART cell preparation increases the targeting of colorectal cancer cells, solves the problem of continuous production of CART cells, and provides assistance for the future treatment of colorectal cancer and other tumors with high expression of CEA protein.

[0011] The method for preparing the universal CEA-CART cell preparation of the present invention comprises the following steps:

[0012] (1) Construction of CRISPR / Cas9 knockout vector for RFX5 gene:

[0013] Design the gRNA sequence, the gRNA sequence is SEQ ID NO.1, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-RFX5 knockout vector;

[0014] (2) Construction of Tapbp gene CRISPR / Cas9 knockout vector:

[0015] Design the gRNA sequence, the gRNA sequence is SEQ ID NO.2, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-Tapbp knockout vector;

[0016] (3) Construction of CRISPR / Cas9 knockout vector for MICA gene:

[0017] Design the gRNA sequence, the gRNA sequence is SEQ ID NO.3, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-MICA knockout vector;

[0018] (4) Construction of universal iPS cells:

[0019] The pU6gRNA-Cas9-GFP-RFX5 knockout vector was transfected into human iPS cells to obtain RFX5 gene-deficient human iPS cells; the pU6gRNA-Cas9-GFP-Tapbp knockout vector was transfected into RFX5 gene-deficient human iPS cells to obtain RFX5 and Tapbp gene-deficient human iPS cells; the pU6gRNA-Cas9-GFP-MICA knockout vector was transfected into RFX5 and Tapbp gene-deficient human iPS cells to obtain universal iPS cells;

[0020] (5) Induction of universal iPS cells into universal T cells:

[0021] Adding induction agents to universal iPS cells induces them into universal T cells;

[0022] (6) Construction of CEA-CAR lentivirus:

[0023] The CEA-CAR chimeric sequence was cloned into the pMD18-T vector to obtain the pMD18-T-CAR vector; the pSin-EF2-Pur-CAR vector was constructed based on the pMD18-T-CAR vector, and the pSin-EF2-Pur-CAR vector, psPAX2 plasmid and pMD2.G plasmid were mixed and transfected into 293T cells to obtain the CEA-CAR lentivirus;

[0024] (7) Construction of universal CEA-CART cells:

[0025] The CEA-CAR lentivirus infects universal T cells, and universal CEA-CART cells are screened and obtained. After the universal CEA-CART cells are expanded and cultured, universal CEA-CART cell preparations are obtained.

[0026] The inducers in step (5) include bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol, BMP4 (bone morphogenetic protein 4), SCF (Stem Cell Factor), TPO (Thrombopoietin), rhIL-7 (Recombinant human Interleukin-7) and rhFLT-3L (Recombinant human FMS-like Tyrosine Kinase 3 Ligand).

[0027] In step (5), the steps of adding an inducer to the universal iPS cells to induce universal T cells are as follows:

[0028] (a) universal iPS cells were cultured, and on the second day of the universal iPS cell culture, bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol and BMP4 were added to the culture medium and the culture was continued;

[0029] (b) On the 5th day of universal iPS cell culture, BMP4 was removed, SCF was added to the culture medium, and culture continued;

[0030] (c) On the 7th day of universal iPS cell culture, rhFLT-3L and TPO were added to the culture medium and culture was continued;

[0031] (d) On the 14th day of universal iPS cell culture, the universal iPS cells differentiated into hematopoietic progenitor cells, which were collected and co-cultured with OP9-DL1 cells in OP9 cell culture medium containing rhIL-7 and rhFLT-3L. T cells were collected and activated with CD3 antibodies to obtain universal T cells.

[0032] After adding bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol and BMP4 to the culture medium in step (a), the concentration of bFGF in the culture medium is 50 ng / ml, the concentration of VEGF is 50 ng / ml, the concentration of insulin-transferrin-selenium is 100 ng / ml, the concentration of L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate is 50 μg / ml, the concentration of 1-thioglycerol is 100 nmol / L, and the concentration of BMP4 is 40 ng / ml.

[0033] After SCF is added to the culture medium in step (b), the concentration of SCF in the culture medium is 50 ng / ml.

[0034] After rhFLT-3L and TPO are added to the culture medium in step (c), the concentration of rhFLT-3L in the culture medium is 10 ng / ml, and the concentration of TPO in the culture medium is 30 ng / ml.

[0035] In step (d), the concentration of rhIL-7 in the OP9 cell culture medium containing rhIL-7 and rhFLT-3L is 10 ng / ml, and the concentration of rhFLT-3L is 30 ng / ml.

[0036] The CEA-CAR chimeric sequence in step (6) is SEQ ID NO.4.

[0037] The present invention designs a CEA-CAR chimeric sequence targeting the CEA protein and constructs a universal CEA-CART cell. On the one hand, it realizes the mass production of CART cells and solves the problem that the previous cells cannot be universal. On the other hand, it designs a CEA-CAR chimeric sequence for tumors with high expression of CEA protein to achieve specific targeting and provide assistance for tumor treatment.

[0038] Compared with non-universal CEA-CART cells, the universal CEA-CART cell preparation prepared by the present invention has a stronger ability to kill colorectal cancer cells and is easier to enter tumor tissue.

[0039] The present invention designs an efficient and specific CRISPR / Cas9 gene knockout guide primer gRNA sequence to achieve knockout of RFX5, Tapbp and MICA genes in iPS cells, effectively solving the problem of regulating large gene families of MHC class I and II complexes, not only reducing the immunogenicity of CD8+ T cells and CD4+ T cells to universal cells, but also relieving the activation of NK cells by universal cells. The present invention performs gene knockout to construct universal iPS cells from the perspectives of gene expression, protein post-translational modification, etc., establishes a universal cell seed bank, and provides help for the subsequent multidirectional induction differentiation and application of iPS cells.

[0040] The present invention establishes an induced differentiation scheme for inducing iPS cells to generate T cells, realizes the continuous production of T cells, and solves the problem of industrialized production of universal T cells.

[0041] In order to solve the problems of cell universality, targeting of CART cells, and continuous production of T cells, the present invention firstly uses CRISPR / Cas9 gene editing technology to knock out RFX5 and Tapbp genes to transform class I and class II MHC genes respectively, thereby eliminating the cell activation to allogeneic CD4+ T cells and CD8+ T cells; then knocks out the MICA gene to eliminate the cell activation to allogeneic NK cells, thereby constructing universal iPS cells, realizing on-demand use of cells, and solving the problems of cell immunogenicity and heterogeneity. On this basis, an induction scheme for inducing iPS cells into T cells is established to produce universal T cells, and then the CEA-CAR gene is introduced through lentivirus to generate universal CEA-CART cells, so that the obtained universal CEA-CART cells can accurately target tumor cells with high expression of CEA protein and kill tumor cells, thereby increasing the therapeutic efficacy and solving the problems of immunogenicity, heterogeneity, targeting and continuous production of cells. At the same time, the present invention eliminates the immunogenicity of class I and class II MHC by modifying the key genes RFX5 and Tapbp, knocks out MICA to eliminate the activation of NK cells, and eliminates the immune activation of the obtained universal cells to allogeneic T cells and NK cells.

[0042] The present invention screens specific antibodies against CEA protein, and then constructs a CAR sequence targeting CRC tumor cells.

[0043] The present invention prepares allogeneic universal CART cells, the principle of which is to transform T cells after gene editing of induced pluripotent stem cells (iPSC) to reduce the immune rejection reaction of allogeneic T cells. This CART cell not only has a mature immune phenotype, but also has significant cell lytic ability, making it a "ready-made" immunotherapy product, bringing revolutionary changes to treatment.

[0044] Compared with allogeneic wild-type T cells, the universal CEA-CART cells prepared by the present invention have no difference in growth rate, cell senescence and apoptosis, secretion of key functional factors, etc., but have stronger tumor killing ability.

[0045] The beneficial effects of the present invention are as follows:

[0046] (1) The present invention knocks out the RFX5, Tapbp and MICA genes in iPS cells by designing specific gRNA, and constructs universal iPS cells that relieve immune activation to allogeneic T cells and NK cells, and then establishes an induced differentiation scheme to induce iPS cells into T cells; at the same time, CEA-CAR lentivirus is constructed, and then T cells are transfected to obtain universal CEA-CART cells, and their functions are verified at the molecular, cellular and animal levels.

[0047] (2) The present invention improves the ability of T cells to kill tumor cells that highly express CEA protein and reduces immune rejection. The cells can be stored and used at any time, and can be used for the prevention and treatment of tumors and other diseases, and can provide a reference for the development of similar new cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is a schematic diagram of the pU6gRNA-Cas9-GFP-RFX5 knockout vector structure.

[0049] Figure 2 This is the sequencing map of the RFX5 gene in RFX5 gene-deficient human iPS cells.

[0050] Figure 3 This is the sequencing map of the Tapbp gene in RFX5 and Tapbp gene-deficient human iPS cells.

[0051] Figure 4 This is the sequencing map of the MICA gene in universal iPS cells.

[0052] Figure 5 This is a diagram showing the results of universal iPS cell stemness identification analysis.

[0053] Figure 6 This is a diagram of GFP protein expression after CEA-CAR lentivirus packaging. In the figure, A is a cell image under the same microscope field of view and visible light, and B is a GFP green fluorescent protein image.

[0054] Figure 7 This is a graph showing the results of CD8+ T cell detection in the cellular immunogenicity release test.

[0055] Figure 8 This is a graph showing the results of CD4+ T cell detection in the cellular immunogenicity release test.

[0056] Fig. 9 This is a graph showing the NK cell detection results in the cellular immunogenicity relief test.

[0057] Fig.10 This is an experimental comparison chart of colorectal cancer cell SW480 that highly expresses CEA protein.

[0058] Fig.11 This is a graph showing the experimental results of universal CEA-CART cells killing SW480 cells.

[0059] Fig.12 These are fluorescence microscopy images of universal CEA-CART cells and non-universal CEA-CART cells.

[0060] Fig.13 This is a graph of mouse tumor volume detection. DETAILED DESCRIPTION

[0061] The present invention is further described below with reference to the embodiments.

[0062] Example 1

[0063] (1) Construction of gene knockout vector:

[0064] ① Design of gRNA target sequence:

[0065] Design the gRNA target sequence, select the appropriate target sequence (20 bp length) for RFX5, Tapbp and MICA genes, and then chemically synthesize two complementary target sequences (increasing the sticky ends after BbsI digestion).

[0066] The sequence is as follows:

[0067] RFX5 oligo: F 5'-ATAG TCGAGGTGCAGAGAACAGGG -3'

[0068] R 5'-AAATCCCTGTTCTCTGCACCTCGA-3'

[0069] Tapbp oligo:F 5'-ATAG TGGTTCGTGGAGGATGCGAG-3'

[0070] R 5'-AAATCTCGCATCCTCCACGAACCA-3'

[0071] MICA oligo: F 5'-ATAG CACAGTCTTCCGTTATAACCT -3'

[0072] R 5'-AAAT AGGTTATAACGGAAGACTGTG -3'

[0073] ② Construction of knockout vector:

[0074] The pU6gRNA-CMV-Cas9-GFP expression vector was digested with BbsI, recovered, and ligated with the oligo double strands formed by the RFX5 oligo sequence to construct an RFX5 gene knockout vector containing one gRNA, namely, the pU6gRNA-Cas9-GFP-RFX5 knockout vector ( Figure 1 The pU6gRNA-CMV-Cas9-GFP expression vector was digested with BbsI, and then ligated with the oligo double strand formed by the Tapbp oligo sequence to construct a Tapbp gene knockout vector containing one gRNA, namely, the pU6gRNA-Cas9-GFP-Tapbp knockout vector; the pU6gRNA-CMV-Cas9-GFP expression vector was digested with BbsI, and then ligated with the oligo double strand formed by the MICA oligo sequence to construct a MICA gene knockout vector containing one gRNA, namely, the pU6gRNA-Cas9-GFP-MICA knockout vector.

[0075] (2) Construction of universal iPS cells:

[0076] ① The preparation method of human iPS cells, i.e., hiPSC cells, refers to the preparation method of hiPSC cells in Chinese patent CN 114958767A. The pU6gRNA-Cas9-GFP-RFX5 knockout vector was transfected into human iPS cells by electroporation. According to the instructions of Lonza SE Cell Line 4D-Nucleofector X Kit, 1 μg of pU6gRNA-Cas9-GFP-RFX5 knockout vector and 15 μL of SF buffer were added to each electroporation cup, with a final volume of 17 μL. Then, 80 μL of 2×10 5Preheat the culture medium of personal iPS cells and mix gently with a pipette, place at room temperature for 10 minutes and then use the CM-130 program for electroporation. After electroporation, mix gently and transfer to a 10 cm culture plate and place in a CO2 incubator for culture to maximize the formation of monoclonal distribution of cells.

[0077] ② The colonies grown from monoclonal cells were broken up with a 100 μL pipette tip, aspirated, and transferred to a 6-well plate. When the cells grew to 80% confluence in the 6-well plate, iPS cells were digested with Accutase, and a portion was subcultured. At the same time, 1-2×10 6 The genome was extracted from the cell, PCR was performed, the PCR product was recovered and connected to the T vector, and then transformed into E. coli competent cells, and single clones were selected for Sanger sequencing analysis. The results are shown in Figure 2 , iPS cells in which the RFX5 gene mutation sequence in the sequencing cell line is one base less than the RFX5 wild sequence and undergoes a frameshift mutation are selected and cultured to obtain RFX5 gene-deficient human iPS cells.

[0078] ③ Referring to the above two-step experimental operation ① and ②, the pU6gRNA-Cas9-GFP-Tapbp knockout vector was transfected into RFX5 gene-deficient human iPS cells to obtain RFX5 and Tapbp gene-deficient human iPS cells. The Sanger sequencing results are shown in Figure 3 , iPS cells with a frameshift mutation in the Tapbp gene sequence compared to the wild-type Tapbp sequence were selected for expansion and culture; the pU6gRNA-Cas9-GFP-MICA knockout vector was transfected into RFX5 and Tapbp gene-deficient human iPS cells, and the Sanger sequencing results were shown in Figure 4 The iPS cells in which the MICA gene mutation sequence was two bases less than the MICA wild sequence and had a frameshift mutation in the sequencing cell line were selected and expanded for culture. Finally, iPS cells in which the RFX5, Tapbp and MICA genes all had frameshift mutations were obtained and named universal iPS cells.

[0079] ④ Identification of stemness of universal iPS cells. Universal iPS cells were seeded into 24-well plates and cultured at 37°C and 5% CO2. When the cell confluence was above 80%, the culture medium was aspirated and 500µL pre-cooled paraformaldehyde fixative was added for 30 minutes. The fixative was aspirated and the cells were washed 3 times with PBS for 2 minutes each time. The PBS was aspirated and 500µL Triton X-100 permeabilization solution was added to each well for permeabilization at room temperature for 30 minutes. The permeabilization solution was aspirated and 500µL goat serum blocking solution was added to each well for blocking at room temperature for 60 minutes. After the blocking, the blocking solution was removed as much as possible, and the diluted primary antibody Anti-Nanog was added, gently shaken, and incubated at 4°C overnight. After equilibration at room temperature for 30 minutes the next day, the liquid was aspirated and the cells were washed 3 times with PBS for 10 minutes each time. The PBS was aspirated and the diluted secondary antibody goat anti-rabbit IgGH&L (Alexa Fluor® 594) was added. (ab150080), operate in the dark, incubate at 37℃ for 1h; after the incubation, remove the secondary antibody in the dark, add PBS to wash 3 times, 10min each time; remove PBS, add diluted DAPI nuclear dye, incubate at room temperature in the dark for 10min; remove the dye, wash once with PBS, 10min, remove PBS; add 1mL PBS, and examine under fluorescence microscope. Referring to the above steps, the primary antibodies used were Anti-Oct4 and Anti-SOX2, and fluorescence microscope examination was performed respectively. The results of stemness identification are shown in Figure 5 , Figure 5 The results showed that Nanog, Oct4 and SOX2 proteins were expressed normally in the cells, confirming that the stemness of universal iPS cells remained unchanged.

[0080] (3) Inducing universal iPS cells to differentiate into universal T cells:

[0081] (a) Universal iPS cells were seeded into 6-well plates and cultured for 1 day in a 5% O2, 5% CO2 incubator with StemFit AK03N medium containing 10 μM Y-27632 and 10 μM CHIR99201; on the second day of universal iPS cell culture, bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol and BMP4 were added to the culture medium, and the concentration of bFGF in the culture medium was 50 ng / ml, the concentration of VEGF was 50 ng / ml, the concentration of insulin-transferrin-selenium was 100 ng / ml, the concentration of L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate was 50 μg / ml, the concentration of 1-thioglycerol was 100 nmol / L, and the concentration of BMP4 was 40 ng / ml, and the culture was continued;

[0082] (b) On the 5th day of universal iPS cell culture, BMP4 was removed and SCF was added to the culture medium. The concentration of SCF in the culture medium was 50 ng / ml and the culture was continued.

[0083] (c) On the 7th day of universal iPS cell culture, rhFLT-3L and TPO were added to the culture medium, and the concentration of rhFLT-3L in the culture medium was 10 ng / ml and the concentration of TPO was 30 ng / ml, and the culture was continued;

[0084] (d) On the 14th day of universal iPS cell culture, universal iPS cells differentiated into hematopoietic progenitor cells. The hematopoietic progenitor cells were collected, and then OP9-DL1 cells (mouse bone marrow stromal cells) were pre-cultured with OP9 cell culture medium in a culture flask to form a cell confluence of 90%. The OP9 cell culture medium was removed, and OP9 cell culture medium containing 10 ng / ml rhIL-7 and 30 ng / ml rhFLT-3L was added. The collected hematopoietic progenitor cells were then added and co-cultured with OP9-DL1 cells. After 2 days of co-culture, T cells were collected and placed in α-MEM containing 15% fetal bovine serum, 2 mM L-glutamine, 10 ng / ml rhIL-7, 10 nM dexamethasone, 100 U / ml penicillin and 100 U / ml streptomycin. OKT3 (CD3 antibody) was added to a final concentration of 500 ng / ml to activate T cells and generate CD8+ αβT cells, that is, universal T cells (universal CD8+ T cells) are obtained.

[0085] (4) CEA+4-1BB+CD3ζ chimeric CAR design:

[0086] The 4-1BB (214-255aa) and CD3ζ (52-163aa) peptides were chimeric after the CEA peptide. The designed DNA sequence was sent to Shanghai Bioengineering Co., Ltd. for synthesis, and the ATG was added before the 5' end of the whole sequence. Eco RI site, added after the 3' TGA stop codon Spe l site and then cloned into the pMD18-T vector, named pMD18-T-CAR vector.

[0087] (5) Construction of pSin-EF2-Pur-CAR vector:

[0088] a. Use Eco RI and Spe l Double enzyme digestion of the two plasmids pMD18-T-CAR and pSin-EF2-Sox2-Pur. The enzyme digestion reaction system is shown in Table 1.

[0089]

[0090] The reaction was carried out at 37°C for half an hour, and then 1.0% agarose gel electrophoresis was performed.

[0091] b. Obtaining CAR and expression vector pSin-EF2-Sox2-Pur fragment

[0092] A) 1.0% agarose gel separation of double enzyme digestion products;

[0093] B) Place the cut gel block into a 1.5 ml EP tube and add Extraction Buffer at a volume ratio of 1:3;

[0094] C) Place in a 50°C water bath for 10 minutes to completely melt the agarose, inverting and mixing every 2 minutes;

[0095] Transfer the melted agarose solution into the adsorption column, centrifuge at 6000 g for 1 min, pour out the liquid in the collection tube, and then place the adsorption column into the same collection tube;

[0096] D) Add 500 ml of Extraction Buffer to the adsorption column, centrifuge at 12000 g for 60 seconds, pour out the liquid in the collection tube, and place the adsorption column into the same collection tube;

[0097] E) Add 750 ml Wash Buffer to the adsorption column, centrifuge at 12000 g for 60 seconds, pour out the liquid in the collection tube, and place the adsorption column in the same collection tube;

[0098] F) Centrifuge again at 12000g for 1 min, and then place the adsorption column into a 1.5 mL centrifuge tube;

[0099] G) Add 50 ml of TE buffer to the center of the adsorption column, let it stand at room temperature for 1 minute, centrifuge at 12000g for 1 minute, and store the obtained DNA for later use.

[0100] c. Recover the CAR fragment and the pSin-EF2-Sox2-Pur vector fragment, connect the two with DNA T4 ligase, and name the product pSin-EF2-Pur-CAR vector. The ligation reaction system is shown in Table 2.

[0101]

[0102] The ligation reaction conditions were 16°C overnight ligation, followed by transformation of E. coli DH5α.

[0103] d. Extract the plasmid from the E. coli DH5ɑ competent cells transformed with the plasmid pSin-EF2-Pur-CAR and transfer the recombinant expression plasmid pSin-EF2-Pur-CAR to Spe l and Eco RI double digestion identification, 1.0% agarose gel electrophoresis detection, enzyme digestion reaction system is shown in Table 3.

[0104]

[0105] The correctly connected recombinant expression vector pSin-EF2-Pur-CAR was screened.

[0106] (6) Lentiviral packaging:

[0107] 293T cells in the logarithmic growth phase were digested with trypsin and 2.5 × 10 6 293T cells were re-seeded in 10cm culture dishes and cultured in a 37℃, 5% CO2 incubator until the cell confluence reached 60-70% before lentiviral transfection. Prepare 32μl of three plasmid (vector) DNA solutions (pSin-EF2-Pur-CAR 20μg, psPAX2 15μg, pMD2.G 6μg) in the lentiviral packaging system and gently mix with 68μl of Lipofectamine 2000 liposomes, let stand for 10 min, then dilute with 1.5ml Opti-MEM, gently mix, and incubate at room temperature for 20min to form a transfection complex; then add the above transfection complex to the cell culture dish, mix gently, and replace the complete culture medium after 6h of culture. GFP expression can be seen under an inverted fluorescence microscope 48h after transfection ( Figure 6 The virus supernatant was collected and centrifuged at 4°C, 3000 r / min for 5 min to remove cell precipitates and debris; the supernatant was filtered with a 0.45 μm diameter filter, and the filtered supernatant was centrifuged at 4°C, 25000 r / min for 2 h. The virus precipitate was resuspended with 500 μl PBS and dissolved at 4°C overnight to obtain CEA-CAR lentivirus.

[0108] (7) Preparation of universal CEA-CART cells:

[0109] Universal T cells were expressed at 2.0×10 5The cells were inoculated into a 24-well plate at a density of 10 cells / well, and the experiment was started 12 hours later. 300 μl of CEA-CAR lentivirus was added for infection, and polybrene with a working solution concentration of 5 μg / ml was added to increase the infection efficiency. The next day, the virus-containing culture medium was removed and replaced with serum-free complete culture medium. 72 hours after infection, CEA-positive T cells were sorted as target cells using flow cytometry, that is, universal CEA-CART cells were obtained, and the universal CEA-CART cells were expanded and cultured to obtain universal CEA-CART cell preparations. At the same time, wild-type human iPS cells were induced into wild-type T cells (WT) according to the scheme in step (3), and 300 μl of CEA-CAR lentivirus was added for infection, and polybrene with a working solution concentration of 5 μg / ml was added to increase the infection efficiency. The next day, the virus-containing culture medium was removed and replaced with serum-free complete culture medium. 72 hours after infection, CEA-positive T cells were sorted as target cells using flow cytometry, named non-universal CEA-CART cells, and reserved for subsequent experiments.

[0110] (8) Detection of the immunogenicity of universal CEA-CART cells on CD8+ T cells and CD4+ T cells:

[0111] Peripheral blood mononuclear cells (PBMCs) were isolated from healthy human subjects and cultured in RPMI-1640 medium supplemented with glutamine and 10% fetal bovine serum (Biosera, Catalog No. FB-1365) for about 3 to 5 hours, and then CD4+ and CD8+ T cells were sorted by flow cytometry (FACS) using anti-CD3, anti-CD8αβ, and anti-CD4+ T cell antibodies. The next day, T cells were labeled with 1 μM CFSE (Dojindo, Catalog No. C309) for 8 minutes and then washed twice with 10% fetal bovine serum / phosphate buffered saline (FBS / PBS). The non-universal CEA-CART cells and universal CEA-CART cells in step (7) were mixed with CD4+ T cells or CD8+ T cells at a cell number ratio of 1:1 in RPMI-1640 medium supplemented with glutamine and 10% fetal bovine serum. After 7 days, the percentage of CFSE-negatively labeled CD4+ T cells or CD8+ T cells was measured by flow cytometry. The results showed that the number of CFSE-negatively labeled cells caused by the activation of CD8+ T cells and CD4+ T cells by non-universal CEA-CART cells was higher than that of universal CEA-CART cells. The results of CD8+ T cell detection showed that ( Figure 7), non-universal CEA-CART cells activated CD8+ T cells to increase proliferation, and the percentage (%) of CFSE-negatively labeled CD8+ T cells in the total CD8+ T cells was significantly higher than that of universal CEA-CART cells (statistical P < 0.01); CD4+ T cell detection results showed ( Figure 8 ), non-universal CEA-CART cells activated CD4+ T cells to increase proliferation, and the percentage (%) of CFSE-negatively labeled CD4+ T cells in the total number of CD4+ T cells was significantly higher than that of universal CEA-CART cells (statistical P < 0.01), indicating that universal CEA-CART cells have low immunogenicity and have very low activation on CD8+ T cells and CD4+ T cells.

[0112] (9) Universal CEA-CART cells to detect the immunogenicity of NK cells:

[0113] Peripheral blood mononuclear cells (PBMCs) were isolated from healthy human subjects and cultured in RPMI-1640 medium supplemented with glutamine and 10% fetal bovine serum (Biosera, Catalog No. FB-1365) for about 3 to 5 hours, and then NK cells were sorted by flow cytometry (FACS) using anti-CD16 and anti-CD56 cell antibodies. The next day, NK cells were labeled with 1 μM CFSE (Dojindo, Catalog No. C309) for 8 minutes and then washed twice with 10% fetal bovine serum / phosphate buffer (FBS / PBS). The non-universal CEA-CART cells and universal CEA-CART cells in step (7) were mixed with NK cells at a cell number ratio of 1:1 in RPMI-1640 medium supplemented with glutamine and 10% fetal bovine serum. After 7 days, the percentage of CFSE-negatively labeled NK cells was measured by flow cytometry. The results showed ( Fig. 9 ), non-universal CEA-CART cells activated NK cells to increase proliferation, and the percentage (%) of CFSE-negatively labeled NK cells in the total number of NK cells was significantly higher than that of universal CEA-CART cells (statistical P < 0.01), indicating that universal CEA-CART cells have low immunogenicity and have very low activation on NK cells.

[0114] (10) Universal CEA-CART in vitro killing of colorectal cancer cells experiment:

[0115] ① Determination of CEA expression in colorectal cancer cells: SW480 colorectal cancer cell lines were taken out of the liquid nitrogen tank for resuscitation, and then amplified and cultured in DMEM-H complete medium containing 10% FBS and 1% double antibody. The amplified and cultured colorectal cancer cells were digested with trypsin, centrifuged and resuspended in 200μL PBS buffer, and divided into two equal volumes of cells, one as a control without adding any antibodies (no CEA antibody was added to screen SW480 cells), and one cell was labeled with CEA antibody (addition of CEA antibody to screen SW480 cells), and the antibody was washed after incubation at 4°C. The expression of CEA on the surface of SW480 colorectal cancer cells was detected using FACS Fortessa flow cytometer, and the number of cells expressing CEA was counted. The results showed that the CEA expression rate of SW480 cells was 99.9% ( Fig.10 ).

[0116] ② The ability of universal CEA-CART cells to kill tumor cells: In order to further explore the in vitro anti-tumor function of universal CEA-CART cells, the present invention used colorectal cancer cells SW480 expressing CEA protein as target cells, wild-type T cells (100 μL, 3×10 6 cells) and universal CEA-CART cells (100 μL, 3 × 10 6 Cells) were used as effector cells. After cell counting, the effector cells and target cells were plated in a 6-well plate at an effector-target ratio of 10:1 and placed in a 37°C incubator for co-culture for 24 hours. After the co-culture, the number of surviving target cells SW480 (adherent cells) was counted, and an equal volume of PBS buffer was added as a control, that is, only an equal number of target cells SW480 were plated in the culture flask, placed in a 37°C incubator for co-culture for 24 hours, and then the number of surviving target cells SW480 was counted. Finally, the percentage of surviving cells was calculated as follows: SW480 cell survival rate under wild-type T cell intervention = (SW480 cell number under wild-type T cell intervention) / (SW480 cell number under PBS intervention) × 100%; SW480 cell survival rate under universal CEA-CART cell intervention = (SW480 cell number under universal CEA-CART cell intervention) / (SW480 cell number under PBS intervention) × 100%; the results are as follows Fig.11 As shown, the average survival rate of SW480 cells under the intervention of wild-type T cells was about 90.5%, while the survival rate of SW480 cells under the intervention of universal CEA-CART cells was about 23.5%. It can be seen that universal CEA-CART cells have a strong killing ability against colorectal cancer cells SW480 that highly express CEA protein.

[0117] (11) Animal experiments:

[0118] ① Cell culture: In vitro culture of colorectal cancer cells SW480, using McCoy ， s 5A medium (containing 10% fetal bovine serum) was used to culture cells in a cell culture incubator with 5% CO2 and 37°C. Cells in the logarithmic growth phase were taken, the medium was removed, and the cells were washed twice with sterile PBS. The cells were digested with 0.25% trypsin, and DMEM medium containing 10% fetal bovine serum was added to terminate the digestion. The cell suspension was pipetted evenly, and the cell suspension was transferred to a 15 mL sterile centrifuge tube and centrifuged at 800 r / min for 5 min. The supernatant was discarded, 2 mL of normal saline was added, and the mixture was mixed evenly by pipetting. Then the cells were counted and the cell concentration was adjusted to 3 × 10 by adding normal saline. 6 Pieces / mL.

[0119] ② Mouse model establishment and grouping: This experiment used 6-week-old female BALB / c mice. Using G-power software, according to the statistical power of 80%, the minimum sample size required for each group was calculated to be 8. Considering the possible loss of sample size, 10 mice were set in each group. The hair on the inside of the right upper limb of the mouse was cut with ophthalmic scissors, and subcutaneous injection was performed. Each mouse was injected with 100 μL (3×10 6 The cells were cultured with colorectal cancer cell SW480 suspension, and tumor growth was evaluated after 2 weeks of culture. After tumor formation, the cells were randomly divided into two groups:

[0120] Non-universal CEA-CART treatment group: 10 mice were injected with 1×10 7 Non-universal CEA-CART cells;

[0121] Universal CEA-CART treatment group: 10 mice were injected with 1×10 7 Universal CEA-CART cells.

[0122] All mice were housed in separate cages with a 12-h light cycle, free access to food and water, room temperature of 22±5°C, relative humidity of 50±10%, and fed with dry feed according to national standards for rodents.

[0123] ③Observation of the effect of universal CEA-CART cells infiltrating into tumor tissue: 3 weeks after cell injection, mice were killed by cervical dislocation, and 1.0 cm × 1.0 cm × 0.3 cm tumor tissue blocks were taken, wrapped in OCT, and sliced ​​in a freezing microtome to make frozen sections. The sections were blocked with 70% methanol containing 3% hydrogen peroxide for 7 minutes, washed 3 times in PBS for 5 minutes each time, and then incubated with rabbit anti-human CD3 antibody and 10% normal horse serum at 4°C overnight. After being rinsed several times in PBS, the sections were incubated in biotinylated donkey anti-rabbit IgG for 1 hour, and then incubated in avidin-biotin-peroxidase complex for 30 minutes. Subsequently, they were fixed on albumin-coated slides with 3,4-diaminobenzidine and hydrogen peroxide, and embedded with coverslips. Then, the sections were photographed under a fluorescence microscope to observe the infiltration ability of non-universal CEA-CART cells and universal CEA-CART cells into tumor tissues. The results showed that universal CEA-CART cells had a high degree of infiltration into tumor tissues because of their low immunogenicity ( Fig.12 ).

[0124] ④ Observation of tumor mass growth inhibition: 3 weeks after cell injection, mice were killed by cervical dislocation, and the tumor masses were removed and their sizes were measured. The volume of the tumor mass was determined by the water displacement method. First, a certain amount of saline was filled into the measuring cylinder, and the mark corresponding to the saline level in the measuring cylinder was recorded, which was the initial volume V1. Then, the tumor mass removed from the mouse was carefully placed in the measuring cylinder to ensure that it was completely immersed in saline. After the liquid in the measuring cylinder stabilized, the mark corresponding to the saline level in the measuring cylinder was read to obtain the volume V2. The volume of the tumor mass V=V2-V1. The results are as follows: Fig.13 As shown, the average volume of tumor mass in mice treated with non-universal CEA-CART was 1210 mm 3 The average tumor volume of mice in the universal CEA-CART treatment group was 772 mm 3 The average volume of tumor masses in mice treated with non-universal CEA-CART was significantly greater than that in mice treated with universal CEA-CART (Figure represents P < 0.001), the results show that universal CEA-CART cells can more effectively inhibit tumor growth.

[0125] In summary, the universal CEA-CART cells constructed by the present invention not only effectively reduce the immunogenicity of CD8+ T cells and CD4+ T cells to them, but also achieve targeting of tumor cells. Therefore, the universal CEA-CART cell preparation, as an immune cell preparation, can be used for the prevention and treatment of tumors.

Claims

1. A method for preparing a universal CEA-CART cell preparation, characterized in that The steps include: (1) Construction of CRISPR / Cas9 knockout vector for RFX5 gene: Design the gRNA sequence, the gRNA sequence is SEQ ID NO. 1, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-RFX5 knockout vector; (2) Construction of Tapbp gene CRISPR / Cas9 knockout vector: Design the gRNA sequence, the gRNA sequence is SEQ ID NO.2, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-Tapbp knockout vector; (3) Construction of CRISPR / Cas9 knockout vector for MICA gene: Design the gRNA sequence, the gRNA sequence is SEQ ID NO.3, and then clone the gRNA sequence into the expression vector to obtain the pU6gRNA-Cas9-GFP-MICA knockout vector; (4) Construction of universal iPS cells: The pU6gRNA-Cas9-GFP-RFX5 knockout vector was transfected into human iPS cells to obtain RFX5 gene-deficient human iPS cells; the pU6gRNA-Cas9-GFP-Tapbp knockout vector was transfected into RFX5 gene-deficient human iPS cells to obtain RFX5 and Tapbp gene-deficient human iPS cells; the pU6gRNA-Cas9-GFP-MICA knockout vector was transfected into RFX5 and Tapbp gene-deficient human iPS cells to obtain universal iPS cells; (5) Induction of universal iPS cells into universal T cells: Adding induction agents to universal iPS cells induces them into universal T cells; (6) Construction of CEA-CAR lentivirus: The CEA-CAR chimeric sequence was cloned into the pMD18-T vector to obtain the pMD18-T-CAR vector; the pSin-EF2-Pur-CAR vector was constructed based on the pMD18-T-CAR vector, and the pSin-EF2-Pur-CAR vector, psPAX2 plasmid and pMD2.G plasmid were mixed and transfected into 293T cells to obtain the CEA-CAR lentivirus; (7) Construction of universal CEA-CART cells: CEA-CAR lentivirus infects universal T cells, screens and obtains universal CEA-CART cells, and expands and cultures the universal CEA-CART cells to obtain universal CEA-CART cell preparations; In step (5), the inducing agents include bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol, BMP4, SCF, TPO, rhIL-7 and rhFLT-3L; In step (5), the steps of adding an inducer to the universal iPS cells to induce universal T cells are as follows: (a) universal iPS cells were cultured, and on the second day of the universal iPS cell culture, bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol and BMP4 were added to the culture medium and the culture was continued; (b) On the 5th day of universal iPS cell culture, BMP4 was removed, SCF was added to the culture medium, and culture continued; (c) On the 7th day of universal iPS cell culture, rhFLT-3L and TPO were added to the culture medium and culture was continued; (d) On the 14th day of universal iPS cell culture, the universal iPS cells differentiated into hematopoietic progenitor cells, the hematopoietic progenitor cells were collected, the hematopoietic progenitor cells were co-cultured with OP9-DL1 cells in OP9 cell culture medium containing rhIL-7 and rhFLT-3L, T cells were collected, and CD3 antibodies were used to activate T cells to obtain universal T cells; The CEA-CAR chimeric sequence in step (6) is SEQ ID NO.

4.

2. The method for preparing a universal CEA-CART cell preparation according to claim 1, characterized in that After adding bFGF, VEGF, insulin-transferrin-selenium, L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 1-thioglycerol and BMP4 to the culture medium in step (a), the concentration of bFGF in the culture medium is 50 ng / ml, the concentration of VEGF is 50 ng / ml, the concentration of insulin-transferrin-selenium is 100 ng / ml, the concentration of L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate is 50 μg / ml, the concentration of 1-thioglycerol is 100 nmol / L, and the concentration of BMP4 is 40 ng / ml.

3. The method for preparing a universal CEA-CART cell preparation according to claim 1, characterized in that After SCF is added to the culture medium in step (b), the concentration of SCF in the culture medium is 50 ng / ml.

4. The method for preparing a universal CEA-CART cell preparation according to claim 1, characterized in that After adding rhFLT-3L and TPO to the culture medium in step (c), the concentration of rhFLT-3L in the culture medium is 10 ng / ml, and the concentration of TPO in the culture medium is 30 ng / ml; In step (d), the concentration of rhIL-7 in the OP9 cell culture medium containing rhIL-7 and rhFLT-3L is 10 ng / ml, and the concentration of rhFLT-3L is 30 ng / ml.

Images