A SNP molecular marker related to the multiple ovulation trait of sheep, a detection primer set and a kit thereof, and an application thereof
By detecting the T>C polymorphism of the sheep ABCA1 gene, and using Sequenom MassARRAY technology and specific primer sets, sheep with the TT genotype were screened, solving the problem of sheep reproductive performance improvement and enhancing breeding efficiency and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies are insufficient to effectively improve the reproductive performance of sheep, especially the number of lambs born. Conventional breeding methods have made slow progress, and the lambing traits of ewes are greatly affected by the environment and feeding conditions.
Using Sequenom MassARRAY technology combined with whole-genome resequencing, the T>C polymorphism at the 18197516bp site of the sheep ABCA1 gene was detected. Specific primer sets were designed for PCR amplification and extension reactions to screen sheep with the TT genotype in order to improve their reproductive capacity.
It has enabled high-precision prediction of the lambing trait in sheep, improved breeding efficiency and reproductive performance, and promoted the development of sheep germplasm improvement and industrial modernization.
Smart Images

Figure CN119331984B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of SNP molecular marker technology, and in particular to an SNP molecular marker associated with the trait of multiple lambing in sheep, as well as its detection primer set, kit, and application. Background Technology
[0002] Reproductive performance is a key factor affecting the economic benefits of sheep farming, especially lambing number, which is controlled by a small number of genes with low heritability. Furthermore, lambing traits in ewes are greatly influenced by environmental and feeding conditions, leading to relatively slow progress in improving conventional breeding methods. With the development of molecular marker technology, precise selection using molecular genetic markers closely related to lambing traits can reduce the randomness in the breeding process, improve selection efficiency, and accelerate the breeding speed.
[0003] To promote the development of the sheep industry, it is necessary to strengthen the selection and promotion of superior breeds, develop appropriately scaled farming, and promote the agricultural-livestock cycle. Introducing superior foreign breeds, combining them with local Chinese breeds, and employing advanced breeding techniques to cultivate new sheep breeds are core tasks that can better drive the sheep industry towards healthy, safe, and high-quality development.
[0004] Dorper sheep are known for their rapid growth, superior meat quality, and strong disease resistance; Hu sheep are known for their high reproductive rate and tolerance to high temperatures and humidity. Crossbreeding Dorper and Hu sheep yields the Dorper-Hu sheep hybrid, which combines the advantages of both breeds while further enhancing growth rate and meat quality. Researching molecular markers for lambing count in the Dorper-Hu sheep hybrid is of great significance for the development and utilization of sheep multiparity resources and for production practices. It helps to fully realize their reproductive potential, thus laying a solid foundation for the sustainable development of the sheep industry.
[0005] With the rapid development of molecular biology and genomics technologies, high-throughput sequencing, genome selection, molecular markers, and genetic modification techniques have become increasingly sophisticated. Whole-genome resequencing, through high-precision sequencing, can detect genetic variations such as single nucleotide polymorphisms (SNPs) and insertions / deletions (Indels). Combined with bioinformatics analysis, it can reveal key genes related to lambing traits, providing a new perspective for studying animal genetic characteristics. Sequenom MassARRAY technology, with its high throughput and high accuracy, is widely used for the rapid validation and screening of known candidate gene loci.
[0006] Combining whole-genome resequencing with Sequenom MassARRAY technology not only enables a comprehensive analysis of the genetic basis of lambing traits in Duhu hybrid sheep, but also accelerates the breeding process, improving reproductive efficiency and economic benefits. This precision breeding method provides new opportunities for the development and utilization of sheep prolificacy resources, and is expected to drive the sheep industry towards high efficiency and high quality.
[0007] ATP-binding cassette transporter A1 (ABCA1) is a membrane-integrated protein encoded by the ABCA1 gene, belonging to the ABC superfamily. Currently, 7 ABC subfamilies with a total of 48 members have been identified. The ABCA subfamily contains 12 members, among which ABCA1 is primarily responsible for the transport of cholesterol and phospholipids from intracellular to extracellular space, participating in the production of high-density lipoprotein (HDL).
[0008] Studies have shown that homozygous female ABCA1-deficient mice exhibit significant reproductive impairments, specifically reduced pregnancy frequency and litter size, indicating a correlation between the ABCA1 gene and reproductive performance. This may be related to the gene's important role in lipid metabolism; ABCA1 deficiency may lead to lipid metabolic imbalance, thereby affecting reproductive organ function and embryonic development, ultimately resulting in decreased reproductive capacity (Robert J. Aiello et al., 2003). Although ABCA1 gene polymorphisms have been extensively studied in model animals such as mice, research in livestock has not yet been conducted, providing a new direction for exploring the molecular basis of livestock reproductive performance. Summary of the Invention
[0009] The purpose of this invention is to provide a method for detecting sheep using Sequenom MassARRAY® SNP technology. ABCA1 The method and application of gene single nucleotide polymorphism provide basic data for molecular marker-assisted selection breeding of sheep and accelerate the improvement of sheep germplasm resources in China.
[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0011] The application of a SNP molecular marker associated with the lambing trait in lambing detection or sheep breeding, wherein the SNP molecular marker is located at position 18197516 bp on chromosome 2 of the sheep genome ARS-UI_Ramb_v2.0. ABCA1 The gene has a base polymorphism of T>C.
[0012] Preferably, the number of lambs born to ewes with the TT genotype at the locus is significantly higher than that of ewes with the TC or CC genotypes.
[0013] The present invention also provides a primer set for detecting SNP molecular markers in the application, the primer set comprising upstream and downstream primers and extension primers, the upstream and downstream primer sequences being shown in SEQ ID NO. 1~2, and the extension primer sequence being shown in SEQ ID NO. 3.
[0014] The present invention also provides a kit for detecting the multiple-lambing trait in sheep using the primer set described above.
[0015] The present invention also provides the application of the primer set or the kit in sheep multiplication detection or sheep breeding.
[0016] The present invention also provides a method for selecting sheep with strong reproductive capacity using the primer set or the kit described above, comprising the following steps:
[0017] (1) Extract the genetic DNA from the sheep to be tested;
[0018] (2) Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the upstream and downstream primers in the primer set;
[0019] (3) The PCR amplification products were digested with SAP enzyme to obtain the enzyme digest;
[0020] (4) Using the enzyme digestion product as a template, the extension reaction is carried out using the extension primers;
[0021] (5) Analyze the extended products and genotype the gene at the 18197516bp site of the sheep chromosome 2 genome sequence;
[0022] (6) Select sheep with the TT genotype at the 18197516bp locus.
[0023] Preferably, the sheep is a Duhu crossbred sheep.
[0024] Preferably, the reproductive capacity is the number of lambs born in a single litter.
[0025] This invention provides a SNP molecular marker that is significantly associated with the multiplication trait in sheep. This marker can be used alone or in combination with existing markers to provide high-precision predictions of sheep multiplication traits, thus offering stable and accurate results. This provides important support for improving sheep reproductive performance and breeding efficiency, accelerates the process of sheep germplasm improvement, and promotes the modernization of China's sheep industry. Attached Figure Description
[0026] Figure 1 The mass spectrometry results are from the 18197516bp site of the genome sequence of chromosome 2 of the Duhu hybrid sheep in Example 2. Detailed Implementation
[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1
[0029] Seventy-six ewes with three consecutive farrowing records were selected, of which 43 had consecutive multiple births (≥2 litters) and the other 33 had consecutive single births. In-depth whole-genome resequencing analysis was performed on these 76 samples, generating a total of 2679.69 Gb of raw data. The average sequencing depth per sample reached 11-fold, with an average genome coverage of 98.2%. Alignment with the reference genome showed a localization rate exceeding 99%, successfully identifying 36,655,095 high-quality SNP variants.
[0030] After data quality control, genome-wide association analysis (GWAS) was performed. The 30 SNPs with the lowest p-values were selected, and MassARRAY genotyping was used to genotype these SNPs. The results were then compared with fetal birth count for significance testing. [The remaining text appears to be incomplete and requires further context.] ABCA1 Genes may be genes that influence lambing traits.
[0031] During the study of SNPs in the sheep genome, it was found that the T>C mutation at position 18,197,516 on sheep chromosome 2 was significantly associated with the multiparity trait in sheep.
[0032] Example 2
[0033] 2.1 Experimental Materials
[0034] Two hundred Duhu hybrid sheep with consecutive three litters were selected for intravenous blood collection, DNA extraction and genotyping were performed, and the association between genotype and litter size was analyzed.
[0035] 2.2 Extraction of genomic DNA
[0036] Blood was collected from the jugular vein of sheep in section 1.1 using 2 ml EDTA negative pressure anticoagulant tubes. The blood was lysed and centrifuged using erythrocyte lysis buffer, and after obtaining a white precipitate, genomic DNA was isolated using the standard phenol-chloroform extraction method. The concentration and purity of the extracted DNA were determined using a Nanodrop 2000 spectrophotometer and 1% agarose gel electrophoresis. Qualified DNA samples were stored at -80°C.
[0037] 2.3 Genotyping using Sequenom SNP technology
[0038] A primer set was designed targeting the 18,197,516 bp site of sheep chromosome 2 genome sequence (based on sheep genome sequence information version number ARS-UI_Ramb_v2.0). The sequences of the upstream primer used for PCR amplification are shown in SEQ ID NO.1, the downstream primer sequence is shown in SEQ ID NO.2, and the extension primer sequence is shown in SEQ ID NO.3. These primers were synthesized by Compson Biotech.
[0039] Upstream primer: ACGTTGGATGAAGCTGAGATGGAGCAGATG (SEQ ID NO. 1)
[0040] Downstream primer: ACGTTGGATGCTGACAGCTGACTTGTCTTG (SEQ ID NO. 2)
[0041] Extension primer: GAGTTTGCTGGGCGGCAA (SEQ ID NO. 3)
[0042] The testing process is as follows:
[0043] (1) Extract the genetic DNA from the sheep to be tested;
[0044] (2) Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using upstream and downstream primers;
[0045] (3) The PCR amplification products were digested with SAP enzyme to obtain the enzyme digest;
[0046] (4) Using the enzyme digestion product as a template, an extension reaction is carried out using extension primers;
[0047] (5) Analyze the extended products to determine the gene at the 18197516bp site of the sheep chromosome 2 genome sequence.
[0048] 2.3.1 PCR Amplification
[0049] Multiplex PCR was used, and the reaction system (384-well PCR plate + 38% reagent loss) is shown in Table 1. The PCR program was as follows: 94℃ pre-denaturation for 120s, one replicate; 94℃ denaturation for 20s, 56℃ annealing for 30s, 72℃ extension for 60s, a total of 45 replicates; and a final extension at 72℃ for 3min.
[0050] Table 1 PCR amplification reaction system
[0051]
[0052] 2.3.2 SAP Processing
[0053] After PCR amplification, the PCR product was treated with shrimp alkaline phosphatase (SAP) reaction solution according to the proportions in Table 2 (384-well PCR plate + 38% reagent loss). 2 μL of SAP treatment solution was added to each well of the 384-well plate, and the plate was then placed in a PCR instrument for the following steps: This process was carried out at 37°C for 40 min; denaturation was performed at 85°C for 5 min; each cycle was repeated.
[0054] Table 2 SAP treatment reaction solution formulation
[0055]
[0056] 2.3.3 Extended Processing
[0057] The composition information of the single-base extension reaction solution is shown in Table 3. Add 2 μL of the single-base extension reaction mixture to each well and mix it with the SAP-treated mixture. Perform the following steps: run at 94℃ for 30 s, one cycle; run at 94℃ for 5 s, one cycle; run at 52℃ for 5 s, five cycles; run at 80℃ for 5 s, five cycles; perform a total of 40 repetitions of the three processes; run at 72℃ for 3 min, one cycle.
[0058] Table 3 Composition of the monobasic extension reaction solution
[0059]
[0060] 2.3.4 Product Purification
[0061] The reaction product after extension treatment was diluted and desalted. The sample was then spotted onto the target using a MassARRAY™ RS 1000 spotter. After crystallization, mass spectrometry was performed, and the data was collected and processed.
[0062] 2.3.5 Data Preparation
[0063] Mass spectrometry analysis of the 18197516 bp site on chromosome 2 of the Duhu hybrid sheep genome is as follows: Figure 1 As shown, the horizontal axis represents the low molecular weight height (Low Mass Height), and the vertical axis represents the high molecular weight height (High Mass Height). The results revealed 148 cases of the TT genotype, 25 cases of the TC genotype, and 27 cases of the CC genotype.
[0064] The statistical results of the analysis of different genotypes at the 18197516bp site of chromosome 2 of the sheep to be tested are shown in Tables 4 and 5.
[0065] Table 4. Genotype and allele frequencies at the 18197516 bp locus of sheep chromosome 2 in the Duhu crossbred sheep population.
[0066]
[0067] The statistical results in Table 4 show that this site conforms to Hardy-Weinberg equilibrium.
[0068] Table 5. Association analysis of different genotypes at the 18197516 bp locus of sheep chromosome 2 genome sequence with lambing number in Duhu hybrid sheep.
[0069]
[0070] Note: Different lowercase letters in superscript indicate significant differences.
[0071] The statistical results in Table 5 show that the 18197516bp site of the sheep chromosome 2 genome sequence is closely related to the number of lambs born in the first, second, and third litters of Duhu hybrid sheep. The number of lambs born in TT-type ewes at this site is significantly higher than that in CC-type ewes.
[0072] In summary, the method provided by this invention can be used to automatically detect SNP loci and screen out TT or TC individuals with the trait of multiple lambing, thereby improving the fertility of sheep and making it suitable for large-scale sheep breeding with multiple lambing as the breeding goal.
[0073] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of a reagent for detecting SNP molecular markers associated with lambing trait in the detection of lambing trait, characterized in that, The SNP molecular marker is located at position 18197516 bp on chromosome 2 of the sheep genome ARS-UI_Ramb_v2.
0. ABCA1 The gene has a base polymorphism of T>C; The sheep in question are Duhu crossbred sheep; The number of lambs born to ewes with the TT genotype at the locus was significantly higher than that of ewes with the TC and CC genotypes.
2. A method for breeding sheep with strong reproductive capacity using the SNP molecular markers described in claim 1, characterized in that, Includes the following steps: (1) Extract the genetic DNA from the sheep to be tested; (2) Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the upstream and downstream primers in the primer set; (3) The PCR amplification products were digested with SAP enzyme to obtain the enzyme digest; (4) Using the enzyme digestion product as a template, an extension reaction is carried out using extension primers; (5) Analyze the extended products and genotype the gene at the 18197516bp site of the sheep chromosome 2 genome sequence; (6) Select sheep with the TT genotype at the 18197516bp locus; The sheep in question are Duhu crossbred sheep; The reproductive capacity refers to the number of lambs born in a single litter. The primer set includes upstream and downstream primers and extension primers. The sequences of the upstream and downstream primers are shown in SEQ ID NO.1~2, and the sequence of the extension primer is shown in SEQ ID NO.3.