Use of a molecular marker associated with piglet growth traits

Abstract

The application of a molecular marker related to piglet growth traits relates to the field of livestock breeding, and aims to provide an InDel marker based on a pig HNF4A gene and application thereof in early selection of growth traits. By detecting an InDel marker in a first intron region of the pig HNF4A gene, the speed of pig breed selection is accelerated by using molecular marker assisted selection. The molecular marker corresponds to a 20-bp insertion / deletion polymorphism site between 46,821,377-46,821,378 bp of Chr17 in the international pig reference genome Sscrofa11.1 version sequence. The application can be used to accurately establish a pig population with high growth speed, thereby accelerating the selection and breeding process of pig growth traits.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and livestock breeding, and in particular relates to a molecular marker, a detection technology and an application thereof for selecting fast-growing piglets. Background Art

[0002] Piglet growth and development performance is a key factor influencing the economic benefits of the pig farming industry, and continuous selection for growth traits is a key focus of pig breeding. Compared to conventional breeding, genomic selection analyzes the genetic makeup of individuals at the DNA level, enabling direct selection of genotypes, thereby improving the speed and accuracy of selection.

[0003] Hepatocyte nuclear factor 4alpha (HNF4A), a member of the hepatocyte nuclear factor (HNF) family, is highly expressed in the liver, kidney, and intestine. HNF4A was originally isolated from rat liver nuclear extracts. Studies by Ceccarelli et al. have shown that HNF4A regulates hepatic lipid metabolism by binding to the apolipoprotein C3 (APOC3) promoter, thereby regulating APOC3 expression. Studies by Pan et al. have also found that HNF4A can directly target stearoyl-CoA desaturase 1 (SCD1), thereby regulating hepatic lipogenesis. Li et al. reported that knocking down the HNF4A gene in hepatocytes significantly reduced hepatocyte proteins such as microsomal triglyceride transfer protein (MTTP), apolipoprotein B-100 (APOB100), and acyl-CoA dehydrogenase long-chain (ACADL), thereby affecting very-low-density lipoprotein (VLDL) secretion and disrupting hepatocyte lipid homeostasis. Furthermore, many researchers have reported the important role of HNF4A in the intestine. Klapper et al. demonstrated that the HNF4A gene participates in intestinal fatty acid metabolism by binding to the human intestinal fatty acid-binding protein 2 (hFABP2) promoter and regulating hFABP2 expression. Chen et al. found that HNF4A accelerates fatty acid oxidation, promotes energy production, and regulates intestinal stem cell self-renewal by activating fatty acid β-oxidation genes, including Acsl5 long-chain acyl-CoA synthetase family member 5 (Acsl5), Acyl-CoA synthetase family member 2 (Acsf2), Solute Carrier Family 27 Member 2 (Slc27a2), Fatty Acid-Binding Protein 2 (Fabp2), and Hydroxyacyl-CoA Dehydrogenase (Hadh).Leng et al. reported that porcine HNF4A affects intestinal lipid absorption by regulating the transcription and expression of apolipoprotein A-IV (APOA IV) and APOCⅢ genes. Verardo et al. found through genome-wide association analysis (GWAS) that HNF4A is a key transcription factor affecting the meat quality of Yorkshire terrier pigs, and affects meat quality by affecting genes such as Adenylyl Cyclase 9 (ADCY9), CREB-Binding Protein (CREBBP), Tumor Necrosis Factor Receptor-Associated Protein 1 (TRAP1), Neuregulin1 (NRG1), Protein Kinase, AMP-Activated, Gamma3-Non-Catalytic Subunit, PRKAG3, Villin 1 (VIL1) and Insulin-like Growth Factor-Binding Protein 5 (IGFBP5). Dai et al. performed ATAC-seq on duodenal tissue from pigs with high and low feed efficiency and found that HNF4A is enriched in the duodenum of pigs with high feed efficiency and affects feed efficiency by participating in lipid and energy metabolism. These studies indicate that HNF4A plays a key role in lipid and energy metabolism in the liver and intestine, thereby affecting piglet growth and development. Summary of the Invention

[0004] The present invention seeks the genetic variation of the pig HNF4A gene, provides a molecular marker related to the growth rate of piglets and a detection method thereof, establishes a molecular marker-assisted breeding technology, and applies it to pig breeding.

[0005] The present invention provides a 20bp In / Del mutation associated with the growth rate of piglets, wherein the mutation site is located in the first intron of the pig HNF4 gene (NM_001044571.1).

[0006] The method for obtaining a partial genomic fragment of the HNF4A gene is as follows:

[0007] (1) Obtaining genomic DNA of the pig to be tested;

[0008] (2) Using the above-mentioned porcine genomic DNA as a template, the following primer pairs were used for amplification to obtain a genomic fragment containing the HNF4A gene mutation site (NC_010459.5: 20 bp insertion or deletion);

[0009] HNF4A-1F: CCGATTAACCATTAACCC;

[0010] HNF4A-1R:AAGTCCCAAAGACACCCT.

[0011] Furthermore, the genomic fragment sequence of the HNF4A gene is shown in SEQ ID NO.2

[0012] CCGATTAACCATTAACCCCCACCCTCCCCGCAGAGCCTCCACCCCTTCGGAGGCTAGGCCAGGACTCCCGGCAGATCCTCCCAGAGGACGGTTGAAACCCAGGAAGGCAGAGGGGGCACCTGGGAGGAGGCAGTGGGAGGGCGGAGGGCGGGGGCCGGGGCTCGGCCCAGAGCCTTC GGGGTGGACATCCTGGGCAGGGCAAGTGGCCGACGTGTGGAGAGGGGAGGATGCGCCTCTCCAAAACCCTGGTCGACATGGACATGGCCGACTACAGTGCTGCGCTGGACCCAGCCTACACCACCCTGGAATTCGAGAATGTGCAGGTGTTGACCATGGGCAATGGTAGGTGGGGGCGGCC GTGTCCAGGGCGCGCCCGCTGGGGGCAGGTCTGCCCAGGGACGGGAGCGAGTCTGTGGCGCTCAGTTTGGGGCTGGGAGGAGAATGACAGACGAGCCCGGTGGTCCCATAGCTGAGCCCAGGTGTTGCCAGGAAAAGCAAATATGCCCAGGTAGGGTGACCCTGTTACCAAAGCTCTTCCCG CTCAGCCTGTGGGGGCGGGAAAGTGATGGTGAGCTTCCTCTTGGCGTCCTGCTCCAGGCATTGGCCCAACCTGGCCCCTTCCTGAACCCCTTAGGCCCAGGTGCTGAGAAATGGCAAGGTATGTCCTGTCCCCAGAGACGGTGGATGGAGCACAACTGTGTTTCAGGGTGTCTTTGGGACTT

[0013] (3) The amplified PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0014] Furthermore, the 20 bp In / Del site is located at NC_010459.5. The "NC_010459.5" refers to the number of the genomic sequence on chromosome 17 where the HNF4A gene is located.

[0015] The invention discloses an application of an In / Del molecular marker related to the weight and daily weight gain of piglets in early piglet breeding.

[0016] Furthermore, the piglet breeds are Landrace, Duroc, Min pig and Jinhua pig.

[0017] The In / Del molecular marker associated with the weight and daily weight gain of piglets of the present invention is characterized in that the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1, and a 20 bp deletion mutation exists between positions 522 and 523 of the amplified sequence.

[0018] A primer pair for detecting molecular markers of the present invention, the primer pair sequence is as follows:

[0019] HNF4A-20bp insertion-F:GAATGACAGACGAGCCCG;

[0020] HNF4A-20 bp insertion-R: CAGGACGCCAAGAGGAAG.

[0021] The application of the molecular marker of the present invention is the application in pig breeding.

[0022] The pig breeding is the selection of pig growth traits.

[0023] Furthermore, the molecular markers are used in pig breeding to gradually reduce the frequency of BB individuals and increase the frequency of A allele in Min pig populations; and to further eliminate AB and BB heterozygous individuals in Landrace pig populations and retain individuals with AA genotype.

[0024] Furthermore, the piglets are Landrace piglets and Minzhu piglets.

[0025] Further, the following steps are included:

[0026] (1) Obtaining genomic DNA of the pig to be tested;

[0027] (2) Using the above-mentioned porcine genomic DNA as a template, the following primer pair was used for amplification to obtain a 20 bp In / Del-tagged HNF4A gene fragment;

[0028] HNF4A-20bp insertion-F:GAATGACAGACGAGCCCG;

[0029] HNF4A-20 bp insertion-R: CAGGACGCCAAGAGGAAG.

[0030] (3) The genotype of the amplified PCR product was detected by 2% agarose gel electrophoresis. Three genotypes were found: the PCR product was 152 bp, which was recorded as the AA genotype; the PCR product was 172 bp, which was recorded as the BB genotype; and the PCR product with two bands was recorded as the AB genotype (152 bp, 172 bp).

[0031] (4) The target piglets screened out complete the molecular marker-assisted selection of fast-growing and fast-developing piglets based on the HNF4A gene.

[0032] The present invention provides a molecular marker associated with piglet growth traits and its application in Min pig and Landrace pig breeding. This molecular marker was developed based on a 20bp In / Del mutation in the HNF4A gene. The method is implemented by detecting the genotype of an In / Del mutation (NC_010459.5: 20bp insertion) in the first intron region of the HNF4A gene in the pig genome. Specifically, during individual genetic assessment, individuals with the genotype of the 20bp insertion mutation (NC_010459.5: 20bp insertion) are selected, thereby completing the molecular marker-assisted selection method for improving piglet growth and development.

[0033] The present invention conducted a population genetic parameter analysis on the polymorphism of the 20bp In / Del marker (NC_010459.5: 20bp insertion), and found that the frequency of the A allele was significantly higher than that of the B allele in the fast-growing Landrace and Duroc pig populations; while in the Min pig and Jinhua pig populations, which are local breeds with relatively slow growth and development, the frequency of the B gene was significantly higher than that of the A allele; indicating that the In / Del marker is related to the growth rate of Landrace pigs, Duroc pigs, Min pigs and Jinhua pigs.

[0034] The present invention conducted trait association analysis on the polymorphism of the 20bp In / Del marker (NC_010459.5: 20bp insertion) in Landrace and Min pig populations, exploring the correlation between the molecular marker and piglet weight and daily weight gain. Statistical analysis showed that in the Min pig population, AB-type individuals had significantly higher weights at 14, 21, 28, and 35 days of age than BB-type individuals (P < 0.05); the average daily weight gain of AB-type individuals was extremely significantly higher than that of BB-type individuals (P < 0.01). In the Landrace pig population, AA-type individuals had significantly higher weights at 21 and 28 days of age than AB-type individuals (P < 0.05). Furthermore, the daily weight gain of AA-type individuals was higher than that of AB-type individuals (P = 0.09). Therefore, in the Min pig population, the growth rate of this population can be increased by moderately increasing the frequency of the A allele; in the Landrace pig population, the growth rate of Landrace pigs can be further increased by eliminating BB-type individuals.

[0035] The beneficial effects of the present invention include:

[0036] This study uses PCR amplification and agarose gel electrophoresis to genotype the porcine HNF4A gene insertion / deletion polymorphism (Chr17:46,821,377-46,821,378). Association analysis of this site with piglet growth traits reveals, for the first time, a significant correlation between the porcine HNF4A gene and piglet growth traits. The study also provides a molecular marker for improving piglet growth rate and a method for detecting it. The present method is simple, rapid, and low-cost, and can be used for early, precise screening of individuals with fast growth rates, thereby accelerating the genetic improvement of growth traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the electrophoresis diagram of the genomic fragment of the porcine HNF4A gene amplified by PCR; in the figure, lane M is the DL1000 marker, and lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 are the target bands;

[0038] Figure 2 These are the sequencing results of a 20-bp insertion marker in the first intron of the porcine HNF4A gene; Figure A shows an AA-type individual, and Figure B shows a BB-type individual;

[0039] Figure 3 The figure shows the results of agarose gel electrophoresis typing; among them, lane M is DNA Marker DL500; to the left of lane M, different genotypes are shown from right to left. DETAILED DESCRIPTION

[0040] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify the contents of the present invention based on the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0041] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0042] The beneficial effects of the present invention are verified by the following examples:

[0043] Example 1 PCR amplification combined with direct sequencing to analyze the genetic variation of the pig HNF4A gene

[0044] 1. Genomic DNA extraction: Pig ear tissue was collected and genomic DNA was extracted using the conventional phenol-chloroform method.

[0045] 2. Primer design: The porcine HNF4A gene information (NM_001044571.1) was searched in the NCBI database. The first base of the first exon was set as +1. The nucleotide sequences of 1000 bp upstream and 1000 bp downstream of the first exon were downloaded to design primers. The primer sequences are as follows:

[0046]

[0047] 3. PCR Amplification: This example used conventional PCR to amplify a -65 to 660 bp fragment of the porcine HNF4A gene. The amplification system consisted of 100 ng of genomic DNA, 25 μL of 2× Taq Master Mix (Dye Plus), 10 pmol of each upstream and downstream primers, and ddH2O to a final volume of 50 μL. The amplification protocol was as follows: initial denaturation at 94°C for 5 min; 32 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s; a final extension at 72°C for 10 min; and storage at 4°C.

[0048] 4. Genetic Variation Identification: Genomic DNA from five individuals, each from the Minzhu and Landrace pig populations, was used as a template for PCR amplification using primers HNF4A-1-F / R. Two microliters of PCR product was subjected to agarose gel electrophoresis. After confirmation of a single, bright band, the product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Multiple sequence alignment analysis of the sequencing results using DNAMAN software revealed six SNPS and a 20-bp insertion / deletion (In / Del) variant in this region.

[0049] Example 2 Detection of genetic structure of different pig breeds using PCR amplification polymorphism technology

[0050] 1. Establishment of genotyping technology:

[0051] A 20-bp In / Del mutation was discovered in the first intron of the HNF4A gene. Primers HNF4A-2F / R were designed to target this mutation. PCR products showed three band patterns after agarose gel electrophoresis: a 152-bp PCR product was designated as the AA genotype, a 172-bp PCR product was designated as the BB genotype, and a PCR product with two bands was designated as the AB genotype (152 bp, 172 bp).

[0052] 2 Primer design

[0053] Based on the above analysis, HNF4A genotyping primers containing an InDel (NC_010459.5: 20 bp insertion) marker were designed. The primer sequences are as follows:

[0054]

[0055] Note: HNF4A-2F is also known as HNF4A-20bp insertion-F, and HNF4A-2R is also known as HNF4A-20bp insertion-R.

[0056] 3. PCR amplification

[0057] PCR amplification was performed using genomic DNA from Min pigs and Landrace pigs, respectively, using primers HNF4A-2F / R. The total PCR amplification volume (10 μL) consisted of 5 μL of 2× Taq Master Mix (Dye Plus), 0.4 μL of each upstream and downstream primer, and 0.5 μL of template DNA, topped up to 10 μL with deionized water. The PCR amplification program was as follows: 94°C initial denaturation for 5 minutes, followed by 32 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 20 seconds, with a final extension at 72°C for 5 minutes.

[0058] 4 PCR polymorphism detection

[0059] Take the above PCR products and use 2% agarose gel electrophoresis to detect the genotype. Figure 3 As shown, there are three genotypes in total, among which the PCR product is 152bp, recorded as AA genotype; the PCR product is 172bp, recorded as BB genotype; the PCR product with two bands is recorded as AB genotype (152bp, 172bp).

[0060] 5. Genotype and allele frequency analysis

[0061] The gene frequency and genotype frequency of the 20bp In / Del marker were detected in the Landrace, Duroc, Min, and Jinhua pig populations using PCR amplification and agarose gel electrophoresis. As shown in Table 1, in the Landrace pig population, there were 149 individuals with the AA genotype, with a genotype frequency of 0.931; 10 individuals with the AB genotype, with a genotype frequency of 0.062; and 1 individual with the BB genotype, with a genotype frequency of 0.006. The A allele frequency was 0.962 and the B allele frequency was 0.038. In the Duroc pig population, there were 225 individuals with the AA genotype, with a genotype frequency of 0.753; 67 individuals with the AB genotype, with a genotype frequency of 0.224; and 7 individuals with the BB genotype, with a genotype frequency of 0.023 and the A allele frequency of 0.86. 5, with a B allele frequency of 0.135. In the Min pig population, there was one individual with the AA genotype (a genotype frequency of 0.006), 19 individuals with the AB genotype (a genotype frequency of 0.122), and 136 individuals with the BB genotype (a genotype frequency of 0.872). The A allele frequency was 0.067, and the B allele frequency was 0.933. In the Jinhua pig population, there were 10 individuals with the AB genotype (a genotype frequency of 0.115), and 77 individuals with the BB genotype (a genotype frequency of 0.885). The A allele frequency was 0.057, and the B allele frequency was 0.943. Landrace and Duroc pigs, through long-term artificial selection, have significantly higher growth rates than the local Min and Jinhua pig breeds. In Landrace and Duroc pig populations, the A allele is the dominant allele, while the B allele is predominant in Min and Jinhua pigs.

[0062] Table 1 Genotype frequencies and allele frequencies of 20 bp insertion / deletion markers in porcine HNF4A gene in Landrace, Min, Duroc and Jinhua pig populations

[0063]

[0064] Example 3

[0065] Application of the molecular markers of the present invention in the growth and development association analysis of Min pigs and Landrace pig suckling piglets

[0066] The experimental population used in this example was from a breeding pig farm in Lanxi County, Heilongjiang Province. Landrace and Min pigs born around the same time were used as the research subjects. Birth weight, weight at 7 days, 14 days, 28 days, and 35 days were recorded. Average daily gain during lactation was calculated using the following formula: Average daily gain = (weight at 35 days - birth weight) / 35.

[0067] The PCR electrophoresis technique established in Example 2 was used to detect the genetic variation of the HNF4A gene in Min pigs and Landrace pigs, and the correlation between the variant sites and the weight and daily weight gain of suckling piglets was analyzed. The GLM procedure of SAS statistical software (SAS Institute Inc, Version 8.0) was used for variance analysis, and the model used was:

[0068] Y ijk =μ+G i +M k+ e ijk

[0069] where Y ijk is the phenotypic value of the piglet trait; μ is the population mean; G i is the genotype; M k is the maternal effect, e ijk is the random residual.

[0070] Statistical analysis showed that in the Min pig population, AB-type individuals had significantly higher body weights at 14, 21, 28, and 35 days of age than BB-type individuals (P < 0.05). The average daily weight gain of AB-type individuals was significantly higher than that of BB-type individuals (P < 0.01) (Table 2). In the Landrace pig population, AA-type individuals had significantly higher body weights at 21 and 28 days of age than AB-type individuals (P < 0.05). The daily weight gain of AA-type individuals was higher than that of AB-type individuals (P = 0.09) (Table 3). Therefore, moderately increasing the frequency of the A allele in the Min pig population could increase growth rate, while reducing the frequency of the B allele in the Landrace pig population could further increase growth rate.

[0071] Table 2 Association analysis between different genotypes of HNF4A gene and growth traits of Min pigs

[0072]

[0073] Note: Capital letters indicate extremely significant differences (P<0.01), and lowercase letters indicate significant differences (P<0.05).

[0074] Table 3 Association analysis between different genotypes of HNF4A gene and growth traits of Landrace pigs

[0075]

[0076]

[0077] Note: Capital letters indicate extremely significant differences (P<0.01), lowercase letters indicate significant differences (P<0.05). # P<0.1.

Claims

1. Application of a molecular marker related to piglet growth traits in breeding fast-growing piglets, characterized in that The molecular marker corresponds to the international pig reference genome Sscrofa11.1 version sequence Chr17:46,821,377-46,821,378bp, and there is a 20bp In / Del site. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1 AGAGGCATCAGGGGGTGTCC; the pig breed is selected from Min pig, Landrace pig and Duroc pig.

2. The use according to claim 1, characterized in that The molecular markers related to the growth traits of piglets are related to the weight and daily weight gain of piglets.

3. The use according to claim 1 or 2, characterized in that Step 1: Obtain the In / Del site of the pig to be tested HNF4A The genomic fragment of the gene was detected by PCR for molecular markers related to piglet growth traits in this region. The 152bp PCR product obtained was recorded as genotype AA, indicating an A individual; the 172bp PCR product obtained was recorded as genotype BB, indicating an B individual; and the 152bp and 172bp PCR products obtained at the same time were recorded as genotype AB, indicating a heterozygous individual. Step 2: If the pigs to be tested are from a civilian population, eliminate individuals with B and retain individuals with A and heterozygous individuals; If the pigs to be tested are from the Landrace group, the heterozygous individuals and individuals with B will be eliminated, and individuals with A will be retained; Among them, the primer sequences required for PCR detection of molecular markers related to piglet growth traits in this region are as follows: HNF4A- 20bp insertion - F:GAATGACAGACGAGCCCG; HNF4A-2 0 bp insertion-R: CAGGACGCCAAGAGGAAG.

4. The use according to claim 3, characterized in that Obtain the In / Del site of the pig to be tested HNF4A The genomic fragment of the gene was amplified using the genomic DNA of the pig to be tested as a template using the following primer pairs: HNF4A-1F: CCGATTAACCATTAACCC; HNF4A-1R:AAGTCCCAAAGACACCCT.

Images