Functional molecular marker of gene AhWRI1 for regulating and controlling oil content of peanut seed kernel and application of functional molecular marker
By developing a functional molecular marker for AhWRI1, a gene that regulates the oil content of peanut kernels, and using KASP technology to identify LTR retrotransposon polymorphisms in peanut germplasm materials, the problem of regulating the oil content of peanut kernels was solved, resulting in a significant increase in kernel oil content and promoting the improvement of peanut oil yield and quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-03-31
Smart Images

Figure CN121759632A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the functional molecular markers and applications of AhWRI1, a gene regulating the oil content of peanut kernels, and belongs to the field of molecular biology. Background Technology
[0002] Peanuts are an important oilseed crop in my country, with an oil content of around 52% in their kernels, generally higher than other oilseed crops such as soybeans and rapeseed, giving them a significant position in the edible vegetable oil market. Peanut oil is highly popular among consumers due to its rich aroma, good quality, and high nutritional value. With socio-economic development and the improvement of people's living standards, the demand for peanut oil is showing an increasing trend. This study utilizes recombinant inbred line populations to perform QTL mapping on genes regulating peanut kernel oil content and develops functional molecular markers based on these target genes. This can be applied to molecular breeding for increasing peanut kernel oil content, which is of great significance for ensuring the safety of edible vegetable oils in my country.
[0003] The main component of plant seed oil is triglycerides, which are synthesized and stored in oil bodies during seed maturation, providing energy for seed germination and seedling growth. Seed oil biosynthesis is influenced by a complex transcriptional regulatory network, among which the AP2 / EREBP transcription factor WRINKLED1 (WRI1) is a core transcriptional regulator of oil synthesis. Numerous studies have confirmed that AtWRI1 in Arabidopsis plays a crucial role in oil biosynthesis. The oil content of seeds from the Arabidopsis wri1-1 mutant is approximately 80% lower than that of the wild type (WT). Transcriptome sequencing of WT and wri1-1 seeds revealed differential expression of genes involved in glycolysis and core fatty acid synthesis. AtWRI1 directly and positively regulates genes in the oil synthesis pathway, including plastic pyruvate kinase β subunit 1 (AtPKP-β1), biotin carboxyl carrier protein isoform 2 (AtBCCP2), acyl carrier protein 1 (AtACP1), and 3-ketoacyl carrier protein synthase (AtKASI).
[0004] Long terminal repeat-retrotransposons (LTRs) are the most abundant transposon elements in plants. They can insert into or near genes, thereby affecting alternative splicing and epigenetic control. Multiple studies have confirmed the association between retrotransposons and plant phenotypic variation. For example, MdMYB1 is a core transcriptional activator in anthocyanin biosynthesis in apple peel; the insertion of an upstream LTR retrotransposon acts as an enhancer for MdMYB1 expression, resulting in the red peel phenotype in apples.
[0005] Competitive allele-specific PCR (KASP) is a high-throughput genotyping technique based on SNPs that can accurately genotype SNPs and InDel variants at the genomic level. It is currently widely used in agricultural and medical research. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a functional molecular marker for AhWRI1, a gene that regulates the oil content of peanut kernels, and its application.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] The molecular marker for AhWRI1, a gene regulating peanut kernel oil content, is located at the InDel site at 45,716,738-45,718,423 bp on peanut chromosome 8. The sequence of the molecular marker is as follows:
[0009] TAAAATGTTGTAATTTTTTTTTTCAAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTT TGTTACATTGAAAGCCAATTTTTCTTATATTT TGGGAAGATTATATATAACTTATAATTA ATTAACTTTGGATGAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA or
[0010] TAAAATGTTGTAATTTTTTTTTTTAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTTTGTTTACATTGAAAGCCAATTTTTCTTATATTT[-]TGGGAAGATTATATATAACTTATAATTAATTAACTTTGGATGAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA.
[0011] A KASP primer combination for amplifying the molecular marker site, the KASP primer combination comprising:
[0012] WRI-A08-X: 5'-ATTTTTGTTACATTGAAAGCCAA-3'
[0013] WRI-A08-C1:5'-TGCATTGTTCATCCAAAGTTAAT-3'
[0014] WRI-A08-Y: 5'-ATTGAAAGCCAATTTTTCTTATATTTC-3'
[0015] WRI-A08-C2: 5'-TTTCTCTGTCAAAGGTGTTTTCTCA-3'.
[0016] The application of the molecular markers in the identification of oil content in peanut kernels includes:
[0017] (1) Extract DNA from the peanut germplasm material to be identified and perform genotyping on the InDel locus of chromosome 8 (45,716,738-45,718,423 bp) using the SNPLine genotyping platform; (2) In peanut germplasm resources or genetic populations with similar genetic backgrounds, if the genotyping result of the InDel locus is the mutant type DEL:DEL, then the kernel oil content of the peanut germplasm material to be identified is higher than that of the germplasm material with the genotyping result of wild type WT:WT.
[0018] The application of the molecular marker method in molecular breeding of peanuts with high oil content in kernels.
[0019] Beneficial effects of this invention:
[0020] This invention utilizes a recombinant inbred line population (JW-RIL population) created by crossing the peanut variety Jihuatian 1 (JHT1) with the high-generation line W191. Whole-genome sequencing, cluster segregation analysis, and linkage analysis were performed on the trait of peanut kernel oil content to locate a major-effect locus, qSOCA08-2, which explains 25.57-39.40% of the phenotypic variation. Based on the genotypes of 11 heterozygous recombinant single plants generated by self-pollination of the remaining heterozygous single plants and the phenotypes of 11 nearly isogenic lines derived from them, qSOCA08-2 was finely mapped to a 373.2 kb physical region between the KASP markers Tif2.A08.45529685 and Tif2.A08.45902854 on chromosome 8. This region contains 26 genes. Based on the functional annotations, sequence differences, expression patterns, and functions of other orthologous genes in plants, Ah08g309800, which is predicted to encode the transcription factor WRINKLED1, is a candidate gene for qSOCA08-2 and is named AhWRI1 (Arachis hypogaea WRINKLED1).
[0021] The 1686-bp sequence of the fourth intron of AhWRI1 is an LTR retrotransposon exhibiting insertion / deletion polymorphism between parents. This retrotransposon functions as an epigenetic silencer of AhWRI1 expression. Based on the LTR retrotransposon insertion / deletion polymorphism, the KASP molecular marker was successfully developed and its association with kernel oil content was validated in the Yuhua 15×Yueyou 20 recombinant inbred line population and germplasm resources, demonstrating the accuracy of the marker and its applicability to marker-assisted selection breeding for high oil content in peanut kernels. Attached Figure Description
[0022] Figure 1 Fine mapping of the major site qSOCA08-2 for oil content in peanut kernels;
[0023] Figure 2 Analysis of AhWRI1 gene sequence and expression pattern;
[0024] Figure 3 Effect of AhWRI1 overexpression on oil content in Arabidopsis thaliana seeds;
[0025] Figure 4 A schematic diagram of the functional markers of AhWRI1 in the genotypic analysis of peanut planting resources and its correlation with kernel oil content;
[0026] Figure 5 A schematic diagram of the functional marker AhWRI1 in the analysis of the genotype of the Yuhua 15×Yueyou 20 recombinant inbred line population and its association with the oil content of the kernel. Detailed Implementation
[0027] The specific embodiments of the present invention will be further described in detail below with reference to examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment, the reagents are all commercially available conventional reagents, and the experimental methods are all conventional methods.
[0028] Example 1: Obtaining the major effective site qSOCA08-2 for oil content in peanut kernels
[0029] (1) Planting and phenotypic determination of JW-RIL population under multiple environments
[0030] A peanut-derived RIL population comprising 554 F8 generations was constructed using the peanut variety Jihua Tian 1 (JHT1, with an oil content of approximately 47%) and the high-generation line W191 (with an oil content of approximately 56%) as experimental materials. In 2024, the JW-RIL population was planted in three environments: Xinxiang, Weifang, and Tangshan. After the peanuts matured, they were naturally sun-dried. Approximately 20 mature, plump kernels free from pests and diseases were selected from each line, and their oil content was measured.
[0031] (2) Preliminary localization of the major site qSOCA08-2 for oil content in kernels
[0032] Based on the phenotypic data of kernel oil content in the JW-RIL population under three environmental conditions, 40 extremely high oil content lines and 40 extremely low oil content lines were selected to construct extreme mixed pools for whole-genome sequencing. After comparison with the reference genome, a total of 249,826 homozygous and polymorphic SNPs and InDel loci were identified in both parents. Four algorithms—Δ (SNP-index), G-statistic, Euclidean distance, and Fisher's exact test—were used to perform association analysis on the detected high-quality SNPs and InDel loci. A 99% confidence level was used as the screening threshold to obtain confidence intervals associated with the oil content trait.
[0033] The Δ (SNP-index) algorithm yielded one confidence interval on chromosome 8, located at 37.63–51.53 Mb; the G-statistic algorithm yielded two confidence intervals on chromosome 8, located at 37.51–46.73 Mb and 47.18–51.53 Mb respectively; the Euclidean distance algorithm yielded one confidence interval on chromosome 8, located at 37.56–51.53 Mb; and Fisher's exact test yielded two confidence intervals on chromosome 8, located at 38.42–45.93 Mb and 46.72–50.35 Mb respectively.
[0034] Combining the results from four algorithms, the 37.51-51.53 Mb (14.02 Mb) region on chromosome 8 was ultimately identified as a candidate QTL region. Molecular markers were designed based on the homozygous polymorphic SNP sites between parents within this candidate region. Genotypic analysis was performed on the JW-RIL population, and a linkage map was constructed. Phenotypic data from three environments were then used to locate the QTL for kernel oil content. The major-effect locus qSOCA08-2 for kernel oil content was located within a 1.04 Mb region between markers Tif2.A08.45529685 and Tif2.A08.46571311, with a LOD value ranging from 20.78 to 35.48, explaining 25.57%-39.40% of the phenotypic variation.
[0035] Example 2: Fine mapping and candidate gene analysis of qSOCA08-2
[0036] (1) Phenotypic analysis of near-isogenic lines
[0037] A heterozygous plant (RHL_238, heterozygous in the qSOCA08-2 region) was selected from the JW-RIL population and self-crossed to the F8 generation. Homozygous plants within the region that did not undergo recombination were then selected to construct the near-isogenic line NIL_238. Peanut 40K SNP microarray analysis revealed that the NIL_238A line (with the same qSOCA08-2 region genotype as the low-oil-content parent JHT1) and the NIL_238B line (with the same qSOCA08-2 region genotype as the high-oil-content parent W191) shared 99.83% genetic background similarity. Phenotypic analysis showed that qSOCA08-2 only regulates kernel oil content, without significantly affecting other important agronomic traits. This also confirmed the reliability of the NIL_238 construction and its potential for fine mapping of qSOCA08-2.
[0038] (2) Fine mapping and candidate gene analysis of qSOCA08-2, the major site for oil content in kernel seeds.
[0039] RHL_238 was self-crossed to the F8 generation. Molecular markers developed from 13 SNP sites that differed between the parents in the qSOCA08-2 region were used to screen for 11 heterozygous recombinant single plants in the remaining heterozygous region. Self-crossing was continued to the F9 generation, and homozygous single plants in the region were screened to construct 11 near-isogenic lines. In the F9 generation of RHL_238_13, RHL_238_36, RHL_238_56, and RHL_238_66, the kernel oil content of plants with the same remaining heterozygous region as the maternal genotype and those with the same paternal genotype did not differ significantly, indicating that the candidate gene for qSOCA08-2 is located between markers Tif2.A08.45529685 and Tif2.A08.46571311. Similarly, in the F9 generation of RHL_238_58, the kernel oil content of plants with the same remaining heterozygous region as the maternal genotype and those with the same paternal genotype did not differ significantly, indicating that qSOCA08... The candidate gene for qSOCA08-2 is located between markers Tif2.A08.42151449 and Tif2.A08.45902854. Among the F9 generation plants of RHL_238_7, RHL_238_22, RHL_238_33, RHL_238_41, RHL_238_52, and RHL_238_62, the kernel oil content of plants with the same genotype as the maternal parent and plants with the same genotype as the paternal parent in the remaining heterozygous region differed significantly, indicating that the candidate gene for qSOCA08-2 is located between markers Tif2.A08.44888621 and Tif2.A08.46571311. In summary, based on the genotypes of the 11 heterozygous recombinant single plants and the phenotypes of the 11 nearly isogenic lines derived from them, it is shown that the candidate gene of qSOCA08-2 is located in a 373.2 kb physical interval between markers Tif2.A08.45529685 and Tif2.A08.45902854. Figure 1 A).
[0040] According to the annotations of the peanut cultivar reference genome version Arahy.Tifrunner.gnm2.ann2.PVFB, the 373.2 kb physical region contains 26 predicted genes ( Figure 1B). Using resequencing data from parental JHT1 and W191, sequence differences in gene regions and promoters (2000 bp upstream of the transcription start site) of 26 predicted genes were compared. Sequence differences were found in the promoter regions of 10 genes, including Ah08g309000, Ah08g309100, Ah08g309500, Ah08g309600, Ah08g309700, Ah08g309800, Ah08g310000, Ah08g310200, Ah08g310800, and Ah08g310900. Sequence differences were also found in the promoter regions of Ah08g308600, Ah08g308900, and Ah08g310800. Sequence differences were found in the UTR regions of three genes. SNPs leading to missense mutations were present in the coding regions of three genes (Ah08g308900, Ah08g310100, and Ah08g310800). Sequence differences were also found in the intron regions of four genes (Ah08g309100, Ah08g309800, Ah08g310000, and Ah08g310800). Expression pattern analysis revealed high expression of Ah08g309600 and Ah08g309800 in the embryo, suggesting their important role in kernel development.
[0041] Based on the functional annotations, sequence differences, expression patterns, and functions of orthologous genes in other plants, Ah08g309800, which encodes the transcription factor WRINKLED1, is predicted to be a candidate gene for the major site qSOCA08-2 of kernel oil content, and is named AhWRI1 (Arachis hypogaea WRINKLED1).
[0042] (3) Analysis of the gene sequence and expression pattern of candidate gene AhWRI1
[0043] AhWRI1 is 10726 bp in length (Arahy.Tifrunner.gnm2.Arahy.08:45710208..45720933), containing eight exons and seven introns. Figure 2 A). Using primers (5'-TTAGAATATTGTATCGCGTGCATTG-3' (SEQ ID NO.7) and 5'-GTATAAGAGGTCGCGAGTTCGAA-3' (SEQ ID NO.8)), sequences containing LTR retrotransposons in the AhWRI1 intron region of JHT1 and W191 were amplified. The PCR products were electrophoresed on a 1.2% (w / v) agarose gel, and the fragment length amplified from JHT1 was greater than that amplified from W191. Figure 2B), the target fragment was gel-recovered and ligated into the PMD20-T vector, and confirmed by Sanger sequencing. Compared with JHT1, the AhWRI1 gene of W191 has a 1686 bp deletion in the fourth intron region 2511 bp downstream of the start codon, which is a Copia-like LTR retrotransposon with two target repeat sites (TSD) (ATATT). Figure 2 A).
[0044] Epigenetic changes induced by intron transposons, such as triggering the formation of transcriptionally repressive heterochromatin, often affect the transcriptional regulation of surrounding genes and produce new expression patterns. Peanut seeds were collected at 35, 45, 55, 65, and 75 days after flowering (DAF) and separated into seed coat and embryo. Total RNA was extracted and reverse transcribed to obtain cDNA. The transcriptional level of AhWRI1 in the seed coat and embryo at the five developmental stages was analyzed by real-time quantitative reverse transcription PCR. Figure 2 C). The reaction system for real-time quantitative reverse transcription PCR was 20 µl: 1 µl cDNA, 10 µl ChamQ Universal SYBR qPCR Master Mix, 0.5 µl each of upper and lower primers (10 µmol / L), and 8 µl RNase-free ddH2O. The amplification program was: 95 ℃ pre-denaturation for 30 s; 95 ℃ denaturation for 10 s, 60 ℃ annealing for 30 s, 40 cycles; 95 ℃ denaturation for 15 s, 60 ℃ annealing for 60 s, 95 ℃ denaturation for 15 s, and melting curve acquisition. Peanut AhADH3 (RT-qPCR primers: 5'-GACGCTTGGCGAGATCAACA-3' (SEQ ID NO. 9) and 5'-AACCGGACAACCACCACATG-3' (SEQ ID NO. 10)) was used as an internal reference gene, and AhWRI1 (RT-qPCR primers: 5'-TGGCAGATCCAGCAAATTTAGGT-3' (SEQ ID NO. 11) and 5'-CATGTTGAACTCGGATAATTCGGC-3' (SEQ ID NO. 12)) was used with 2 ΔCT The relative gene expression levels (AhWRI1 / AhADH3) were calculated and the differences were analyzed for significance.
[0045] During seed development, AhWRI1 is almost not expressed in the seed coat, but is highly expressed in the embryo; the transcriptional level of AhWRI1 differs significantly among embryos at all developmental stages of JHT1 and W191. Figure 2C). It is speculated that the AhWRI1 LTR retrotransposon insertion / deletion polymorphism is a causal sequence variation of the major effect site qSOCA08-2 for peanut kernel oil content, and that the upregulation of AhWRI1 increases the oil content of peanut kernels.
[0046] Figure 2 Analysis of the AhWRI1 gene sequence and expression pattern, where A: schematic diagram of the AhWRI1 gene structure; B: PCR amplification and agarose gel electrophoresis confirmed the LTR retrotransposon insertion / deletion polymorphism of AhWRI1 between parents; C: real-time quantitative reverse transcription PCR determined the transcription level of AhWRI1 in the seed coat and embryo at 35, 45, 55, 65 and 75 days after flowering. ***, P < 0.001.
[0047] (4) AhWRI1 heterologous overexpression in Arabidopsis thaliana
[0048] To clarify the biological function of AhWRI1 in regulating seed lipid synthesis, transgenic lines overexpressing AhWRI1 were created in Arabidopsis thaliana Col-0 background. T2 generation seeds were seeded on 1 / 2 MS medium containing Basta antibiotic. The number of positive and negative seedlings was counted, and based on Mendelian genetics, three single-copy AhWRI1-overexpressing Arabidopsis thaliana lines were screened. Generations were continued to T3, and homozygous single plants were selected for transplantation to obtain homozygous AhWRI1-overexpressing lines.
[0049] The transcriptional level of AhWRI1 in three T3 generation homozygous lines (OE-9, OE-10, and OE-11) was analyzed by RT-qPCR. Total RNA was extracted from seedlings of Col-0 (wild-type) and the overexpression homozygous lines OE-9, OE-10, and OE-11 two weeks after germination, and reverse transcribed into cDNA for quantitative real-time reverse transcription PCR analysis. The reaction system and amplification procedure were the same as those described in the section on the analysis of AhWRI1 transcriptional levels in peanut seed coat and embryo.
[0050] Using Arabidopsis thaliana AtACTIN7 (5'-CCTCAGCACCTTCCAACAGATG-3' (SEQ ID NO.13) and 5'-AACTCACCACCACGAACCAGAT-3' (SEQ ID NO.14)) as internal reference genes, the relative expression level of AhWRI1 was analyzed. The total fatty acid content in seeds was positively correlated with the relative expression level of AhWRI1: compared with Col-0, OE-9 had the lowest relative expression level of AhWRI1, with a significant increase of 5.17% in total fatty acid content; OE-10 had a moderate relative expression level of AhWRI1, with a significant increase of 8.28% in total fatty acid content; and OE-11 had the highest relative expression level of AhWRI1, with a significant increase of 11.24% in total fatty acid content. Figure 3A and Figure 3 B). This indicates that overexpression of AhWRI1 promotes oil biosynthesis in Arabidopsis seeds.
[0051] Fatty acid composition analysis showed that, compared with Col-0, the contents of oleic acid (C18:1) and erucic acid (C22:1) in the three strains OE-9, OE-10, and OE-11 were significantly increased. Figure 3 (C) indicates that overexpression of AhWRI1 promotes the synthesis of oleic acid and erucic acid in Arabidopsis seeds, suggesting that AhWRI1 may regulate seed oil content by affecting the content of oleic acid and erucic acid in fatty acids.
[0052] Figure 3 The effect of AhWRI1 overexpression on the oil content of Arabidopsis seeds was investigated. A: transcriptional level of AhWRI1 in transgenic lines was analyzed by real-time quantitative reverse transcription PCR; B: total fatty acid content in seeds of Col-0 and transgenic lines; C: fatty acid composition in seeds of Col-0 and transgenic lines. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
[0053] Example 3: Development and Validation of Functional Molecular Markers for the AhWRI1 Gene
[0054] (1) Development of functional molecular markers for the AhWRI1 gene
[0055] The AhWRI1 gene exhibits an LTR retrotransposon insertion / deletion sequence polymorphism in its fourth intron region, located at 45,716,738-45,718,423 bp on chromosome 8 (reference genome Tifrunner V2.0). The sequence preceding and following this site within 100 bp is SEQ ID NO.1.
[0056] TAAAATGTTGTAATTTTTTTTTTCAAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTT TGTTACATTGAAAGCCAATTTTTCTTATATTT TGGGAAGATTATATATAACTTATAATTA ATTAACTTTGGATGAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA
[0057] If the LTR retrotransposon is missing, the molecular marker sequence is SEQ ID NO.2:
[0058] TAAAATGTTGTAATTTTTTTTTTCAAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTT TGTTACATTGAAAGCCAATTTTTCTTATATTT [-] TGGGAAGATTATATATAACTTATAATTAATTAACTTTGGAT GAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA .
[0059] KASP markers were designed based on the insertion / deletion sequence differences of LTR retrotransposons between parents, including four primer sequences:
[0060] WRI-A08-X: 5'-ATTTTTGTTACATTGAAAGCCAA-3' (SEQ ID NO. 3);
[0061] WRI-A08-C1: 5'-TGCATTGTTCATCCAAAGTTAAT-3' (SEQ ID NO.4);
[0062] WRI-A08-Y: 5'-ATTGAAAGCCAATTTTTCTTATATTTC-3' (SEQ ID NO.5);
[0063] WRI-A08-C2: 5'-TTTCTCTGTCAAAGGTGTTTTCTCA-3' (SEQ ID NO. 6).
[0064] The PCR reaction system consisted of 1 μL of genomic DNA (~10 ng / μL), which was dried and then mixed with 1 μL of 1×Master Mix and KASP primers. The primer volume was approximately 1.4% of the total reaction system.
[0065] KASP primer mixing solution: Prepare stock solutions of each of the four primers at a concentration of 100 μmol / L. The KASP primer mixing solution ratio is X:C1:Y:C2:water = 15:15:15:15:40.
[0066] The PCR amplification program was as follows: 94 ℃ pre-denaturation for 15 min; 94 ℃ denaturation for 20 s, 61 ℃-55 ℃ extension for 1 min, 10 cycles; 94 ℃ denaturation for 20 s, 55 ℃ extension for 1 min, 26 cycles; store at 10 ℃.
[0067] (2) Verification of functional molecular markers of the AhWRI1 gene in peanut germplasm resources
[0068] DNA was extracted from 353 peanut germplasm resources. Using the AhWRI1 gene as a functional molecular marker, genotyping was performed on the InDel site (LTR retrotransposon insertion / deletion polymorphism in the AhWRI1 intron region) on chromosome 8 of the 353 germplasm resources via the SNPLine platform. Figure 4 A).
[0069] Of the 353 materials, 214 materials had LTR retrotransposons in the AhWRI1 intron region (genotype WT:WT), with an average kernel oil content of 50.88%; 139 germplasms lacked LTR retrotransposons in the AhWRI1 intron region (genotype DEL:DEL), with an average kernel oil content of 52.10%. Compared to germplasms carrying LTR retrotransposons, germplasms lacking LTR retrotransposons had a significantly increased kernel oil content of 2.40%. Figure 4 B).
[0070] Figure 4 A is a schematic diagram illustrating the analysis of the germplasm genotype of peanut natural populations using the AhWRI1 functional marker. Figure 4 B is a schematic diagram illustrating the association between the functional marker AhWRI1 and the germplasm genotype of peanut natural populations and the oil content of kernels.
[0071] (3) Verification of the functional molecular marker of AhWRI1 gene in a population of Yuhua 15 × Yueyou 20 recombinant inbred lines
[0072] DNA was extracted from each line in the Yuhua 15×Yueyou 20 recombinant inbred line population. Genotyping was performed on the InDel site (LTR retrotransposon insertion / deletion polymorphism in the AhWRI1 intron region) on chromosome 8 of each line using the SNPLine platform. Figure 5 A).
[0073] The results showed that 104 lines had LTR retrotransposons in the AhWRI1 intron region (genotype WT:WT), with an average kernel oil content of 53.82%; 124 lines had LTR retrotransposons deleted in the AhWRI1 intron region (genotype DEL:DEL), with an average kernel oil content of 54.88%. Compared with lines carrying LTR retrotransposons, the kernel oil content of lines with deleted LTR retrotransposons was significantly increased by 1.97%. Figure 5 B).
[0074] Figure 5A is a schematic diagram of the genotypic analysis of the population of Yuhua 15×Yueyou 20 peanut recombinant inbred lines, based on the functional marker AhWRI1. Figure 5 B is a schematic diagram illustrating the association between the functional marker AhWRI1 and the oil content of peanut recombinant inbred lines Yuhua 15×Yueyou 20.
Claims
1. A molecular marker of peanut kernel oil content regulating gene AhWRI1, characterized in that, The molecular marker is located at the InDel site of 45,716,738-45,718,423 bp of peanut chromosome 8, and the sequence of the molecular marker is: TAAAATGTTGTAATTTTTTTTTTTACAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTTTGTT ACATTGAAAGCCAATTTTTCTTATATTT TGGGAAGATTATATATAACTTATAATTAATTA ACTTTGGATGAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA or TAAAATGTTGTAATTTTTTTTTTTACAAAATCCTAAAAAATTAAAATACAATCCAAGCATGCAATTTTTGTTACATTGAAAGCCAATTTTTCTTATATTT[-]TGGGAAGATTATATATAACTTATAATTAATTAACTTTGGATGAACAATGCAGATGGAAACATATGCCAAGGAAATTGAGGAAATGAAGGATGTTTCACAA.
2. A KASP primer combination for amplifying the molecular marker locus of claim 1, wherein, The KASP primer combination comprises: WRI-A08-X: 5'-ATTTTTGTTACATTGAAAGCCAA-3' WRI-A08-C1: 5'-TGCATTGTTCATCCAAAGTTAAT-3' WRI-A08-Y: 5'-ATTGAAAGCCAATTTTTCTTATATTTC-3' WRI-A08-C2: 5'-TTTCTCTGTCAAAGGTGTTTTCTCA-3'.
3. The use of the molecular marker according to claim 1 for identifying oil content in peanut kernels, characterized in that, It comprises: (1) Extracting the DNA of the peanut germplasm material to be identified, and genotyping the InDel site of 45,716,738-45,718,423 bp of chromosome 8 of the peanut germplasm material to be identified through the SNPLine genotype analysis platform; (2) In the peanut germplasm resources or genetic population materials with similar genetic backgrounds, if the genotype analysis result of the InDel site is mutant DEL:DEL, then the oil content of the seed kernel of the peanut germplasm material to be identified is higher than that of the germplasm with the genotyping result of wild type WT:WT.
4. The application of the molecular marker method of claim 1 in the molecular breeding of high-oil-content peanut seed kernels.